ID: 945781260

View in Genome Browser
Species Human (GRCh38)
Location 2:214175352-214175374
Sequence AGAGAAATTCTGTGAATAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 730
Summary {0: 1, 1: 0, 2: 5, 3: 65, 4: 659}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945781260 Original CRISPR AGAGAAATTCTGTGAATAAA AGG Intronic
900634124 1:3653283-3653305 AGAGAAAGCCCGTGAAGAAATGG + Intronic
901549983 1:9989002-9989024 AGAGAAATTCTGGGCAGAAGAGG + Intergenic
902454747 1:16524693-16524715 AGACAATTTCTGGGAAGAAAGGG - Intergenic
902497703 1:16885660-16885682 AGACAATTTCTGGGAACAAAGGG + Intronic
903076885 1:20777192-20777214 AGAGACATGCTGTGAAGGAAAGG - Intronic
904222556 1:28984327-28984349 AGAGAAATTCTAGGCAGAAAAGG - Intronic
904262882 1:29300436-29300458 AGAGGAATTCTGTGTTTTAAAGG - Intronic
904550461 1:31312585-31312607 AGAGAATTACTGTGAATAAATGG - Intronic
904930039 1:34080413-34080435 AAAGATATTCTGTGTATGAAAGG - Intronic
905116506 1:35645866-35645888 AGGAAAATTCTCTGAAGAAAAGG - Intergenic
905766994 1:40609690-40609712 AGAGAAATTCTAGGCAGAAAAGG + Intergenic
905778716 1:40688825-40688847 AGAGAGATTCTGTGAACAAAAGG - Intergenic
906984188 1:50665602-50665624 AGAGAAAATATGTAAACAAATGG - Intronic
907063901 1:51460217-51460239 AGAGAAAATCTGAGAGTAAAAGG + Intronic
907279352 1:53335822-53335844 TGAAAAATTCTGTGTATCAAAGG - Intergenic
907897762 1:58708301-58708323 AGATAAACTCTGTGAAAGAATGG + Intergenic
908276752 1:62481022-62481044 AAAAAAAATCTGTGAACAAAAGG + Intronic
909036988 1:70604568-70604590 AGAAAATTTCTGGGAAAAAAAGG - Intergenic
909085043 1:71160685-71160707 AGAGATAATCTCTGGATAAAGGG + Intergenic
909775457 1:79479042-79479064 AGAGAAATTCTAGGCAGAAAAGG - Intergenic
910309733 1:85809894-85809916 ATAAAAATTCTGTAGATAAATGG - Intronic
910448370 1:87321888-87321910 AGAGAATTTTTTTGAATTAATGG - Intergenic
910529377 1:88218121-88218143 AGAGAAATTTGGTGAGTAAACGG + Intergenic
911177883 1:94835063-94835085 AGAGAAATTCTACAAATTAAGGG + Intronic
911761868 1:101626421-101626443 AGAGATATTGTGTAACTAAAAGG + Intergenic
913291080 1:117272596-117272618 AGATAAATTCTGAAAATTAAAGG - Intergenic
913656907 1:120969284-120969306 ACAGAGATTCTGTGAGCAAATGG + Intergenic
914008063 1:143750565-143750587 ACAGAGATTCTGTGAGCAAATGG + Intergenic
914521470 1:148420537-148420559 ACAGAGATTCTGTGAGCAAATGG + Intergenic
914646878 1:149661019-149661041 ACAGAGATTCTGTGAGCAAATGG + Intergenic
915790753 1:158668113-158668135 ACAGAAATTTTGAGAATAAGAGG + Intronic
916158527 1:161884028-161884050 ACAGAATTTCTGTGCATATATGG + Intronic
916691939 1:167198333-167198355 AGAGAGATTCAGTGACTAATTGG + Intergenic
916845510 1:168645932-168645954 ACAGAAATACTGTAATTAAAGGG + Intergenic
917480204 1:175405175-175405197 AGAGAAAACCTGTGCACAAAGGG + Intronic
917493211 1:175516098-175516120 TAAGAAATTTTCTGAATAAATGG - Intronic
917630411 1:176886082-176886104 ACACAAATTCTGTGAAAATATGG + Intronic
917966348 1:180181333-180181355 AGAGAAGTTCTGAGCATAATCGG - Intronic
918562182 1:185881636-185881658 AGAGAAATTCTAGGCAGAAAAGG - Intronic
918598111 1:186317337-186317359 AGAGAAATTTTATTATTAAAAGG - Intronic
918709401 1:187707877-187707899 AGAGAAATTCATTCATTAAATGG + Intergenic
918794921 1:188882055-188882077 AGGGAAAAGATGTGAATAAAAGG + Intergenic
919604741 1:199668191-199668213 AAAGTAATTCTATAAATAAAAGG + Intergenic
920369221 1:205467243-205467265 ACAGAATTTCTGTGATGAAAGGG - Intergenic
920748456 1:208651318-208651340 TGAGAAATTCTGTGAGAAATTGG + Intergenic
921397518 1:214684188-214684210 ACAGTAATTCTGTGAAGTAATGG + Intergenic
921673823 1:217955349-217955371 AGAGAAAGACAGTGAATACAGGG + Intergenic
921679968 1:218020104-218020126 AGAGAAATTCTAGGCAGAAAAGG + Intergenic
921725559 1:218519619-218519641 ACACAAATTCTGAGAATCAAAGG + Intergenic
921762242 1:218929669-218929691 AGAGCCTTTCTGGGAATAAATGG - Intergenic
921825065 1:219663254-219663276 AAAGCATTTCAGTGAATAAATGG - Intergenic
921836492 1:219783914-219783936 GGAAAAATTCTGGCAATAAAAGG - Intronic
921855423 1:219977151-219977173 TTAGAAATTCTTTGACTAAATGG + Intronic
922076614 1:222251398-222251420 AAAGAAACTGTGAGAATAAATGG + Intergenic
922340218 1:224648958-224648980 GAAGAAATTCTGGGAACAAAGGG - Intronic
922711897 1:227840540-227840562 AGAGACAATATGTAAATAAATGG - Intronic
922876397 1:228943051-228943073 AGTGAAATTCTGGGCAGAAAAGG + Intergenic
923385712 1:233463492-233463514 TGGGAAATTTTGAGAATAAAAGG - Intergenic
923639174 1:235735878-235735900 ACAGAAGCTCTGTGAGTAAAAGG + Intronic
923794447 1:237140515-237140537 AAATAAGTTCTGTGAGTAAATGG - Intronic
924197227 1:241620868-241620890 AGAGAAACTCTGTGCATATTGGG + Intronic
924750597 1:246885071-246885093 AGATAAATACCTTGAATAAAAGG - Intronic
924818419 1:247463381-247463403 AGAGAAATTCTAGGCAGAAAAGG - Intergenic
1063014900 10:2066159-2066181 AAAGAAAATGTGTGAATTAATGG + Intergenic
1064527393 10:16271708-16271730 AGAGAAATTTTGTGATCAAATGG - Intergenic
1064927119 10:20581748-20581770 AGAGAAATTCTATGCAGAAAAGG + Intergenic
1065182551 10:23141025-23141047 AGACAAATTCTATGGAGAAATGG + Intergenic
1065290725 10:24226968-24226990 GTAGAAATTCTGTGAATAACTGG - Intronic
1065542191 10:26781434-26781456 AGGGAACCTCTGTGAATCAAGGG - Intronic
1065909307 10:30287477-30287499 AGAGAAATTCTCTGCAGACAGGG - Intergenic
1066449264 10:35513130-35513152 ATAGACATTGTGTGAATACATGG + Intronic
1066682967 10:37953134-37953156 AGAGAAAGCCTGTGAATGTAAGG - Exonic
1066763375 10:38779983-38780005 AGTGAGATTCTGTCAAAAAAAGG - Intergenic
1066826425 10:39591070-39591092 AGTTAAATTCTGTGAATTGAAGG - Intergenic
1066863558 10:40362141-40362163 AGTTAAATTCTGTGAATTGAAGG - Intergenic
1066907426 10:41229265-41229287 AGTTAAATTCTGTGAATTGAAGG - Intergenic
1067288943 10:44927606-44927628 AGAGAACAGCTGTGAATCAAGGG + Intronic
1067457596 10:46431752-46431774 AAAGATAGTCTTTGAATAAATGG - Intergenic
1067482809 10:46615704-46615726 AGAGTCATCGTGTGAATAAAGGG - Intergenic
1067611945 10:47725961-47725983 AGAGTCATCGTGTGAATAAAGGG + Intergenic
1067629603 10:47952882-47952904 AAAGATAGTCTTTGAATAAATGG + Intergenic
1068304174 10:55182331-55182353 AGAGAAAGTCTGTGTATTAATGG - Intronic
1068555973 10:58459324-58459346 AGGGAAATTCTGCCAATAAATGG + Intergenic
1068681222 10:59822733-59822755 AGAGAAATTCTAGGCAGAAAAGG + Intronic
1068850036 10:61727490-61727512 AGAGAAATTCTGTGTATAAGGGG - Intronic
1069160674 10:65088760-65088782 AGTGAAACTCTTGGAATAAAAGG - Intergenic
1070361481 10:75694201-75694223 AGAGAAGTTCTTTGCATAAGTGG + Intronic
1070552570 10:77502250-77502272 AGGGAAATGCTATGAAGAAAAGG - Intronic
1071201535 10:83224116-83224138 AGAGAAATTCTAGGCAGAAAAGG - Intergenic
1071229544 10:83569405-83569427 ATTGGAGTTCTGTGAATAAATGG + Intergenic
1071372806 10:84969696-84969718 ACAAAAATTATGTGAATATATGG + Intergenic
1071376286 10:85008088-85008110 AGAGAAACTGTGTGTATTAAGGG - Intergenic
1071402978 10:85296077-85296099 AAAGATATTCTTTGAACAAATGG - Intergenic
1071428503 10:85583278-85583300 AGAGAAATTCTAGGCAGAAAAGG - Intergenic
1071627363 10:87186196-87186218 AGAGTCATCGTGTGAATAAAGGG + Intronic
1071749956 10:88463910-88463932 AGAGAAATTCTCTTGCTAAATGG - Intronic
1071934013 10:90506569-90506591 AAAGAAATTCAGTGAAAAAATGG - Intergenic
1072827529 10:98622705-98622727 AGAAAAATCCTGAGAATTAACGG + Intronic
1073752408 10:106543862-106543884 AGAGCAATGCTATGAATTAATGG + Intergenic
1074136388 10:110630512-110630534 AGGGAAATTCTGTACAAAAAGGG - Intergenic
1074481622 10:113827041-113827063 AGAGAAATTCTGAAAAGGAAGGG - Intergenic
1074675152 10:115840036-115840058 AGAAATATTTTATGAATAAATGG - Intronic
1075441899 10:122486490-122486512 AGAGCGCTTCTGTGAACAAAGGG - Intronic
1075988584 10:126812212-126812234 AAATAAATTATGTCAATAAATGG + Intergenic
1078111299 11:8395814-8395836 AGAGAAATTCTTCGGATAAATGG + Intronic
1078186600 11:9056873-9056895 TGAGAAACTATGTTAATAAAAGG + Intronic
1079734323 11:23976514-23976536 AGAGAAATTAAGTGACTCAAAGG - Intergenic
1079898449 11:26150446-26150468 AGAGAAATTCTAGGCAGAAAAGG - Intergenic
1080354562 11:31427352-31427374 GTAGAAATTCAGTGAATAATTGG + Intronic
1081011204 11:37814095-37814117 AAAGAAATGCTGGGAATGAAAGG - Intergenic
1081109926 11:39121840-39121862 AGAGAAATTCTAGGCAGAAAGGG - Intergenic
1081942703 11:46957986-46958008 AAAGAAAATCTGTGTATAAGTGG - Intronic
1082952073 11:58828106-58828128 AGAGAAAATATGTGGAGAAAGGG - Intergenic
1083032875 11:59610315-59610337 AAACAAAATCTGTGCATAAAAGG + Intronic
1083701709 11:64483655-64483677 AGAGAAATACTGTTTTTAAAGGG + Intergenic
1084655309 11:70511800-70511822 AGGGAATTTCTGTGAAGAATGGG + Intronic
1084880933 11:72171393-72171415 AAAAAAATTCTGTGTAAAAAAGG - Intergenic
1085818537 11:79768003-79768025 AGACAAAGTCTGGCAATAAAAGG + Intergenic
1085870834 11:80347349-80347371 AGAGAAATTCTAGGCAGAAAAGG - Intergenic
1086064003 11:82728227-82728249 AGAGAAATTGTGTGGAAAAGTGG + Intergenic
1086435099 11:86772268-86772290 AGAGAAATCCTGTCTAAAAAGGG + Intergenic
1086649207 11:89266584-89266606 AGTGGAATTGTGTGAAAAAATGG - Intronic
1086993011 11:93326779-93326801 AGCCAAATTCTTTGAAAAAATGG - Intergenic
1087408517 11:97760587-97760609 AGAAAAATTGTGTAAAGAAACGG + Intergenic
1087559982 11:99776388-99776410 AGAGAAATTTTTTCTATAAATGG - Intronic
1087563637 11:99823502-99823524 AGAGAAAATCTGAAAAAAAAAGG + Intronic
1087608484 11:100405731-100405753 AGAGAAATTCTACGTAGAAAAGG - Intergenic
1087847534 11:102990316-102990338 AGAGTAATTCTCTGACTCAACGG + Intergenic
1087861273 11:103160112-103160134 AGAGAAATTGGTTGAATAAAAGG - Intronic
1088132985 11:106518014-106518036 AAGGAAATTTTGTGAAGAAAGGG + Intergenic
1088500101 11:110474483-110474505 AGAAATATTAAGTGAATAAATGG - Intergenic
1088715385 11:112544277-112544299 AGAGAAATTCTAGGCAGAAAAGG - Intergenic
1089906140 11:122040807-122040829 AGAGGAATTGTGTGATCAAAGGG + Intergenic
1090571949 11:128057034-128057056 AAAGATATTTAGTGAATAAATGG + Intergenic
1090783788 11:130030487-130030509 AATGAAATTCCGTTAATAAAGGG - Intergenic
1091223054 11:133941892-133941914 GGAGAACTTCTCTGAAGAAATGG - Intronic
1091904829 12:4176761-4176783 AGGGAATTTGTGAGAATAAATGG + Intergenic
1092519803 12:9258068-9258090 GGAGAAAGTCTATGAAAAAAAGG + Intergenic
1092552051 12:9513773-9513795 TTAGAAATTCTGGGAATAAGTGG + Intergenic
1092744711 12:11662396-11662418 AGAGAAATTCTCAGAAGAACTGG - Intronic
1093419420 12:18957521-18957543 ACAAAAATTCCGTGAAAAAAGGG + Intergenic
1093438102 12:19161160-19161182 AGAACAATTCTCTGAAGAAAGGG + Intronic
1093798499 12:23342724-23342746 ATAAAACTTCTTTGAATAAATGG + Intergenic
1094088128 12:26616759-26616781 AAAGAAAATCTGTGTATAAGTGG - Intronic
1094308401 12:29048884-29048906 AGAGAAATGCTGAGAAAAGAGGG + Intergenic
1094520070 12:31176849-31176871 TTAGAAATTCTGGGAATAAGTGG - Intergenic
1095305655 12:40636105-40636127 TAAGAAATTCTGTTATTAAAAGG - Intergenic
1095763312 12:45866274-45866296 AGAGTAATCCTGTCAAAAAAAGG - Intronic
1096108486 12:49013614-49013636 AGAGACAATCTGTGAAAATAAGG - Intronic
1096170288 12:49463008-49463030 AGAGAAATTCTAGGCAGAAAAGG - Intronic
1097947129 12:65382089-65382111 AGACAGATTTTGTGAAGAAAGGG - Intronic
1098094013 12:66935447-66935469 AGACCAATTATGTGATTAAAGGG + Intergenic
1098373354 12:69783654-69783676 AGAGCAAATCTAAGAATAAACGG - Intronic
1098523325 12:71458713-71458735 ATATTAATTGTGTGAATAAACGG - Intronic
1098557196 12:71832867-71832889 AGAGAAAATCAGTGAAACAAAGG - Intergenic
1098775823 12:74614558-74614580 AAATAAATTCTGTCAACAAATGG - Intergenic
1098917481 12:76272589-76272611 AAAGAAATCCTGTTACTAAATGG - Intergenic
1099080631 12:78175811-78175833 AGATAACATCTGTGAATAAATGG + Intronic
1099164827 12:79291818-79291840 AAAGAAATTCCGTGCACAAAAGG + Intronic
1099189572 12:79548556-79548578 TGAGAAACTATGTGTATAAACGG + Intergenic
1099337080 12:81376388-81376410 AGAGGAACTCTGTGGTTAAAAGG + Intronic
1099675028 12:85748161-85748183 AAGGAAATTCTGTATATAAAGGG + Intergenic
1099787953 12:87290961-87290983 AAAGAAAATCTCTGAAAAAAAGG + Intergenic
1099803372 12:87484814-87484836 ACAGAAATTATATGAATCAATGG - Intergenic
1100014897 12:89997286-89997308 AAAGAAATTATGTTATTAAAAGG - Intergenic
1100293005 12:93235431-93235453 AGAGAAATTCTAGGCAGAAAAGG + Intergenic
1100463054 12:94819791-94819813 AGAGAAATCCTATCAACAAAAGG + Intergenic
1100906210 12:99302654-99302676 TGAGAAAGTCAGTGAATAAAGGG - Intronic
1101335087 12:103789852-103789874 AGAAAAATACTATGAAAAAAAGG + Intronic
1102561892 12:113768226-113768248 AGAGAAATACTCTAATTAAATGG + Intergenic
1102609613 12:114099892-114099914 AGAGAAATTCTGGGCAGAAAAGG - Intergenic
1104265778 12:127231440-127231462 AGGGAAATTCTGGGCAGAAAAGG + Intergenic
1104384256 12:128336401-128336423 AGAGACATTCTGTTAGGAAATGG - Intronic
1104388398 12:128370825-128370847 AGTTGAATTCTATGAATAAATGG - Intronic
1104683886 12:130771689-130771711 AGAGAAAGACTGTGAAGAATTGG - Intergenic
1105043670 12:132984005-132984027 AGAGAAAATCTGGGAATGGATGG - Intergenic
1106870179 13:34011159-34011181 AGAGAAATTCTAGGGAGAAAAGG + Intergenic
1107166894 13:37292870-37292892 AGGGAAATTTTGAGAAAAAAGGG + Intergenic
1107314207 13:39113571-39113593 AGATAAATTCTATCAAGAAAAGG - Intergenic
1107645368 13:42489198-42489220 AAAGAACTTCTGTGTATCAAAGG + Intergenic
1107854094 13:44597649-44597671 AGGGAAATTCTGGGAAGAAGAGG - Intergenic
1108184032 13:47870961-47870983 AGAGAAATTAAGAGTATAAATGG + Intergenic
1108263973 13:48685873-48685895 AGGGAAATTCTGTGTATATCAGG + Intronic
1108901711 13:55418182-55418204 AGAGAAACTCCTTGAATACAGGG - Intergenic
1108984517 13:56568327-56568349 AGAAAAATTCTTTAAATAAGAGG - Intergenic
1109150504 13:58841999-58842021 AAAGAAATGATTTGAATAAATGG - Intergenic
1109419973 13:62099603-62099625 AGAGAAATTCTAGGCAGAAAAGG + Intergenic
1109431251 13:62238489-62238511 AGAAAAATTAGATGAATAAATGG - Intergenic
1109888308 13:68573145-68573167 GAAGAAATTCTGAGAACAAATGG - Intergenic
1110066659 13:71115448-71115470 AGAGAGATTAGGAGAATAAAGGG - Intergenic
1110154082 13:72292619-72292641 AGAGAAAATATATGAATAAAGGG + Intergenic
1110411899 13:75214015-75214037 AATGAAATTGTGGGAATAAAAGG + Intergenic
1110753186 13:79139747-79139769 AGAGGAATTCTGGGAAATAAAGG + Intergenic
1110759967 13:79220820-79220842 AGGAAACTTATGTGAATAAATGG - Intergenic
1110780888 13:79463377-79463399 AGACAAATCTTGTGCATAAAGGG - Intergenic
1110846386 13:80194759-80194781 AAAGAAACTCTCTGATTAAAGGG - Intergenic
1110862891 13:80362991-80363013 AGTTCAATTATGTGAATAAATGG + Intergenic
1111025608 13:82517544-82517566 AGAGAAAATCTATGTATATATGG - Intergenic
1111155520 13:84318160-84318182 AGAGAAATCAGATGAATAAATGG + Intergenic
1111183974 13:84704989-84705011 AGACACAGTGTGTGAATAAAAGG + Intergenic
1111539696 13:89654681-89654703 ATATAAATTGTATGAATAAATGG + Intergenic
1111606476 13:90546066-90546088 AGAGAAATTCTAGGCAGAAAAGG - Intergenic
1112677285 13:101716741-101716763 CGAGAAATACTGTGATAAAATGG + Exonic
1113192629 13:107767766-107767788 AGAAAAATTCTGTTATAAAAAGG - Intronic
1115408204 14:33042798-33042820 AAATAAACACTGTGAATAAAAGG - Intronic
1115945296 14:38653061-38653083 AGAGACAGTCTGTCCATAAAGGG - Intergenic
1116121394 14:40725255-40725277 AGAGAAATACTGGGTAGAAAAGG - Intergenic
1116745039 14:48807056-48807078 TGAGAAATGATGTGAACAAATGG - Intergenic
1116774129 14:49160392-49160414 AGAGAAGCTCTGGAAATAAATGG - Intergenic
1116963707 14:50993011-50993033 GGAAAGCTTCTGTGAATAAATGG + Intronic
1116997064 14:51335375-51335397 AGAGAAATTCAGGCAAGAAAAGG + Intergenic
1117166003 14:53034220-53034242 AGACAAATTCTATTAATATAAGG - Intergenic
1117180126 14:53182953-53182975 AGACAAATTATGTGGATAAAGGG + Intergenic
1117265265 14:54079795-54079817 AGATAAATTCTGTGTAGAAGGGG + Intergenic
1117549688 14:56822196-56822218 AGACAAAGTCTGGGAATATAAGG - Intergenic
1117784989 14:59274001-59274023 AGAGGAATTCTGGGAATTGAAGG - Intronic
1118073535 14:62272246-62272268 AGACAAATTCTTTCAATCAATGG - Intergenic
1118286411 14:64477978-64478000 AGAGAGATTCTCTGTACAAATGG - Intronic
1118361181 14:65058179-65058201 AGAAAAATTATGTTCATAAATGG - Intronic
1119460723 14:74800650-74800672 AGAAAAATACGGTGAAGAAAAGG + Intronic
1119562616 14:75603142-75603164 AGAGAAATTCTAGGCAGAAAAGG + Intronic
1119608019 14:76037463-76037485 GAAGAATTTCTGTTAATAAATGG - Intronic
1120928849 14:89827118-89827140 AGAGGAATTCTGCAATTAAAAGG + Intronic
1121145252 14:91577506-91577528 AGAGAAATTCTAAGCAGAAAAGG + Intergenic
1121460863 14:94076870-94076892 GAAGAAATTCTGTGTATAAGTGG - Intronic
1121767553 14:96501211-96501233 CTAGACATTCTGTGAAAAAAGGG + Intergenic
1202872839 14_GL000225v1_random:179645-179667 AGAGAAATTGTTTGGATATAGGG + Intergenic
1202934692 14_KI270725v1_random:76223-76245 AGTGAGATTCTGTCAAAAAAAGG - Intergenic
1124168381 15:27350049-27350071 AGAGATTTTGTGTGTATAAAGGG - Intronic
1124550345 15:30675187-30675209 ATAAAAATTCTGTGAAAACATGG + Intronic
1125257873 15:37787728-37787750 AGAGAAGTTCTCTGAAAAAGGGG - Intergenic
1125847381 15:42869705-42869727 TGAAAAATGCTGTGAATCAAAGG + Intronic
1126062191 15:44793403-44793425 AGTGAAATTATATGATTAAAAGG - Intergenic
1126868224 15:52959428-52959450 TGTGAAATTCAGTGAAGAAATGG + Intergenic
1127573186 15:60264123-60264145 AGAGAAACTTTCTGAAAAAAAGG + Intergenic
1127597946 15:60505663-60505685 AGCGAAGTTCTTTGAATAATTGG + Intronic
1127629871 15:60818069-60818091 AGAGAAATACTGTGAGTGAGAGG + Intronic
1127687546 15:61363798-61363820 AGAGAAAATATGAAAATAAATGG - Intergenic
1128486688 15:68098460-68098482 GAAGAAAATCTGTGTATAAATGG + Intronic
1128560502 15:68663058-68663080 AAAAAAAATCTGTGGATAAATGG + Intronic
1128859953 15:71060826-71060848 AGAGAAAATCAGTGTATCAAAGG - Intergenic
1129637074 15:77331484-77331506 AAAGATATTCTGTGTATACAAGG - Intronic
1130385893 15:83411861-83411883 AAAGAAAGTCTTTCAATAAATGG - Intergenic
1130571223 15:85045795-85045817 AGAGAAATAATGTGATCAAAGGG - Intronic
1130790426 15:87149555-87149577 AGTGCAATTTTGTGAATAAATGG + Intergenic
1130975893 15:88774044-88774066 GTAGAAATCCTGAGAATAAATGG - Intergenic
1131022504 15:89110949-89110971 AGAGAAACTCTGTGGAAACAGGG - Intronic
1131817997 15:96242744-96242766 AGTGAAATACTGTAAATTAAGGG - Intergenic
1131881480 15:96867388-96867410 AGAGAAATTCTAGGCAGAAAAGG + Intergenic
1131896247 15:97033508-97033530 AAAGAAATTCAATGAAAAAAAGG + Intergenic
1132148769 15:99444880-99444902 AGAAAAATGCTGTGAAGGAAGGG - Intergenic
1135377316 16:21959235-21959257 AAAGAAGTTCTGTGGGTAAACGG - Intronic
1135663584 16:24317039-24317061 AGGGAACTCCTGTGAATAAAAGG + Intronic
1136252723 16:29016784-29016806 ACAGAACTTCTGTGCATCAAAGG - Intergenic
1137815622 16:51395240-51395262 AGAGAAATTCTGGGCAGACAGGG + Intergenic
1137919038 16:52467443-52467465 TGAGAAATTATTAGAATAAACGG - Intronic
1138004081 16:53314133-53314155 AGAGAAAATGTGTGAATATCGGG + Intronic
1138732680 16:59212697-59212719 AGACAAAATCTGTGAATCAGAGG - Intergenic
1139530591 16:67540674-67540696 ACAGAAATTCCGTGAGTAGAGGG - Exonic
1140280010 16:73545287-73545309 CGATAAATTCTGAGAAGAAAAGG - Intergenic
1140800547 16:78484318-78484340 AAAAAAAATCTGTGAACAAAAGG - Intronic
1140811668 16:78584898-78584920 AGAAAAATTCTGTCAATGAATGG - Intronic
1140946323 16:79771306-79771328 AGAGAAATTCTGTTAGTACATGG + Intergenic
1144029611 17:11307794-11307816 AGAAAAATAATGTGAGTAAAGGG + Intronic
1144143544 17:12374684-12374706 AAAGAAATTTTGAAAATAAAAGG - Intergenic
1144157119 17:12515800-12515822 AAAGCAATTCTGAGAAGAAAAGG + Intergenic
1144996819 17:19275351-19275373 TGAGAATTTCAGGGAATAAATGG + Intronic
1145060603 17:19730971-19730993 AGAGAAATTTTGGGAAAGAAGGG + Intergenic
1145226256 17:21130604-21130626 AAAGAAATGCTGTGAGGAAAAGG + Intronic
1146304078 17:31716825-31716847 AGAGAAATTATGTTCATGAATGG + Intergenic
1147061458 17:37882588-37882610 AGAGTAATGGTGTGAATAAATGG - Intergenic
1147402621 17:40190205-40190227 AGAGAAAAGCTGTGAAAGAAAGG + Intronic
1147513401 17:41093644-41093666 AGAGAAATTCTAGGCAGAAAAGG + Intronic
1148553769 17:48565684-48565706 AGAGAATTTCTCTGGATAGAGGG - Intronic
1149076611 17:52602912-52602934 AGCGAAATGCTATGAATAATAGG + Intergenic
1149172855 17:53833626-53833648 AGATAAATGCTGAGAATACATGG - Intergenic
1152819502 17:82429556-82429578 AGAGACATTCTGTGGATACGTGG - Intronic
1153158742 18:2179322-2179344 AGAGAAATTCTAGGCAGAAAAGG + Intergenic
1153161761 18:2213568-2213590 AAGGAAGTTCTGTGAATAAAGGG + Intergenic
1153360415 18:4188910-4188932 AAAGAAATCCAGTGAGTAAAAGG - Intronic
1153703890 18:7725400-7725422 AGGGAAATTCTGGGCAGAAAAGG + Intronic
1154003255 18:10505054-10505076 AGTGAAACTCTGTCAAAAAAAGG - Intergenic
1155142912 18:23059373-23059395 AGAGAAACTCTTGGAATGAAGGG - Intergenic
1155537781 18:26834667-26834689 ATAGAGATGCTGTGAAGAAAAGG - Intergenic
1155620778 18:27776740-27776762 AGAAAAATTGTGTGAAGAAAAGG + Intergenic
1155807067 18:30184813-30184835 AGAGAAATTCTAGGCAGAAAAGG + Intergenic
1155829534 18:30495631-30495653 AGAGAACTTCAGTGATTAAAGGG + Intergenic
1156311480 18:35926563-35926585 AGGGAAATACTGTGTAGAAAAGG + Intergenic
1156400708 18:36736857-36736879 AGAGAAATTCTAGGCAGAAAAGG - Intronic
1156557325 18:38082312-38082334 AGACAAACTCTGTGAAAAAATGG + Intergenic
1156636050 18:39030685-39030707 ACAGGAATTCTGTAATTAAAAGG - Intergenic
1156940751 18:42764669-42764691 AGTTAAATTCTGAGGATAAAAGG - Intronic
1157318570 18:46616053-46616075 ACAGAAAGTCTGAGAATAAATGG - Intronic
1158014434 18:52766860-52766882 AGAGAAATTCTAGGCAGAAAAGG - Intronic
1158091362 18:53717596-53717618 AAAGAAAATCTGTGTATAAGTGG - Intergenic
1158212081 18:55062897-55062919 AGAGACACTCAGTGAACAAATGG + Intergenic
1158968476 18:62644335-62644357 AGAGAAATTCTAGGCAGAAAAGG + Intergenic
1159289221 18:66395449-66395471 AGAGATTTTCTGTAAAGAAATGG + Intergenic
1159576027 18:70178715-70178737 AAAAAAACTTTGTGAATAAAAGG + Intronic
1161177077 19:2850387-2850409 AGAGAAATTCAGTGTGTTAATGG + Intronic
1162260256 19:9527520-9527542 AGAGAAATTGTATGAATGTAAGG - Intergenic
1162275775 19:9653524-9653546 AGAGAAACTCTGTGAATTTCAGG - Exonic
1162280256 19:9690914-9690936 AGAGAAATTCTGTGAATTTCAGG - Exonic
1162649808 19:12079275-12079297 AGAGAAACCCTGTAAATGAAGGG + Exonic
1163057433 19:14731111-14731133 AGAGAAATTGAATGAATAAAGGG - Intronic
1163853528 19:19681152-19681174 AGAGAAATCCTATGAATGTAAGG + Exonic
1164278326 19:23744610-23744632 AGAGAAACTCAATGAATATAAGG - Exonic
1164819766 19:31239305-31239327 AAATAAATTATGAGAATAAAAGG + Intergenic
1164964063 19:32465326-32465348 TAAGAAATTCTCTGAATTAAAGG - Intronic
1168633909 19:57979719-57979741 AGAAAAACTCTATGAATATAAGG - Exonic
926177209 2:10604813-10604835 AGAGATCTTCTGAGAAAAAAGGG + Intronic
926367585 2:12147018-12147040 AAAGGAAGTGTGTGAATAAAGGG - Intergenic
926617555 2:15012198-15012220 AGAGAAATTCAAGAAATAAACGG + Intergenic
927366228 2:22299892-22299914 AGAGAAATTCTATCTTTAAAGGG - Intergenic
927369587 2:22339227-22339249 AGAGTAAATTTGTGCATAAAAGG + Intergenic
927397035 2:22664512-22664534 AGAGAAAATTTGTGTATAAGTGG - Intergenic
928813043 2:35253294-35253316 AGAGAAATTCTAGGCAGAAAAGG + Intergenic
928935448 2:36671737-36671759 AGAGCAATTTTGAGAAGAAAAGG - Intergenic
930057445 2:47262979-47263001 AGAGAGATTATGTAAAGAAAAGG - Intergenic
930527218 2:52545323-52545345 AGAGAAATTCTAGGCAGAAAAGG + Intergenic
931071738 2:58659242-58659264 AGAGGAAATTTGTGCATAAAGGG - Intergenic
931567197 2:63627403-63627425 AGAGAAATTCTAGGCAGAAAAGG + Intronic
931596560 2:63951805-63951827 AAAAAAAATCTGTGTATAAATGG + Intronic
931938891 2:67230555-67230577 AGAGAAATTCTAGGCAGAAAAGG + Intergenic
931960844 2:67480985-67481007 ATAGAAATGCAGTGATTAAAAGG + Intergenic
932837971 2:75055167-75055189 GGAGAAATTGAGTGAATAAGTGG - Intronic
933583399 2:84152569-84152591 TGAGATTTTCTGTTAATAAATGG + Intergenic
933763047 2:85687163-85687185 AGAGCAGTTCTCTAAATAAAGGG + Intronic
933951898 2:87338256-87338278 AGTGAAATTCTGTGAGCACAAGG + Intergenic
934236140 2:90234590-90234612 AGTGAAATTCTGTGAGCACAAGG + Intergenic
935245812 2:101218158-101218180 TGAGAAATCCTGTGAAGAATAGG - Intronic
935719252 2:105965870-105965892 AGAGCAATTCAGTGAAGAAATGG - Intergenic
935867957 2:107411796-107411818 AGAACACTGCTGTGAATAAAAGG - Intergenic
936858349 2:116987039-116987061 AGAGAAATTCTGGGCAGACAAGG + Intergenic
936887824 2:117334321-117334343 AGAGACATTTTGTGTATAAGAGG - Intergenic
937708017 2:124943774-124943796 ATTGAAAATGTGTGAATAAATGG - Intergenic
938724920 2:134099040-134099062 AGAGAAATTCTGTGTATCAATGG - Intergenic
938772761 2:134514260-134514282 AGAGAATTTCTGGAAACAAAGGG - Intronic
939564503 2:143771027-143771049 TGAGAAGTTCAGTGAATAAAGGG + Intergenic
940324507 2:152411219-152411241 AGAGAAATTCTGGGAAGGGAAGG + Intronic
940428847 2:153563735-153563757 GGAAAACTTCTATGAATAAATGG - Intergenic
940660889 2:156543887-156543909 ATAGAAATACTATAAATAAAAGG - Intronic
941427649 2:165368464-165368486 AGAGAAATTCTGGGCAGAAGAGG - Intronic
942012012 2:171773476-171773498 AGAGAAAATGTGAAAATAAAAGG + Intergenic
943110431 2:183597645-183597667 TGAGAACTTCTGGGGATAAAAGG - Intergenic
943267292 2:185749571-185749593 TGATCATTTCTGTGAATAAAGGG + Intronic
943384551 2:187185063-187185085 AGGGAAATTCTGGGCAGAAAGGG - Intergenic
943506512 2:188767162-188767184 AGAGGTATTCTGTAAATATATGG - Intronic
943965300 2:194325406-194325428 AGAGTATTTCTGGGAATAACTGG - Intergenic
944067457 2:195633956-195633978 AGAGAAATTCTAGGCAGAAAAGG - Intronic
944199441 2:197090580-197090602 AGAGAAATTCTAGGCAGAAAAGG + Intronic
944217880 2:197273881-197273903 TGATAAAAGCTGTGAATAAAAGG + Intronic
944502813 2:200379335-200379357 AGGGCAATTCTGAGAACAAAAGG + Intronic
944691613 2:202163766-202163788 AAAAAAATTCCCTGAATAAATGG - Intronic
944891137 2:204118159-204118181 AGAGAAATTCTAGGCAGAAAAGG - Intergenic
944964732 2:204917734-204917756 AATGAAATGCTCTGAATAAAAGG - Intronic
945054578 2:205857305-205857327 TTTCAAATTCTGTGAATAAAAGG - Intergenic
945409044 2:209487663-209487685 AGACAAATGATTTGAATAAATGG + Intronic
945448177 2:209962666-209962688 TGAGAAATTGCGTTAATAAAGGG - Intronic
945781260 2:214175352-214175374 AGAGAAATTCTGTGAATAAAAGG + Intronic
945859953 2:215109250-215109272 AGAAAAAATTTGTGTATAAAAGG + Intronic
945925779 2:215802635-215802657 AGAGTAATTTTTTTAATAAATGG + Intergenic
946471355 2:219964091-219964113 AGGGAAATTCTGGGCAGAAAAGG + Intergenic
946476587 2:220011852-220011874 AGAAGACTTCTGTGAATAAATGG - Intergenic
946875667 2:224127138-224127160 AGAGAAATTCAGTGATTTACCGG - Intergenic
947065701 2:226222482-226222504 TGTGAGATTCTGTGTATAAAGGG - Intergenic
947194850 2:227552351-227552373 ATAGAAATTCTGAGAATGACGGG - Intronic
947555122 2:231085436-231085458 AGAGAAATTCAGTGAAGAACAGG + Intronic
948320293 2:237063462-237063484 AGTGTAATTCAGTGAATAATGGG - Intergenic
1169684071 20:8250872-8250894 CTGTAAATTCTGTGAATAAAAGG - Intronic
1170335082 20:15261142-15261164 AAATAAATGCTGTGTATAAATGG - Intronic
1170441786 20:16386641-16386663 AGAGAGATTGAGTGAAAAAATGG + Intronic
1171105116 20:22426014-22426036 TCTGAAATTCTGGGAATAAAGGG - Intergenic
1171383061 20:24747730-24747752 AGGGAAATTCTGGGAAAAAGTGG + Intergenic
1172237304 20:33386873-33386895 AGAGGCAATATGTGAATAAATGG + Intronic
1172575494 20:36005138-36005160 AGACAAATTCTGAGAATTACTGG + Intronic
1173273461 20:41557549-41557571 AAATCATTTCTGTGAATAAATGG - Intronic
1173395936 20:42679519-42679541 AGAGAAAATATGAGAAGAAATGG + Intronic
1175183325 20:57163579-57163601 ATGGAAATTTTGAGAATAAATGG + Intergenic
1176909316 21:14543951-14543973 AGAGAAATTGTGTCTAGAAAGGG - Intronic
1176917316 21:14642150-14642172 AAAGAAAATCTGTGTATAAGTGG + Intronic
1177216643 21:18138519-18138541 AATAAAATTCTGTAAATAAAAGG - Intronic
1177366714 21:20149160-20149182 GGAGAAAATCTGTGTATAAGTGG + Intergenic
1177640089 21:23834536-23834558 AGAGAAATTCTAGGCAGAAAAGG + Intergenic
1178426303 21:32481322-32481344 AGAGGAATTCAGTGAAGAAGGGG + Intronic
1179014059 21:37579642-37579664 ATAGAAATTTATTGAATAAATGG - Intergenic
1180559976 22:16608405-16608427 AAATAAATTCTGCAAATAAAGGG - Intergenic
1182564608 22:31188222-31188244 AGAGAAATCGTGTGAAGAAAAGG + Intronic
950997407 3:17518151-17518173 AGAGAAATTCTAAGCAGAAAAGG + Intronic
951251094 3:20395210-20395232 AGGGAAATTCTGGGAAGAAGAGG + Intergenic
951459281 3:22931954-22931976 TGAGAAATTCTCTTAATTAATGG - Intergenic
951836305 3:26987026-26987048 TGAGAAGATCTGTGAATGAATGG - Intergenic
952098720 3:29985938-29985960 GAAGAAATTCTGTGAATTAGAGG - Intronic
952556988 3:34543074-34543096 AGTGTATTTCTGTGACTAAAAGG + Intergenic
952725863 3:36583314-36583336 AGAAAAATTCTATGAATTACTGG - Intergenic
955139828 3:56258323-56258345 AGAGACAATGTGTGAACAAATGG + Intronic
955543146 3:59999406-59999428 AATGAAAGTCTGTGAATCAATGG - Intronic
955978888 3:64504705-64504727 AGAGAAAGAATGAGAATAAAAGG - Intergenic
956081164 3:65557808-65557830 AGAGCAATTCAGTGATTGAAGGG - Intronic
956098674 3:65744921-65744943 AGAGAAATTCTTTAACTATAAGG + Intronic
957389522 3:79545937-79545959 GAAGAAACTCTGTGAATAAGTGG - Intronic
957543731 3:81609702-81609724 AGAGAAAATTTGTGAATAAGTGG - Intronic
957732462 3:84157472-84157494 AGAGGAATACTGTAAATAAATGG - Intergenic
958119340 3:89263852-89263874 AGAGCAATTCTAGGAAGAAAAGG - Intronic
958174965 3:89985770-89985792 AGACAAATACTGAAAATAAAGGG + Intergenic
958547727 3:95576232-95576254 AAAGTAATTCAGTGAGTAAAAGG + Intergenic
958824979 3:99019366-99019388 AGATAAATTCACTGAACAAATGG - Intergenic
958981822 3:100729715-100729737 AGATAATTTTTGTGGATAAATGG + Intronic
959144943 3:102533196-102533218 AGAGAAATCCTGAGACTACATGG - Intergenic
959777414 3:110183794-110183816 ATTGAAATTATGTAAATAAATGG + Intergenic
959830849 3:110860589-110860611 AGAGAAAATCTGTGTACAAATGG + Intergenic
959830918 3:110861562-110861584 AGAGAAAGTCTGTGTATAAGTGG - Intergenic
959904468 3:111695201-111695223 ATAGAAATTCTATGAAGATAGGG + Intronic
959937506 3:112044673-112044695 AGAGATCTTCTGAGAAAAAAGGG + Intronic
960244836 3:115388756-115388778 AGAGACATTGTGTGACTGAATGG + Intergenic
960266849 3:115629976-115629998 AGAGAAATACAGTCTATAAATGG - Intronic
960361662 3:116719517-116719539 TGAGAAAAACAGTGAATAAAAGG - Intronic
960847785 3:122020926-122020948 AGCGTAATGCTGAGAATAAAAGG - Intronic
963307863 3:143674134-143674156 ACAAAAATTCTTTGAAGAAATGG + Intronic
963410620 3:144922394-144922416 AGAGAAATTCTAGGCAGAAAAGG - Intergenic
963451656 3:145490107-145490129 AGAGAAATTCTAAGCAGAAAAGG + Intergenic
963534802 3:146514270-146514292 AGAGAAATTCTAGGTAGAAAAGG + Intergenic
964252388 3:154733756-154733778 AGAAAACTTTTTTGAATAAAAGG + Intergenic
964433351 3:156627450-156627472 AGAGAAATTCTTTCTATAAGAGG + Intergenic
964853284 3:161118205-161118227 AATGAAATTCTTTGAAGAAATGG + Intronic
964979404 3:162660750-162660772 AGAGAAATGCTGAGAAAAAGGGG - Intergenic
965249679 3:166327144-166327166 AGGGGAATTTTGTGAATAAGAGG + Intergenic
965316945 3:167204115-167204137 AGAGAACTTCTGTGGATGATTGG - Intergenic
965438085 3:168677393-168677415 AGAGAAATTTTGTTAAGGAAAGG + Intergenic
966647706 3:182265139-182265161 ACAGACATTCTTTGAAGAAAAGG + Intergenic
967497911 3:190162599-190162621 AAAGAACTTCTGTGAATATCGGG + Intergenic
968466932 4:756878-756900 CGAGAAAGTCTGTGAATTTACGG + Intronic
968765552 4:2466828-2466850 AGAGAATTTCAGTTCATAAATGG - Intronic
970101826 4:12531834-12531856 CCAGATATTCTGTGAGTAAAGGG - Intergenic
970111830 4:12646210-12646232 AGATAAGTTCTGTGAATGGATGG + Intergenic
970698273 4:18703960-18703982 AGAAAAATTCAGTGAAGGAAAGG + Intergenic
971039785 4:22738879-22738901 AGAGAAATACTGTAAAGAAGAGG - Intergenic
971487816 4:27178292-27178314 CGAGAAATTCTCTGAAGAAACGG + Intergenic
971772229 4:30911363-30911385 ATAGAACATCTGTAAATAAATGG - Intronic
971865799 4:32170117-32170139 AAAGCAAAACTGTGAATAAAGGG + Intergenic
971956409 4:33425330-33425352 AGAGAAATCCTGTAAAATAATGG + Intergenic
972033467 4:34492217-34492239 AGAGAGATCCTGTAAAAAAATGG + Intergenic
972118712 4:35672823-35672845 AGAGGAATTCTTTCAATAAATGG + Intergenic
972473477 4:39429395-39429417 AGATAAATTCTGTGGATGATAGG - Intronic
972903803 4:43719229-43719251 AGACAAATTCGGGGAATAAAAGG - Intergenic
973634629 4:52850688-52850710 AGATAAAGGCTGAGAATAAAGGG + Intergenic
974302744 4:60089924-60089946 GGAGAAAATTTGTGAAAAAAAGG + Intergenic
974377060 4:61092424-61092446 AGATAAGTTCTTTGAGTAAAGGG - Intergenic
974407308 4:61490776-61490798 GGAGAAACTCTATGAATAATGGG + Intronic
974979139 4:68931814-68931836 AGAAAAATTGTGTAAAAAAAAGG - Intronic
975387089 4:73770316-73770338 AGAGAAATTCTAGGTAAAAAAGG + Intergenic
975428461 4:74258457-74258479 AAAAAAAATCTGTGTATAAATGG - Intronic
975646269 4:76549174-76549196 AGATAAATTGTGTGGATAATTGG + Intronic
975947433 4:79724325-79724347 AGATAAATTCTATGCAGAAAAGG - Intergenic
976113510 4:81701874-81701896 AGAGAAAGTGTATGAATAAACGG - Intronic
976516831 4:85977806-85977828 AAAGAACTTCAGTTAATAAACGG - Intronic
976883658 4:89960806-89960828 AGAGAAATTCTAGGCAGAAAGGG - Intergenic
977103655 4:92851813-92851835 AGAGAAAGTATGTGAAAAAGTGG + Intronic
977207385 4:94178551-94178573 AGAGAAATTTTGTGTTTCAATGG - Intergenic
977275598 4:94973716-94973738 AGAGAAATTCTAGGCAGAAAGGG - Intronic
977338759 4:95730425-95730447 AGAGAAATTCTAGGCATAAAAGG - Intergenic
978680264 4:111372185-111372207 AGAGAAATGCTGTTAATTAATGG + Intergenic
978842849 4:113235015-113235037 AGAGAAATACTGTATAAAAATGG - Intronic
978925894 4:114243631-114243653 AAAGAAATTCTGGACATAAATGG - Intergenic
979184313 4:117770125-117770147 AGAGAAATTCTAAGCAGAAAAGG + Intergenic
979536411 4:121825389-121825411 AGTGAAATTTTGTGATTAAGAGG - Exonic
979596562 4:122541467-122541489 AGGGAAATTCTGTGCAGAAGAGG + Intergenic
979858600 4:125665138-125665160 AGAGAAATTCTAGGCAGAAAAGG - Intergenic
979971718 4:127143708-127143730 AGAGTAATTCTGTGGCTTAAGGG + Intergenic
980188753 4:129496076-129496098 AGAGATATTCTTGGAATACAAGG - Intergenic
980492984 4:133553140-133553162 AGAGAAATTCTAGGCAGAAAAGG - Intergenic
980778785 4:137469586-137469608 TGAGAAATTCAGTCCATAAAAGG + Intergenic
980788852 4:137592305-137592327 GGATAATTTCTGTGAATTAAGGG - Intergenic
981496981 4:145404961-145404983 AGGGAAAGCCTGTGAATTAAAGG - Intergenic
982671159 4:158321138-158321160 AGAGAAATTCTAGGCAGAAAAGG - Intronic
982798533 4:159673792-159673814 AGAGAAATTCTGGGCAGAAGAGG + Intergenic
982837379 4:160137288-160137310 GGAGAAAATCTGTGTATAAGTGG + Intergenic
983152480 4:164301886-164301908 AGAGGAATGCTGTGAAGAAGGGG + Intronic
983722596 4:170874835-170874857 AGAGAAAGTGTGTTTATAAATGG + Intergenic
983824832 4:172246368-172246390 AAAAAAATTCTATGCATAAATGG - Intronic
984230222 4:177088300-177088322 AGATAAATTCTTTGAGTAAGGGG + Intergenic
984506267 4:180622696-180622718 AAATAAATTCTGTGAAACAAAGG + Intergenic
984513094 4:180702301-180702323 AGAGAAATTCTTTGTAGACAGGG - Intergenic
984746096 4:183219969-183219991 AGAGAAATTCTGTCTTTAAAGGG - Intronic
985023023 4:185712040-185712062 AGAGAAATTCTAGGCAGAAAAGG + Intronic
985127584 4:186710670-186710692 GGAGACATTCTGTGAACAACTGG - Intronic
985430027 4:189870469-189870491 TGATAAATGCTGTGAGTAAAGGG - Intergenic
987082580 5:14438837-14438859 AGAGAAATTATCTCAATTAAAGG - Intronic
987308119 5:16657505-16657527 AGGGGAATTCTGTTACTAAAAGG + Intergenic
987641945 5:20623461-20623483 AAAGAAAATATTTGAATAAATGG - Intergenic
987858136 5:23448165-23448187 AGAAAAATGATGTAAATAAATGG - Intergenic
988241820 5:28621111-28621133 AAAAAAATTCTGAAAATAAAAGG - Intergenic
988633208 5:32953064-32953086 AGAGAAATTCTTTTAAAAAAAGG + Intergenic
988936569 5:36089336-36089358 GGATAAATTCACTGAATAAATGG - Intergenic
989743716 5:44802753-44802775 ACATAGATTCTGTGGATAAATGG - Intergenic
989764575 5:45066140-45066162 GGATAAAGTCTGTTAATAAAGGG - Intergenic
990079890 5:51899771-51899793 AGAGAAATACTGGGTAAAAAAGG - Intergenic
990908451 5:60828386-60828408 ACTGAAATTCTAAGAATAAATGG + Intronic
990962503 5:61409410-61409432 AGAGAAATTATGTGGAAAATTGG + Intronic
991022568 5:61995459-61995481 ATAGTCATTCTGTGGATAAATGG - Intergenic
991981887 5:72240800-72240822 AGAGAAAGTCTGTGAAGGAAGGG - Intronic
992513719 5:77469716-77469738 AGAGAAATTTAGAGAAAAAAAGG + Intronic
992729807 5:79651926-79651948 AGTGAAATTCTGTAAGTAACAGG - Intronic
993156565 5:84232277-84232299 AGAGAAATCCTTTCAAGAAATGG + Intronic
993194593 5:84724382-84724404 AAATAAATGCTGTGAAAAAATGG + Intergenic
993297077 5:86153897-86153919 AGAGAAATTCTAGGCAGAAAGGG - Intergenic
993319284 5:86453161-86453183 AAATAAGTTATGTGAATAAAAGG + Intergenic
993903935 5:93603374-93603396 TGAGAAATTAGGTAAATAAAAGG - Intergenic
994749054 5:103715713-103715735 ATTGTAATTCAGTGAATAAAAGG - Intergenic
994775214 5:104031011-104031033 AGAGAAATTCTAGGCAGAAAAGG + Intergenic
994830481 5:104775227-104775249 AGAGAAATTCTAGGCAGAAAAGG - Intergenic
995376240 5:111477290-111477312 TGGGACATTCTGTGAGTAAAAGG + Intronic
995502880 5:112827698-112827720 AGAGAAATAAAGTGAATAAGTGG - Intronic
995533583 5:113114440-113114462 AGAGAAATTCTAGGCAGAAAAGG + Intronic
995596667 5:113754985-113755007 AGATAAATTATGTTAACAAAAGG - Intergenic
995611467 5:113914402-113914424 AGAGAAATACTGTGCTTAAAAGG - Intergenic
995637645 5:114212979-114213001 GGAGTACTTCTGGGAATAAATGG + Intergenic
995638207 5:114219752-114219774 AGAGAAATTCTAGGCAGAAAAGG - Intergenic
995820230 5:116221577-116221599 TTAGAAATGCTGTGAAGAAAAGG + Intronic
995910447 5:117180571-117180593 AAAGAAAATGTGTGGATAAAAGG + Intergenic
996009887 5:118470444-118470466 AGAAAAATGCTGAAAATAAAAGG - Intergenic
996024317 5:118627909-118627931 GGAAGAATTCTGTGTATAAACGG + Intergenic
996052245 5:118947728-118947750 AGAGAAATTCTAGGCAGAAAAGG - Intronic
996467881 5:123824796-123824818 AGGGAATTTCTGAGAAAAAAGGG - Intergenic
997728468 5:136143485-136143507 AGGGAAAGACTGTGAATACAAGG - Intronic
998881129 5:146646073-146646095 AGATAATTTCTGTGAAGACAGGG - Intronic
999170866 5:149593864-149593886 GAAGAAATTCTGTGTATAAGTGG + Intronic
999340470 5:150765762-150765784 AGAGTAACTGTGAGAATAAAAGG - Intergenic
999564217 5:152839119-152839141 AGAGAAATTCTGGGCAGACAAGG - Intergenic
999666641 5:153919608-153919630 AGAGAAATTCAGTGGAAAATGGG - Intergenic
999957911 5:156722294-156722316 AGACAAATTCTGCAAATGAAGGG + Intronic
1000655927 5:163877694-163877716 AAATAAATTCTGTGAATTTAGGG + Intergenic
1000842564 5:166239060-166239082 AGAGAAATTTTGCAAAAAAAAGG + Intergenic
1001130629 5:169060729-169060751 AGAGAAGTTCTATGAACAACAGG + Intronic
1002407163 5:179044102-179044124 AAAGAAATGCTGAAAATAAAGGG + Intergenic
1002892674 6:1349408-1349430 AGTGAGATTTTGGGAATAAATGG - Intergenic
1004769523 6:18766052-18766074 AAGGAAATACTGTGAATAGAGGG + Intergenic
1004977566 6:20984940-20984962 AGGGAAATTCTGGGTAGAAAAGG - Intronic
1005458095 6:26041094-26041116 AGCGAAGGTCAGTGAATAAAGGG + Intergenic
1005680324 6:28200384-28200406 AGAGCAAAACTGTGGATAAAGGG + Intergenic
1008406896 6:51128171-51128193 AGAGAAATTTTGTGAACAAAAGG - Intergenic
1008541682 6:52551513-52551535 AGAGAAAGTCTGCAAACAAACGG + Intronic
1009476866 6:64103387-64103409 GTGGAAATTCTGTGAATTAAGGG - Intronic
1009574650 6:65437067-65437089 ATAGAAAGTCTGTATATAAAAGG + Intronic
1009948255 6:70364800-70364822 AGAGAAATTCTAGGCAGAAAGGG - Intergenic
1010112381 6:72253666-72253688 TGAGAAATTATGTAAATAAAGGG - Intronic
1010189343 6:73179002-73179024 GGGGAAATTCTGTGATCAAAAGG + Intronic
1010238076 6:73591570-73591592 AGAAGACTTCTGTGATTAAAAGG + Intergenic
1010500168 6:76589475-76589497 AGATAAGTATTGTGAATAAAAGG + Intergenic
1010518661 6:76805823-76805845 AGACACATTCTATGCATAAATGG + Intergenic
1010584543 6:77642125-77642147 AGAGAAATTCTAGGCAGAAAAGG - Intergenic
1010736545 6:79450338-79450360 AGAGAAATTCTAGGAAGAAAAGG + Intergenic
1011353389 6:86447225-86447247 AGAGAAATACTGGGTAGAAAAGG - Intergenic
1011443531 6:87412594-87412616 AGAGAAATTTTGTGAAGAGAGGG + Intronic
1011493463 6:87916203-87916225 AGAGAAATTCTGGGCAGGAAAGG + Intergenic
1011989699 6:93498988-93499010 AGAGAAAGTCTGCTATTAAAAGG - Intergenic
1012032907 6:94095578-94095600 TCAGAAATTCTGTTAATTAATGG - Intergenic
1012446629 6:99313792-99313814 AGACAAATTCATTCAATAAATGG - Intronic
1012555621 6:100507472-100507494 AGAGAAATATTGTGATAAAAAGG - Intergenic
1012722447 6:102762902-102762924 AAAGACATTCTGTGAAAACATGG - Intergenic
1013000409 6:106016619-106016641 AGAAAAAATCTGTGCATAAATGG - Intergenic
1013187253 6:107770553-107770575 AGAGAAACTCTATGAGGAAATGG + Intronic
1013218964 6:108059420-108059442 ACAGGAATTCTGAGAAGAAAAGG + Intronic
1013381050 6:109571003-109571025 TGAGGAATTCTGAGAAGAAAAGG + Intronic
1013630063 6:111977811-111977833 AGAGAAGTCCAGTGCATAAATGG - Intergenic
1013690844 6:112640945-112640967 AGAGAAATTCTGAAAGTGAAAGG + Intergenic
1013830122 6:114261960-114261982 AGAGAAATTGTGTGAGAAGAGGG - Intronic
1014252270 6:119127182-119127204 AGAGAAATTCTAGGCATAAAAGG - Intronic
1014333361 6:120099306-120099328 AGAGAAATACTGAAAATAAAAGG + Intergenic
1014661610 6:124179693-124179715 AAAGTAATTCTGTGGATAAAAGG - Intronic
1014833459 6:126129779-126129801 AGAGATATTCTGAGAACAGACGG - Intergenic
1015070439 6:129087546-129087568 AGAGATTTTCTTTTAATAAAAGG - Intronic
1015509042 6:134019441-134019463 AGAAAAATTCTGTTATTAAAGGG + Intronic
1015546875 6:134370284-134370306 AGAGGAATTAGGTGAATAGAAGG - Intergenic
1015563793 6:134544521-134544543 AGAGAAAGACTGTGAAAGAAAGG - Intergenic
1016038596 6:139409096-139409118 AAAGGAATTCTGTGTATGAAGGG + Intergenic
1016499714 6:144705700-144705722 AGAACAATTCTGTGTAGAAATGG - Intronic
1016642492 6:146365466-146365488 GGAGAAATGCTGTGAATCATGGG + Intronic
1017317935 6:153054281-153054303 TCAGAGATTTTGTGAATAAATGG - Intronic
1017372233 6:153725364-153725386 AGAGAACTTCTCAGAATCAAAGG + Intergenic
1017406456 6:154124880-154124902 AGATAATTTCTTTGGATAAAAGG - Intronic
1017545054 6:155441858-155441880 AGACAAATGCTGTGATTCAATGG + Intronic
1017584801 6:155909058-155909080 AGAGAAATTCTAGGCAGAAAAGG + Intergenic
1018050231 6:160002558-160002580 AAAGAAAATCTGTGTATAAGTGG + Intronic
1018220194 6:161570437-161570459 AGAAAAAATCTGTGTATAAGTGG - Intronic
1018240199 6:161766843-161766865 AAAGAGGTTTTGTGAATAAAAGG + Intronic
1018328076 6:162696120-162696142 AGAGAAAAACAGTGAATACAGGG + Intronic
1018567726 6:165173458-165173480 GGAGAAATTCTGTGAAACAATGG + Intergenic
1019042262 6:169117143-169117165 AGAGAAATTCTAGGCAGAAAAGG + Intergenic
1019043402 6:169124712-169124734 AGAGAAATTCTAGGCAGAAAAGG + Intergenic
1020174529 7:5871696-5871718 AGTGAAATTCTTTGAACAAGAGG + Intergenic
1020285209 7:6673684-6673706 AGAGAAACCCTGTGATTATAAGG + Intergenic
1020488932 7:8755043-8755065 AGAGAATTTCTCTGAATGAGTGG + Intergenic
1020510612 7:9052339-9052361 AAGGGAATTATGTGAATAAATGG - Intergenic
1020902541 7:14023977-14023999 ATAGACAGTGTGTGAATAAATGG + Intergenic
1022783066 7:33605565-33605587 ATAAGAATTCTGTGAAAAAATGG - Exonic
1023212357 7:37820944-37820966 AGAAAAATTATTTGAAGAAATGG - Intronic
1023538675 7:41241042-41241064 AGAGCAAGTCTATGAAGAAATGG - Intergenic
1023792448 7:43763524-43763546 AGGGATATTGTGGGAATAAAAGG + Intronic
1024139332 7:46445985-46446007 AGAGAAATACTGAGAATAGAAGG - Intergenic
1024934936 7:54702308-54702330 AGAGAATGTCTGTGAAGGAAGGG + Intergenic
1026285661 7:68960621-68960643 ATGGAATTTCTGTGAATAACAGG - Intergenic
1026396534 7:69960519-69960541 TGTGTAATTCTGTGTATAAAGGG + Intronic
1026767670 7:73170843-73170865 ATTGAATTTCTGTGAATAATAGG - Intergenic
1027044138 7:74980551-74980573 ATTGAATTTCTGTGAATAATAGG - Intronic
1027079507 7:75221807-75221829 ATTGAATTTCTGTGAATAATAGG + Intergenic
1028192608 7:87870457-87870479 AGATAAATTCTGGGCATAAGAGG + Intronic
1028531338 7:91842052-91842074 AGAGAAATTCTAGGCAGAAAAGG + Intronic
1029084225 7:97998663-97998685 AGTGAAATTCTTTGAACAAGAGG - Intergenic
1029235978 7:99119387-99119409 AGAGTAAATATGTAAATAAAGGG + Intronic
1029388727 7:100260391-100260413 ATTGAATTTCTGTGAATAATAGG + Intronic
1030506067 7:110424394-110424416 AGAGAAAGTCTGTTTATCAAAGG - Intergenic
1030968576 7:116025125-116025147 AGAGATGTCCTGTGAAGAAAAGG + Intronic
1031035519 7:116784211-116784233 AGGGAAGTTATGAGAATAAATGG + Intronic
1031111262 7:117612119-117612141 ATAGCAATTCTGTGATTGAAGGG + Intronic
1031116333 7:117673033-117673055 AGAGAAATTCTAGGCAGAAAAGG + Intronic
1031346832 7:120677231-120677253 AAAAAAAATCTGTGAATAAATGG + Intronic
1032248428 7:130232437-130232459 AGGGAAATTCTGGGCAGAAAAGG - Intergenic
1032600469 7:133288382-133288404 AGAGATAATCTGAAAATAAAAGG - Intronic
1032700756 7:134377083-134377105 AGTGAAAATCTGTGATAAAAGGG - Intergenic
1032797589 7:135290202-135290224 AGAGAAATTCTAGGCAGAAAAGG + Intergenic
1032917641 7:136510175-136510197 AGAGAAATTCTAGGCAGAAAAGG - Intergenic
1033998658 7:147385499-147385521 AGAGAAATTGTCAAAATAAAGGG + Intronic
1034023395 7:147670351-147670373 AGAGAAATTCTAGGCAGAAAAGG + Intronic
1034906633 7:154953780-154953802 AGAGAAATTCTTTTACTAACAGG - Intronic
1035131485 7:156658549-156658571 AAAAAAATTCTTTGAAAAAAAGG + Exonic
1035856741 8:2984098-2984120 AGTGACATTCTGAGAATAAAAGG + Intronic
1035979934 8:4359277-4359299 AGATATATTCTGTGTATATATGG + Intronic
1036138689 8:6186178-6186200 AGAAAAATTCTGAGAAAGAATGG + Intergenic
1036475464 8:9089148-9089170 AGAGAAACTCAGTGAAGAAAAGG - Intronic
1037147957 8:15596368-15596390 AGAAAAATTCTGTGTAAAAGTGG - Intronic
1037258486 8:16981604-16981626 AGAGAAATTCTAGGCAGAAAAGG + Intergenic
1037979667 8:23242560-23242582 AGAGAAATTCTGTGAGCTAGAGG - Intergenic
1038583973 8:28773160-28773182 AATGAAAATCTGTGAAAAAAGGG + Intronic
1038722644 8:30051036-30051058 AGAGACATTTTGTGTAAAAAGGG + Intergenic
1038886193 8:31665334-31665356 AGAGCATTTCTGTGTATAGAAGG - Intronic
1039081944 8:33742235-33742257 ACTGAAATTCTGTACATAAAGGG - Intergenic
1039213886 8:35246216-35246238 AAAAAAATAATGTGAATAAACGG - Intronic
1039645570 8:39278400-39278422 AGAGAAATTCTAGGCAGAAAAGG - Intronic
1040643867 8:49375469-49375491 AGAAAAATTATTTCAATAAATGG + Intergenic
1040908352 8:52491881-52491903 AGAGAAATTCTAGGCAGAAAAGG - Intergenic
1041758189 8:61336587-61336609 AGAGAAAACATGTGCATAAAAGG + Intronic
1041801403 8:61804410-61804432 AGTAAAATTCTGAGTATAAAGGG - Intergenic
1042099142 8:65255441-65255463 ACAGGAATTCAGAGAATAAATGG - Intergenic
1042724388 8:71857319-71857341 AGAGAAATTCTGGAGCTAAAAGG - Intronic
1043086596 8:75842522-75842544 ATATAAATTCTGTGAAAAAGAGG - Intergenic
1043676120 8:82956468-82956490 AGAGAAATTCTAGGCAGAAAAGG - Intergenic
1044217338 8:89627497-89627519 AGAGCAATGATGTTAATAAATGG - Intergenic
1044257006 8:90075708-90075730 AGAGAAATTCTGAAAATAATTGG - Intronic
1044267165 8:90195544-90195566 AGAGAAATTTTGATAACAAATGG + Intergenic
1044471726 8:92578031-92578053 AGATAAATTATGGGAATAATAGG - Intergenic
1044699371 8:94951995-94952017 AGAATTATTCTGTGAATTAAAGG - Intronic
1044971646 8:97625726-97625748 AAAGAAATTTTTTGAATTAAAGG + Intergenic
1045040081 8:98215251-98215273 ATAGTTATTCTGTGAATAATGGG - Intronic
1045762589 8:105628406-105628428 AGAGAAATTCTAGGCAGAAAAGG + Intronic
1046126498 8:109915542-109915564 CAAGCAATTCTGTGAATAAAGGG - Intergenic
1046181317 8:110652684-110652706 ACAGAAAATTTGGGAATAAAAGG - Intergenic
1046346844 8:112940445-112940467 AAAGAAAGTCTATGAATATAAGG + Intronic
1046632221 8:116632524-116632546 ATAGACAGTCTGTGAATGAATGG - Intergenic
1046854370 8:119014209-119014231 AAAGAAATTCTTTAAAGAAAAGG - Intronic
1047087047 8:121529317-121529339 AAAGAAAATCTGTGATTAATTGG - Intergenic
1047179535 8:122573868-122573890 AGAGAGAATCTGTTAATAACAGG + Intergenic
1047878769 8:129169943-129169965 AGGGAAATTCTGGGCAGAAAAGG + Intergenic
1047978881 8:130159311-130159333 AGAAAACTGCAGTGAATAAAAGG + Intronic
1048374723 8:133813035-133813057 AGAGAAATTGTGAGGATAGAAGG - Intergenic
1048600520 8:135914609-135914631 AGAGAAGTTCTAAGAAGAAAGGG - Intergenic
1048732873 8:137463205-137463227 AGAGAAATCCAGTAAATAACTGG - Intergenic
1049046307 8:140154711-140154733 AGATAAAAGCTGTGAAGAAAAGG - Intronic
1049929713 9:444640-444662 AGACCAATTCTGTGATTACAGGG - Intronic
1050241360 9:3639100-3639122 AGAGAAATTCTGTGCTTATGGGG - Intergenic
1050330371 9:4539927-4539949 AGAGAAATTCTGGGCAGAAGAGG + Intronic
1050819224 9:9856406-9856428 AGAGAAATTCTAGGCAGAAAAGG - Intronic
1051101520 9:13527830-13527852 TGAGAAATACTGTGAGCAAAAGG - Intergenic
1051630487 9:19136164-19136186 CGAGAAATTATGGGAAGAAAGGG - Intronic
1052170383 9:25388199-25388221 TAAGAAATTCTGTGTATAATGGG + Intergenic
1052528198 9:29649053-29649075 AGAGGAATTCAGAGATTAAATGG - Intergenic
1052593708 9:30531566-30531588 AGAGAAATTCTAGGCAGAAAAGG - Intergenic
1052738910 9:32374783-32374805 AAAGAAACACTGTGAATCAAGGG + Intergenic
1052962431 9:34310766-34310788 TGAGAGATTCTTTGAATAATGGG + Exonic
1056289056 9:85123754-85123776 AGGGAAATTCTAAAAATAAAAGG + Intergenic
1057578867 9:96267702-96267724 ATAGAAATTATGAGAAAAAAAGG + Intronic
1058048948 9:100387271-100387293 AGAGTAGTACTGTGAATGAAAGG + Intergenic
1058960280 9:109986391-109986413 AGAGAAATTCCAAAAATAAAGGG + Intronic
1059645101 9:116258098-116258120 AGATAAACTGTGTGCATAAATGG + Intronic
1059712083 9:116877815-116877837 GGAGAATTTCTATGACTAAATGG - Intronic
1059892690 9:118821218-118821240 AGTAAAATTCTCTGAATAGAAGG + Intergenic
1060783652 9:126432259-126432281 AGAGAAATGCTGAAAACAAAGGG + Intronic
1203731621 Un_GL000216v2:96908-96930 AGAGAAATTGTTTGGATATAGGG - Intergenic
1186033271 X:5392618-5392640 AGAGAAATTCTGGGCAGAAGAGG - Intergenic
1186127160 X:6426338-6426360 AGGGAAATTCTGGGCAGAAAAGG - Intergenic
1186393508 X:9184508-9184530 AGAGAAATTTTCTTAATAACTGG - Intergenic
1187017464 X:15344368-15344390 AGAGAATTTCAGTGAATGAAGGG + Intergenic
1187128026 X:16472197-16472219 ACAGAAAATATGTGTATAAATGG + Intergenic
1188097214 X:26039449-26039471 ATAGAAATTCAGTGATAAAAAGG - Intergenic
1188397332 X:29701822-29701844 AGAGAAAGAGTGAGAATAAAGGG + Intronic
1189392960 X:40592512-40592534 AGAAAAAATTTGTGAAAAAAAGG + Intronic
1189530005 X:41870058-41870080 AGAGAAAATCTATGAGGAAATGG + Intronic
1189710772 X:43809356-43809378 AGAGTAAATGTGTGAGTAAATGG + Intronic
1190406885 X:50097180-50097202 AGAGAATTTCTGAGAACAATGGG + Exonic
1190890318 X:54561726-54561748 GGATACAGTCTGTGAATAAATGG - Intergenic
1191710514 X:64145522-64145544 AGAGAAACCCTGTAAATATAAGG - Intergenic
1192330823 X:70173935-70173957 AGAAAAATTTGGTGAATGAAGGG + Intergenic
1192709881 X:73569369-73569391 AGACAAATTCTTTGAAGTAAAGG - Intronic
1192925625 X:75752172-75752194 AAAGAAATTAAGAGAATAAAAGG - Intergenic
1193033400 X:76923808-76923830 AATGAAATTCTGGGAATAACAGG - Intergenic
1193111061 X:77731439-77731461 AGAGAAATTCTAGGAAGACAAGG + Intronic
1193184222 X:78493204-78493226 AGAGAAAGTCTGAGAGTAAATGG + Intergenic
1193436097 X:81476778-81476800 ATAGAAATTATGAGAATAAAAGG - Intergenic
1193580135 X:83253779-83253801 TCAGAAATTCTGAAAATAAAAGG + Intergenic
1194176259 X:90651719-90651741 AGAGAAATTCTAGGCAGAAAAGG - Intergenic
1194405543 X:93492103-93492125 ATATATATTCTGTGAATGAATGG + Intergenic
1194639308 X:96383646-96383668 AGAGAAATTCTGTTAAATGAGGG + Intergenic
1194658244 X:96599062-96599084 AGAGAAGTTTTGAGAAAAAAGGG + Intergenic
1195367184 X:104137870-104137892 ACAGAACATCTGTGAACAAAAGG - Intronic
1195650533 X:107278682-107278704 AGAGAAATTCTAGGAAGACAGGG - Intergenic
1195842548 X:109190268-109190290 AGAGACATTCTGAGTAGAAAGGG + Intergenic
1196274059 X:113745655-113745677 AGAGAAATTTTCTTCATAAAAGG + Intergenic
1196882834 X:120214225-120214247 AGAGAAATTTAATGAAGAAATGG + Intergenic
1197124891 X:122932640-122932662 AGAGAAATTCTGTTAAGATCAGG - Intergenic
1197257195 X:124275857-124275879 GGAGGAATTCTGTAAGTAAAAGG + Intronic
1197829792 X:130629493-130629515 AGAGAAATGCTGGGGATACAAGG - Intronic
1198138092 X:133774674-133774696 AGAGCCATTGTGAGAATAAAAGG - Intronic
1198436973 X:136626723-136626745 ATAGAAATACTGTGAAAAACAGG - Intergenic
1198522973 X:137471459-137471481 GGAGAAATTCTGAGAATAGTTGG - Intergenic
1198670174 X:139071685-139071707 GGAGAAATTCTATGAATAACAGG - Intronic
1199336994 X:146630160-146630182 AGAGAAATTCTGGGCAGAAGAGG + Intergenic
1200315170 X:155124796-155124818 AGAGAAATTATTTGAAAACATGG + Intronic
1200377751 X:155802162-155802184 AGAGAAATTTTGATAGTAAATGG - Intergenic
1200522884 Y:4232664-4232686 AGAGAAATTCTAGGCAGAAAAGG - Intergenic
1201609397 Y:15823821-15823843 AGGGAAATTCTGGGCAGAAAAGG - Intergenic