ID: 945785525

View in Genome Browser
Species Human (GRCh38)
Location 2:214230972-214230994
Sequence TGCTTCCAATTTAAGATCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 221}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945785525_945785529 6 Left 945785525 2:214230972-214230994 CCAAAGATCTTAAATTGGAAGCA 0: 1
1: 0
2: 0
3: 26
4: 221
Right 945785529 2:214231001-214231023 AGGGGTTATAATGCCTTCTTTGG 0: 1
1: 0
2: 1
3: 20
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945785525 Original CRISPR TGCTTCCAATTTAAGATCTT TGG (reversed) Intronic
904776272 1:32908983-32909005 GTCTTCCAATTTATGAACTTAGG - Intergenic
906088716 1:43158864-43158886 GACTTCCAATTAAAGATCTTAGG + Intergenic
907898702 1:58717742-58717764 TTGTTCTAATTTAAGAACTTAGG + Intergenic
908924931 1:69242584-69242606 AGCTTCCAATTCATGAACTTTGG - Intergenic
909475889 1:76080491-76080513 TGGGGCCAATTTAAGATCTGGGG + Intronic
911614465 1:99993310-99993332 TGTTTCCAATTCAAGGTTTTTGG + Intronic
915926896 1:160029367-160029389 TGATTACAATTTAAATTCTTTGG + Exonic
916799142 1:168198393-168198415 TTTTTCCCATTTAAGATTTTTGG - Intronic
920595163 1:207261813-207261835 TTCTTCCAATTCATGAGCTTGGG - Intergenic
921368114 1:214394111-214394133 TGCCTCCAATTTAAGAAGTCTGG - Intronic
921642764 1:217575568-217575590 TGCTTCCAATTTGATTGCTTTGG + Intronic
922090288 1:222389375-222389397 TGCCTCCAAGTTAAAATCCTTGG + Intergenic
923585717 1:235268250-235268272 TCCTTCCATTTTAACTTCTTTGG - Intronic
923823896 1:237477807-237477829 TGCTCCCACTTTAAAAGCTTAGG - Intronic
924305037 1:242679387-242679409 TGCTTCCAATTTATGAAGTTTGG + Intergenic
924475644 1:244380073-244380095 TGCTTTGAATTTTAGTTCTTGGG + Intronic
1064307273 10:14178744-14178766 TGCTTGCAATTTACCATCTGGGG + Intronic
1065284146 10:24171055-24171077 TGCTACCAATCTAAGCTTTTAGG - Intronic
1066048592 10:31615899-31615921 TGCTTCCTGTTTAAGAACTGGGG + Intergenic
1067929000 10:50540760-50540782 TGATTTCAACTTAAGATCATGGG + Intronic
1069040439 10:63690484-63690506 TCCTTGCAATGTAGGATCTTTGG + Intergenic
1069298799 10:66880813-66880835 AGCTTCCAATTTAGCATTTTAGG - Intronic
1071740936 10:88357323-88357345 AACTTCAAATTTAAGATCCTGGG + Intronic
1076337388 10:129717241-129717263 TGCATCTAATTTGAAATCTTTGG + Intronic
1077257994 11:1597715-1597737 TGCTGCCAGTGTAAGATCTGAGG - Exonic
1077261091 11:1621405-1621427 TGCTGCCAGTGTAAGATCTGAGG - Exonic
1077262568 11:1630534-1630556 TGCTGCCAGTGTAAGATCTGAGG + Exonic
1078181653 11:9016702-9016724 TGCCTACAATTTAAGGTCCTGGG - Intergenic
1078237272 11:9497089-9497111 TGATTCCACTTTGAGCTCTTGGG + Intronic
1078748331 11:14136594-14136616 TGCCTCCAATTTAGGGTCTGTGG - Intronic
1078911853 11:15739918-15739940 TGCCTGCAATTTCAGAGCTTTGG - Intergenic
1079598335 11:22281551-22281573 TGCAACCAATGTAGGATCTTTGG + Exonic
1079654210 11:22968112-22968134 TGCTTACAATCTCAGAACTTTGG - Intergenic
1079699916 11:23532445-23532467 TGCCACAAATTTAAGTTCTTAGG + Intergenic
1080338964 11:31234513-31234535 TGATTGCTAGTTAAGATCTTTGG - Intronic
1080367344 11:31590964-31590986 TTCATCAAAATTAAGATCTTTGG + Intronic
1081507235 11:43731295-43731317 TTCATCCAGTTTAAGATTTTAGG - Intronic
1082733953 11:56835672-56835694 TTCTTCCAATTTAAAAACATAGG + Intergenic
1084798850 11:71527778-71527800 TGCTGCCAGTGTAAGATCTGAGG + Exonic
1084803992 11:71566176-71566198 TGCTGCCAGTGTAAGATCTGAGG + Exonic
1084806425 11:71582365-71582387 TGCTGCCAGTGTAAGATCTGAGG - Exonic
1086813048 11:91334903-91334925 TGCTTCCAATCTGCCATCTTAGG - Intergenic
1087137659 11:94736979-94737001 TGATTCCAATTTTCTATCTTAGG - Intronic
1089028158 11:115293588-115293610 TGCTTCAAATTTATGATTTTGGG - Intronic
1089836471 11:121374799-121374821 TGCTTCCTCTTTAAGATCATGGG - Intergenic
1092956621 12:13557017-13557039 GGCTTTCAATTTAAGGTTTTGGG + Exonic
1093640527 12:21522462-21522484 TGCTTCAAATGTGAGATTTTAGG - Intergenic
1096046861 12:48570031-48570053 TGCTTCCATTTCAGGTTCTTGGG - Exonic
1097902274 12:64885033-64885055 TGCTTCCAATTTCATATCTATGG + Intergenic
1098937361 12:76496036-76496058 TTCTACCAATTTACCATCTTTGG + Intronic
1099453385 12:82835467-82835489 TGGATCCAATTTTAGGTCTTAGG + Intronic
1099953446 12:89328989-89329011 TGCTTGCCCTTTAAGAGCTTAGG + Intergenic
1100515313 12:95321835-95321857 TGCTTGCAACTAAAGATCTTTGG + Intergenic
1102640484 12:114362240-114362262 TGCTTCCAAATAAAGAACTTAGG + Intronic
1107058956 13:36134987-36135009 TGCTTCTCATTTGACATCTTTGG + Intergenic
1109467672 13:62759307-62759329 TTCTTCCAATTCATGAACTTGGG - Intergenic
1109967633 13:69722036-69722058 TGGTTACATTTTAATATCTTAGG - Intronic
1109988833 13:70026681-70026703 TGCTGTCAATTTAAGAACTTAGG + Intronic
1110041820 13:70770540-70770562 AGCTTCCTATTAAAGGTCTTAGG + Intergenic
1111463217 13:88573613-88573635 TGATTCCAATTTAATTTATTTGG + Intergenic
1112301999 13:98239373-98239395 TGCTTGCAATTGGAGCTCTTTGG + Intronic
1112979596 13:105366236-105366258 GTATTCCAATTTAAGATATTTGG + Intergenic
1113270834 13:108672122-108672144 TTCTTACAATTTAAGAAATTTGG + Intronic
1116159469 14:41250723-41250745 TGTTGCCAATTTAATATATTTGG + Intergenic
1117786556 14:59291901-59291923 CACTTCCCATTTAAGATCTAGGG + Intronic
1117896303 14:60490910-60490932 TCATTCCAATTCAAAATCTTGGG + Intronic
1121679145 14:95778235-95778257 GTTTGCCAATTTAAGATCTTGGG - Intergenic
1121764297 14:96472596-96472618 TGCTTGCTACTTAAGATATTTGG + Intronic
1125579158 15:40773629-40773651 TCCTTCCAAATTCAGATCTTGGG - Intronic
1126399501 15:48255137-48255159 TCCTTCCAGTTTAAGAATTTGGG + Intronic
1128632199 15:69278855-69278877 TGCTTCCATTTTAAGGTATGTGG + Intergenic
1128748527 15:70132079-70132101 AGCTTCCAAAGTAAGCTCTTCGG + Intergenic
1131352271 15:91712207-91712229 TGCTTCAAATTAAAGTTCTTGGG - Intergenic
1131600011 15:93837646-93837668 CTCTTCCAATTTAAGACCTCAGG - Intergenic
1133553099 16:6877881-6877903 TGCTTCCAGACTAAGAACTTAGG + Intronic
1134566183 16:15253809-15253831 TGTTTCCATTTTTAGGTCTTCGG - Intergenic
1134736312 16:16502889-16502911 TGTTTCCATTTTTAGGTCTTCGG + Intergenic
1138099506 16:54241272-54241294 TGCTTCCAACTTAAGTGGTTTGG - Intergenic
1138750365 16:59412309-59412331 TGCTTCCAATTTAAAATTGAAGG - Intergenic
1138818766 16:60233567-60233589 TCCTTACAATTTCATATCTTAGG - Intergenic
1138907652 16:61357147-61357169 TATTTCCATTTTAAGTTCTTTGG - Intergenic
1138993147 16:62417057-62417079 TTCTTCCAATTTTATAACTTGGG + Intergenic
1144071830 17:11681006-11681028 TCCTTCCCATTTAGGACCTTTGG + Intronic
1150169259 17:62975163-62975185 TGCTTCAAATCTCAGATCTCAGG + Intergenic
1151042532 17:70879878-70879900 TGTTTCCAATTTCAGATTTGAGG + Intergenic
1153357193 18:4150133-4150155 TGCTTCCAACTCTTGATCTTTGG + Intronic
1154264068 18:12864368-12864390 TGTTTACAATTTAAAATCTTTGG - Intronic
1154954031 18:21238289-21238311 TTCTCTCAATTTAAGATCTGAGG - Intergenic
1155417839 18:25619752-25619774 TGTTTCCAATCTCAAATCTTAGG - Intergenic
1157051897 18:44175973-44175995 TGCTTTCCAATTAATATCTTGGG - Intergenic
1157493087 18:48137298-48137320 TGACACCAAATTAAGATCTTTGG + Intronic
1158307108 18:56117832-56117854 TTCTTCCATTTTAATATCTTAGG + Intergenic
1158535055 18:58300831-58300853 TACTTCCAATTTAGAATCTGAGG - Intronic
1159747240 18:72253287-72253309 TTCTTCCAGTTTTTGATCTTTGG - Intergenic
1162362009 19:10226240-10226262 TGCTCCCAAGATAAGGTCTTGGG + Intronic
1164103199 19:22077658-22077680 TGTTTCCAAATTAAGACATTTGG + Intronic
925627374 2:5854505-5854527 TGCTTGTAATTTCAGAACTTTGG - Intergenic
926435359 2:12832064-12832086 TTCTTCCAATTTTAGTTCTGTGG + Intergenic
926445815 2:12941893-12941915 TGCTTGCAATTTCAGCACTTTGG + Intergenic
928052327 2:28011947-28011969 TGCTCCAAGTTTAAAATCTTTGG + Intronic
928833330 2:35515165-35515187 TGTTTTTAATTCAAGATCTTTGG + Intergenic
929315439 2:40472506-40472528 TTCAACCAATGTAAGATCTTTGG + Intronic
929461493 2:42105150-42105172 ATCTTCCAATTTAAAATTTTTGG - Intergenic
930315510 2:49792486-49792508 TGCCTCCAATTTCAGATACTAGG + Intergenic
930513431 2:52375404-52375426 TGCTTACAATGTAAGGTATTCGG - Intergenic
933904461 2:86876500-86876522 CGCTTCCATTTTAAAATCCTTGG - Intergenic
936367778 2:111875651-111875673 CGCTTCCATTTTAAAATCCTTGG + Intronic
937732388 2:125249207-125249229 TGCTTCCAATCAAACATCTTTGG + Intergenic
938052497 2:128187465-128187487 TGCTTCCAGTTTCGGCTCTTTGG - Exonic
939519422 2:143210860-143210882 TGCATCCAACTTTAGATATTTGG + Intronic
939838849 2:147162602-147162624 TGCTGACAATTTAAGATAGTGGG - Intergenic
942427199 2:175872535-175872557 TGGTTCAATTTTTAGATCTTGGG - Intergenic
943042549 2:182820622-182820644 TGCTTCCTTTTTAATAACTTAGG + Intergenic
944206354 2:197162596-197162618 AGCCTCTAATTTAAGATTTTTGG + Intronic
945018263 2:205543179-205543201 AGCTTACAATCTGAGATCTTAGG + Intronic
945198905 2:207262348-207262370 TGCTTGTAATTTAAGCACTTTGG + Intergenic
945237095 2:207641062-207641084 TGCTTGCAACTCCAGATCTTTGG - Intergenic
945785525 2:214230972-214230994 TGCTTCCAATTTAAGATCTTTGG - Intronic
947362115 2:229356460-229356482 AGCTTGCAAATTCAGATCTTGGG - Intergenic
948183889 2:236003847-236003869 TTCTTTCATTTTAAGTTCTTTGG - Intronic
948350116 2:237333375-237333397 TGATTCCAATTTAACTTCCTGGG - Intronic
1172363956 20:34334695-34334717 TGTTTCCAATTTCAGTGCTTAGG - Intergenic
1174523679 20:51154734-51154756 TGCTGCCAATATCAGATCATGGG - Intergenic
1175608335 20:60329707-60329729 TGCTTCCTATGGAAGATCTAAGG - Intergenic
1177861273 21:26457419-26457441 CGCTTTGAATTTAAGAACTTTGG + Intergenic
1178042231 21:28652109-28652131 TGTTTGCATTTTAAGATCTTAGG - Intergenic
1178475603 21:32934606-32934628 TGTTTGCAAATTAAAATCTTGGG + Intergenic
1178680218 21:34668334-34668356 TGCCTCCAAGTTAAGAGCTTGGG - Intergenic
1179333955 21:40432575-40432597 TGCTTCGGATTCAACATCTTTGG + Intronic
1179975418 21:44862858-44862880 TGCTTGCAATTAACGATTTTTGG + Intronic
1180126730 21:45796851-45796873 TGCTTCCATTCTAAGAGGTTTGG - Intronic
1181887885 22:26036049-26036071 TGCTTCCTATGTACAATCTTTGG - Intergenic
1184082177 22:42230148-42230170 TGCTTCAACTTTAAGGTGTTTGG - Intronic
1184485906 22:44779359-44779381 TGCTTGCAATCCAAGAACTTTGG - Intronic
954727955 3:52631941-52631963 TGATTCCAACTTAAGATTTTTGG + Intronic
955744675 3:62128304-62128326 TCCTTCCACTTTAAGATCAAAGG - Intronic
957013329 3:75033201-75033223 TTCTTCCAATTTAAGGTAATTGG - Intergenic
957050117 3:75405149-75405171 TGTTTTCAAGTAAAGATCTTGGG - Intergenic
957219978 3:77369642-77369664 TGCTCCCAATTAAAGTTTTTTGG + Intronic
957922244 3:86760558-86760580 TGCTTCCAATCCACAATCTTGGG + Intergenic
959089019 3:101882542-101882564 TGCTTACAATTTCAGCACTTTGG - Intergenic
959585887 3:108024961-108024983 TGCTTAGATTTTAAGATATTTGG - Intergenic
962233611 3:133688495-133688517 TCCTTGCATTTTCAGATCTTTGG - Intergenic
963469843 3:145726509-145726531 TGCTTCCAAATTAAAAACCTTGG + Intergenic
963605393 3:147408712-147408734 TGTTTATAATTTAAGATCTTGGG - Intronic
964072216 3:152648335-152648357 TGTTTACAATTTTAGATATTAGG - Intergenic
964266145 3:154897746-154897768 TGGTACCATTTTAAGATCTATGG - Intergenic
964312251 3:155406776-155406798 TTCTTCCAATTTATGAACATGGG - Intronic
964565246 3:158043501-158043523 TTCTTCCAATTTATGAGCATTGG - Intergenic
965410313 3:168321881-168321903 TGTTTCCAATTTCAGATTTTGGG - Intergenic
966039677 3:175466494-175466516 AGCTTCCAACTTAAAATTTTAGG - Intronic
967541792 3:190677032-190677054 TGTTTCAAATATAATATCTTTGG + Intergenic
974155313 4:58063847-58063869 TACTTCCAATTTAATGCCTTGGG + Intergenic
974261075 4:59524549-59524571 TTCTTCCAATTTATGAGCATGGG + Intergenic
974444970 4:61968122-61968144 AGTTTCCAACTTAAGAACTTTGG + Intronic
976723039 4:88188471-88188493 TGCTTCTAATCTCAGTTCTTTGG - Intronic
977663477 4:99617563-99617585 TGCCAGGAATTTAAGATCTTTGG + Intronic
977731552 4:100359515-100359537 TGCTTCCAATTTTGAATCTTTGG + Intergenic
978348387 4:107795982-107796004 TGCTTCCACTTAGAGATCTAGGG + Intergenic
978489106 4:109292225-109292247 TGCTTCCAATTTCATATTATGGG + Intronic
978805526 4:112796058-112796080 TGCTTGCAATTCCAGAACTTTGG - Intergenic
979988054 4:127339702-127339724 AGCTTCAAATTTAATTTCTTTGG - Intergenic
980316148 4:131203437-131203459 TGTTTCCAGTTTCAGAGCTTTGG - Intergenic
980353201 4:131709590-131709612 CGTTTCTAATTAAAGATCTTAGG + Intergenic
980400174 4:132273227-132273249 TTCTTCCCATTTATCATCTTAGG - Intergenic
984445116 4:179827129-179827151 TTCTTCCATTTTAAGAAATTTGG + Intergenic
986062849 5:4207964-4207986 TGTTTCCTATTGAAGATCTTCGG - Intergenic
987921846 5:24293781-24293803 TACTTCATATTTAAGATTTTTGG + Intergenic
988099919 5:26662277-26662299 TTCTTCGAATTTAAGAAGTTTGG + Intergenic
993236578 5:85318332-85318354 TGTTTCCAATATAAAATATTCGG + Intergenic
994055684 5:95411982-95412004 TGCTGACAATTTAAGATAGTGGG + Intronic
994242427 5:97440260-97440282 TGCTTCCCATTAAACTTCTTTGG + Intergenic
994666419 5:102710909-102710931 TTCCTCTAATTCAAGATCTTGGG + Intergenic
997130161 5:131268710-131268732 TGCTTCCAATCTCAGCACTTTGG - Intronic
997720235 5:136072353-136072375 TGCTTCCATGTTAAGTTCTCAGG - Intergenic
999741474 5:154557326-154557348 AGCTTCCAACTTAAGAAATTAGG - Intergenic
999920649 5:156316333-156316355 TTCTTCCAATTTATGAACATAGG - Intronic
1000244626 5:159439174-159439196 TGGATCCAATTTAAAGTCTTGGG + Intergenic
1002989769 6:2227869-2227891 TGCTTCCAACTTCAGTTCTGTGG + Intronic
1003767220 6:9252684-9252706 TGATTCCAAGTGAAGATTTTTGG + Intergenic
1004555443 6:16692817-16692839 ATCTGCCAATTTGAGATCTTGGG - Intronic
1006028729 6:31163821-31163843 TTCTTCCATTTTAAAAACTTGGG - Exonic
1010012378 6:71063657-71063679 TTCTTCCAATTTATGAACGTGGG + Intergenic
1010954915 6:82079038-82079060 TACTTACTATTTAAAATCTTTGG - Intergenic
1011148995 6:84248027-84248049 TGTTTCCAACTTAAAATATTAGG - Intergenic
1011366904 6:86592315-86592337 TGCCTACTATTTTAGATCTTAGG + Intergenic
1011411647 6:87072730-87072752 TGCTTCAAAATTAAGACCTTAGG + Intergenic
1012549565 6:100454683-100454705 TGTTTCCCCGTTAAGATCTTTGG + Intronic
1013824446 6:114194710-114194732 TGCTGCCAATTTTAGAACATGGG + Intronic
1015128033 6:129776304-129776326 TGCCTCCAAATTGAGATATTAGG - Intergenic
1016215146 6:141590823-141590845 AGCTTCCAATTTAAGAAGCTGGG - Intergenic
1016498527 6:144691043-144691065 TGCTTCCAATTCAACATCTAGGG + Intronic
1018453904 6:163935252-163935274 TAGTTTCATTTTAAGATCTTGGG + Intergenic
1018660564 6:166082684-166082706 TGCCTCCAATTCAAGAGCATGGG + Intergenic
1019868779 7:3738166-3738188 TGCTTTCAATTTTAGGTCTTAGG + Intronic
1022674334 7:32484299-32484321 TGCTTCCACTTTGAGACATTAGG + Intergenic
1023788636 7:43734329-43734351 AGCTTCCACTTTAAGAAATTGGG + Intergenic
1024489793 7:49967325-49967347 TGCTTCCAAATTAAAAGATTGGG - Intronic
1026294467 7:69039244-69039266 TGCCTACAATTTCAGGTCTTTGG + Intergenic
1028427183 7:90702693-90702715 TGCTTCCTATTTTATTTCTTAGG + Intronic
1030197496 7:106867408-106867430 TGCTTCCAGTTTAAAATACTTGG + Intronic
1030951215 7:115792492-115792514 TGCTTCCAATACCAGAACTTTGG + Intergenic
1031063214 7:117075441-117075463 TGCTCCCAAATTAAGATATTTGG + Intronic
1032728747 7:134616618-134616640 TGCCTCCAATTTTACTTCTTTGG - Intergenic
1033774766 7:144596560-144596582 TTCTTCCAATTCAAGAACATGGG - Intronic
1036112688 8:5921609-5921631 TCCTTCCAATTTTAGATGTTAGG + Intergenic
1037117315 8:15242361-15242383 TGCTTCCAGTTTCAAATTTTTGG - Intergenic
1037179045 8:15982532-15982554 TTCTCTCAAATTAAGATCTTTGG + Intergenic
1039096732 8:33895017-33895039 TGCTTCTAATTAAAGATTATTGG - Intergenic
1039344060 8:36684517-36684539 TTGTTCCAATGTAAGATCTCAGG + Intergenic
1040590411 8:48787772-48787794 TGCATCCACTTTGACATCTTGGG + Intergenic
1040638962 8:49308556-49308578 TGTTTCTACTTTAAAATCTTTGG - Intergenic
1040816265 8:51511522-51511544 TGCTTCCAAATTAAAATCATCGG + Intronic
1041716006 8:60932760-60932782 TGCTTCCAATCTGTAATCTTGGG + Intergenic
1042474395 8:69230375-69230397 TGGGTGCAGTTTAAGATCTTTGG - Intergenic
1044224733 8:89705587-89705609 TGCCTCCAATCTGACATCTTGGG + Intergenic
1045857161 8:106777888-106777910 TGCTCCCAGTTTATGACCTTTGG + Intergenic
1047472615 8:125192659-125192681 TCATTTCAATTTAAGATTTTAGG + Intronic
1048632450 8:136258855-136258877 TGTTTCTAATTTATTATCTTGGG + Intergenic
1050357725 9:4798834-4798856 TGCTTCCAAGTGATGATTTTTGG + Intronic
1050449039 9:5760250-5760272 TCCTTCAAATTTAGGATTTTGGG + Intronic
1050493520 9:6215070-6215092 TCCTTCCAATGTGTGATCTTAGG + Intergenic
1050579462 9:7036101-7036123 TTCTTCCAATCTATGAGCTTGGG + Intronic
1050974339 9:11917374-11917396 GTCTTCCAATTTATGATCATGGG + Intergenic
1051322059 9:15915242-15915264 TCCTTCCAATTCATGATCATTGG + Intronic
1051373266 9:16377131-16377153 TTCTTCCAAATAAACATCTTAGG + Intergenic
1052844125 9:33319808-33319830 TACTTACAATTTTAGTTCTTTGG - Intronic
1055825873 9:80324029-80324051 TACATTCAATTTAAGAACTTCGG - Intergenic
1058023994 9:100120065-100120087 TGCTTCAAATTCCAGATGTTGGG + Intronic
1059646662 9:116274863-116274885 AGCTTCCAATTCAAAGTCTTGGG - Intronic
1186501737 X:10056225-10056247 TGCATCAAATTTAAGATATAGGG + Intronic
1188228769 X:27634887-27634909 TGTTTCAAATTTCAGATTTTTGG - Intronic
1191016733 X:55817111-55817133 TTCTTCCAATTCAAGAGCATGGG + Intergenic
1191653802 X:63574134-63574156 TGCTTCCAATCTATGAACATGGG - Intergenic
1191795380 X:65016261-65016283 TGATTCCCACTTAAGATCATTGG - Intronic
1191853300 X:65602071-65602093 GGCTTCCAAGTTTAGAACTTGGG - Intronic
1193404014 X:81080448-81080470 TTCTTCCAATTAATGATCATGGG - Intergenic
1193696428 X:84712134-84712156 TTCTTACATTTTCAGATCTTTGG + Intergenic
1194078109 X:89422740-89422762 TGGTGCCAATTTAAAATGTTTGG - Intergenic
1194473497 X:94328782-94328804 TGTTTCCAGTTTAAAATATTTGG - Intergenic
1195317642 X:103694280-103694302 AGCTGTCAATTTCAGATCTTAGG + Intergenic
1195884755 X:109626227-109626249 TGTTTCCAATTTAACATATCTGG - Intronic
1197235300 X:124055596-124055618 TGATTGCAGTTAAAGATCTTTGG + Intronic
1198107569 X:133476016-133476038 TGCCTTAAAATTAAGATCTTTGG - Intergenic
1199213657 X:145243173-145243195 TGATACCAATTTAAAACCTTAGG + Intergenic
1200430755 Y:3078286-3078308 TGGTGCCAATTTAAAATGTTTGG - Intergenic
1201930715 Y:19343234-19343256 TGTTTCCAATTGAACTTCTTTGG + Intergenic
1201976623 Y:19856457-19856479 TGTTTCCAATTGAACTTCTTTGG - Intergenic