ID: 945780402

View in Genome Browser
Species Human (GRCh38)
Location 2:214164378-214164400
Sequence GATACACATGAGCAGACACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 124}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945780402 Original CRISPR GATACACATGAGCAGACACC TGG Intronic
900137407 1:1123900-1123922 CATACACTTGAGCACACACCTGG + Intergenic
900781756 1:4623224-4623246 GACACACATGCACAGTCACCTGG + Intergenic
901151634 1:7107246-7107268 CATACACATGCACACACACCAGG - Intronic
903806569 1:26009947-26009969 GAGACACATGAGGAAACACCAGG + Intergenic
906773807 1:48510461-48510483 GATACATGTGAGCAGCAACCAGG + Intergenic
906853665 1:49281402-49281424 GATTCCCATGTGCACACACCAGG + Intronic
906888150 1:49675370-49675392 GATACACATGAACATACAGAGGG + Intronic
915030393 1:152875264-152875286 TGTACACATGTGCACACACCTGG + Intergenic
915947386 1:160163529-160163551 GATACAGATGAGCAGTCATATGG + Intronic
920266181 1:204725151-204725173 GATACAGATGAGCAGCCAGATGG + Intergenic
923112736 1:230905081-230905103 GATACACATGAACAGCCAAATGG - Intergenic
1075422301 10:122310618-122310640 GAGACAGAGGAGCAGACCCCAGG + Intronic
1079409767 11:20176379-20176401 GTTACACATGAGTAGAAACTGGG - Intergenic
1085042717 11:73335951-73335973 GATCCATAAGAGCAGAGACCAGG - Intronic
1085412950 11:76302349-76302371 GAAACAGAAGAGCAGAAACCGGG + Intergenic
1088737279 11:112738068-112738090 GATACACATGAACTGACTCCAGG - Intergenic
1088988901 11:114934120-114934142 GGTACACATGAGCAGCCATGGGG + Intergenic
1089673320 11:120072249-120072271 GATACAGATGGGGAGACCCCAGG + Intergenic
1089683505 11:120132605-120132627 GACACACCTGAGCACCCACCCGG + Intronic
1090325134 11:125879507-125879529 GATACAGATGAACAGCCAGCTGG + Intergenic
1091186692 11:133653825-133653847 CAGACACATGAGCAGAACCCAGG - Intergenic
1097137984 12:56875327-56875349 GATACACATGAACAGCCAGATGG - Intergenic
1097391084 12:59014162-59014184 TATACCCATCAGCAGACTCCTGG + Intergenic
1097392076 12:59027028-59027050 GATGCACATCATCAGACACTTGG - Intergenic
1098393244 12:69991730-69991752 GCTGCACAGGAGCAGACACTGGG - Intergenic
1099773331 12:87092853-87092875 GGTACCCAAGAGCAAACACCAGG - Intergenic
1104881616 12:132075250-132075272 GACACAGCTGACCAGACACCAGG - Intronic
1106127404 13:26911656-26911678 GATAAAAATGAGCAGAGGCCGGG + Intergenic
1113778913 13:112964450-112964472 CATCCACATGAGCAGACACAGGG - Intronic
1122615462 14:103014728-103014750 AATACACATCAGCAGAGATCAGG + Intronic
1122639728 14:103151832-103151854 AATGCCCAGGAGCAGACACCAGG - Intergenic
1122884766 14:104706128-104706150 GGTCGACATGAGCAGCCACCAGG + Exonic
1123695250 15:22874351-22874373 GATTCAGATGAGCTAACACCTGG - Intronic
1130153571 15:81331009-81331031 GTTAGACATGAGCAGACAGTGGG + Intergenic
1131425247 15:92340591-92340613 GATACACATTTGCAGCCTCCAGG - Intergenic
1133718174 16:8469176-8469198 AATACACCAGAGCAGACACATGG - Intergenic
1133780618 16:8936241-8936263 GATACGCATGGGCCAACACCTGG + Intronic
1134978963 16:18592100-18592122 TAGACACATAAGGAGACACCAGG - Intergenic
1137556775 16:49475210-49475232 CACACACACGAGCACACACCAGG - Intergenic
1140521618 16:75586731-75586753 CAAACACATGTGCAGACACCTGG + Intergenic
1142151055 16:88512734-88512756 GGGACAGATGAGCACACACCAGG + Intronic
1143388429 17:6545848-6545870 GTTCCCCCTGAGCAGACACCTGG + Intronic
1143831564 17:9656153-9656175 GATACACATCAGCAGTCCTCTGG + Intronic
1145207470 17:20992280-20992302 CATGCACATACGCAGACACCCGG + Intergenic
1145895299 17:28453982-28454004 GATACAGATGAGCAGCCACATGG + Intergenic
1149347541 17:55753257-55753279 GATAGACAGGAGCAGAGAGCTGG - Intronic
1150899699 17:69258505-69258527 GATACACATGAACATAAACATGG + Intronic
1151949630 17:77343450-77343472 GATACAAATGAACAGCCAACTGG - Intronic
1152746525 17:82042656-82042678 GACACACATGAGCATTCACACGG + Intergenic
1152746546 17:82042844-82042866 GACACACATGAGCATGCACACGG + Intergenic
1153434695 18:5057123-5057145 GATACACATGAACATAAACATGG + Intergenic
1155049770 18:22136506-22136528 GATTCACATGAGAAAACAGCTGG + Intergenic
1156516134 18:37682289-37682311 GATACACATGAAAAAACACAGGG + Intergenic
1159017655 18:63114786-63114808 GATACAGATGAAGAGACACGTGG - Intergenic
1159216249 18:65394300-65394322 GAGACACATGGGCAGAGTCCAGG - Intergenic
1159225398 18:65527371-65527393 GATACACACATGTAGACACCAGG - Intergenic
1160221835 18:76983796-76983818 GATCCACATGAGCACAGACATGG - Intronic
1161111924 19:2475492-2475514 AATACACATCAGCTGTCACCTGG - Intergenic
928895734 2:36260780-36260802 GATACACATCACGAAACACCAGG - Intergenic
930873682 2:56191149-56191171 GAAACATTTGAGCAGGCACCTGG - Intronic
931393974 2:61869596-61869618 AATACACATCAGCAGCCACGTGG + Intronic
931848930 2:66233828-66233850 AATACACATAGGCACACACCTGG - Intergenic
931992067 2:67800547-67800569 GATACACATGTCCAGGCACAGGG + Intergenic
935620818 2:105128089-105128111 GAGACACATGAGGAAACACCAGG + Intergenic
936228605 2:110680148-110680170 GTTCAACATGAGCAGCCACCGGG - Intergenic
936343783 2:111659835-111659857 GATACAAATGAGCAGCCAGATGG - Intergenic
937979679 2:127607615-127607637 GATGCAAATTAGCAGGCACCTGG + Intronic
942293383 2:174494606-174494628 GAAACACAAGAGCATTCACCAGG + Intergenic
945204023 2:207312530-207312552 GTGACACATGAGCTGACGCCAGG - Intergenic
945247371 2:207730834-207730856 TATACACAGGAGCAGGCAACAGG - Intronic
945780402 2:214164378-214164400 GATACACATGAGCAGACACCTGG + Intronic
945990130 2:216389148-216389170 GAAACACATGAGCTGAGACTTGG - Intergenic
946288149 2:218721102-218721124 GATACAGATGAACAGCCACATGG - Intronic
1168855120 20:1002555-1002577 GGTACAGATGCGCGGACACCCGG + Intergenic
1169033102 20:2428411-2428433 GATACACATGAGCAGAGCTTTGG - Intronic
1175096374 20:56544480-56544502 GATACAGATGATCAGCCAGCCGG - Intergenic
1175691291 20:61067676-61067698 CACACACCTGAGCAGACTCCAGG - Intergenic
1175764105 20:61581261-61581283 GTTACAGATGAGCACAAACCAGG + Intronic
1176091102 20:63319014-63319036 GAGGCACATGAGCAGACCCAAGG - Intronic
1176270287 20:64232669-64232691 GCCACACATGAGCAGAGCCCTGG + Intronic
1178664427 21:34534160-34534182 GGTACCCATGAGGAGACAGCTGG + Intronic
1181174997 22:21030250-21030272 GGTGCACATGGGCAAACACCTGG + Exonic
1181830044 22:25553305-25553327 GATACAGATGAGCAGCCAGGTGG + Intergenic
953657152 3:44862701-44862723 GATACACCTTAGCAGACGCCAGG - Intronic
953714513 3:45306455-45306477 CACACACATGAGCAGAGAGCTGG + Intergenic
955801626 3:62692890-62692912 GATACAGATGAGAAGAGACCTGG - Intronic
961666230 3:128494567-128494589 CAGACACATGGGCAAACACCTGG - Intergenic
962989625 3:140566303-140566325 GATAGACATGGGCATACACTGGG - Exonic
963556819 3:146801617-146801639 AATACACATTTGCAGACATCAGG - Intergenic
964960449 3:162417293-162417315 GAGACAAATGAGAAGACACAAGG + Intergenic
965778213 3:172255886-172255908 GAAACGTATGAGGAGACACCAGG - Intronic
965867712 3:173225747-173225769 GATACAGATGAACAGACAGATGG + Intergenic
966170731 3:177077032-177077054 TATCCAAATGAGCAGACAACTGG + Intronic
967581105 3:191155899-191155921 CATAGACATGGGAAGACACCTGG - Intergenic
970487523 4:16539548-16539570 GAAACACATCCGCATACACCAGG + Intronic
972555316 4:40175435-40175457 GATACAAAGTAGCAGACACCTGG + Intergenic
975667940 4:76752553-76752575 GATACATATCAGCAGACTCTGGG + Intronic
978913788 4:114098613-114098635 TATAAAGATAAGCAGACACCAGG - Intergenic
983358358 4:166695302-166695324 GACACACACCAGCAGGCACCTGG - Intergenic
985576092 5:674173-674195 GATACACAGGAGCAGACCCGGGG - Intronic
991395918 5:66205331-66205353 GATACACAAGGGCACACACCAGG - Intergenic
992433297 5:76730905-76730927 GATACAGATGAACAGCCACATGG + Intronic
995751559 5:115457868-115457890 GAGACACACGGGCAGACTCCCGG + Intergenic
998069635 5:139187168-139187190 GATACAGATGAGGACACATCAGG + Intronic
999209473 5:149875236-149875258 GATGCACAGGATTAGACACCAGG - Intronic
1001024314 5:168210714-168210736 GCTACACCTGAGCAGAAATCAGG + Intronic
1006730156 6:36230552-36230574 GATCCACCTGAGCAGAGTCCGGG + Exonic
1011428812 6:87262105-87262127 GTTATACATGAGCAGTGACCTGG - Exonic
1012256305 6:97036746-97036768 GCTTCACATGAGCCCACACCTGG - Intronic
1013274916 6:108574926-108574948 GATAAACGTGAGCAGGCAGCAGG + Intronic
1019165932 6:170097590-170097612 GAAACAAAGGAGCCGACACCTGG + Intergenic
1019868067 7:3731567-3731589 GATGCACCTGAGCAGGCATCTGG + Intronic
1020495092 7:8841189-8841211 GATACTAATGTGCAAACACCAGG + Intergenic
1021050295 7:15974903-15974925 GGAACACATGTGCACACACCAGG - Intergenic
1021143440 7:17055508-17055530 GATACACATCTGCAGACCACAGG - Intergenic
1034495741 7:151421057-151421079 TATAGACATGAGCACCCACCTGG + Intergenic
1039397358 8:37238008-37238030 GATACAGAAGAACACACACCAGG - Intergenic
1044332250 8:90934701-90934723 GATATACCTGAGCGGAAACCTGG + Intronic
1045980791 8:108184944-108184966 TGTACATATGAGAAGACACCAGG + Intergenic
1048331260 8:133472212-133472234 GGGACACAGGAGCAGTCACCAGG - Intronic
1048732219 8:137455366-137455388 GATACATAAGAGAAGACAGCAGG + Intergenic
1051101418 9:13526647-13526669 CAAACATATGAGCAGACTCCTGG - Intergenic
1051168362 9:14291126-14291148 GATATACATAAGCACACACAGGG + Intronic
1052798803 9:32948602-32948624 GATACAGATGAACAGCCAGCTGG + Intergenic
1055821901 9:80276011-80276033 GATCGACATGAACTGACACCTGG + Intergenic
1059959112 9:119547785-119547807 GATACACTTAAGGAGACTCCTGG + Intergenic
1060417898 9:123445520-123445542 CATACCCATGTGCACACACCTGG - Intronic
1061327606 9:129873787-129873809 GATGCACACCAGCACACACCAGG + Intronic
1188066819 X:25672025-25672047 GATAAACTTCAGCAGACATCTGG - Intergenic
1189715986 X:43866784-43866806 GACACAAATGAGCAGACTCTGGG + Intronic
1193254795 X:79335032-79335054 GGTACACATGGGCATAAACCTGG - Intergenic
1193958378 X:87891842-87891864 AAGACACAAAAGCAGACACCAGG + Intergenic
1195821597 X:108951014-108951036 GACCCACATTGGCAGACACCAGG + Intergenic
1199505677 X:148558879-148558901 GAAACCCATGAACAGACACCAGG + Intronic
1200825966 Y:7641480-7641502 AATACACATCTGCAGACATCAGG + Intergenic
1200868785 Y:8074959-8074981 GTAACACATGGGCAGAAACCAGG + Intergenic
1200881816 Y:8221656-8221678 AATACACATTTGCAGACATCAGG + Intergenic
1200956665 Y:8955671-8955693 AATACACATTTGCAGACATCAGG - Intergenic