ID: 945787871

View in Genome Browser
Species Human (GRCh38)
Location 2:214266138-214266160
Sequence TACAAAGACACTCATAGATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 293}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945787871_945787874 17 Left 945787871 2:214266138-214266160 CCTTATCTATGAGTGTCTTTGTA 0: 1
1: 0
2: 3
3: 26
4: 293
Right 945787874 2:214266178-214266200 ACTAATAGGAATGAAAACTAGGG 0: 1
1: 0
2: 0
3: 21
4: 281
945787871_945787875 28 Left 945787871 2:214266138-214266160 CCTTATCTATGAGTGTCTTTGTA 0: 1
1: 0
2: 3
3: 26
4: 293
Right 945787875 2:214266189-214266211 TGAAAACTAGGGTAGCGAAGAGG 0: 1
1: 0
2: 0
3: 6
4: 91
945787871_945787873 16 Left 945787871 2:214266138-214266160 CCTTATCTATGAGTGTCTTTGTA 0: 1
1: 0
2: 3
3: 26
4: 293
Right 945787873 2:214266177-214266199 AACTAATAGGAATGAAAACTAGG 0: 1
1: 0
2: 1
3: 18
4: 347
945787871_945787872 3 Left 945787871 2:214266138-214266160 CCTTATCTATGAGTGTCTTTGTA 0: 1
1: 0
2: 3
3: 26
4: 293
Right 945787872 2:214266164-214266186 AACAAAGACAGACAACTAATAGG 0: 1
1: 0
2: 2
3: 31
4: 441

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945787871 Original CRISPR TACAAAGACACTCATAGATA AGG (reversed) Intronic
900076140 1:819317-819339 TACAAACACAGTCATGGAGAAGG + Intergenic
900664700 1:3807184-3807206 TAAAAAGAAACTAATAGGTAGGG + Intergenic
905949008 1:41929682-41929704 CACATATACACTGATAGATACGG - Intronic
908628010 1:66068680-66068702 TACAAACACACTTTTATATAAGG + Intronic
908872715 1:68632602-68632624 TACAAAGTCATTCATAAAGAAGG - Intergenic
909252182 1:73372230-73372252 TACACACACACACATATATATGG + Intergenic
910713035 1:90201543-90201565 TACACACACACACACAGATAGGG - Intergenic
912057428 1:105622572-105622594 CAAAAAGACTCTCATTGATAAGG + Intergenic
912063425 1:105703647-105703669 TACACACACACACATATATATGG - Intergenic
913342059 1:117768450-117768472 TACAAAGATACTCCTCGAGAAGG - Intergenic
913446547 1:118956421-118956443 TACAAAAACACACACAGAGATGG + Intronic
916914596 1:169392614-169392636 TACAAAGATACTCACAGCTTGGG - Intronic
917697356 1:177539511-177539533 TACAAACACACTAAAAGAAATGG + Intergenic
918993196 1:191725206-191725228 TTCAAAGAAATTCATAAATAGGG - Intergenic
920944199 1:210512692-210512714 TACACACACACACATATATATGG - Intronic
921919755 1:220654512-220654534 TACAAAGTCACTGACTGATATGG - Intronic
922682072 1:227607312-227607334 TACAAAGACCCTCAGAAAGAGGG - Intronic
923029678 1:230237914-230237936 GACAAAGACACTGTTAGATAAGG - Intronic
924815370 1:247437005-247437027 TCCAAGGACACTCAGAGAGAAGG + Intronic
1063559932 10:7116407-7116429 TGGAAAGACACCCCTAGATAGGG + Intergenic
1063987789 10:11525395-11525417 TACAAAGTCACAGATAGATTTGG - Exonic
1065176957 10:23086957-23086979 TACAAAAACACACATGGAAATGG + Intergenic
1065688256 10:28307422-28307444 TTCACTGACACTCATAGATTTGG - Intronic
1066827731 10:39626077-39626099 TTCAAAGACAGTGATAGAAAAGG + Intergenic
1066842673 10:39948172-39948194 TTCAAAGACAGTGATAGAAAAGG + Intergenic
1066843498 10:39964464-39964486 TTCAAAGACAGTGATAGAAAAGG + Intergenic
1066849958 10:40092107-40092129 TTCAAAGACAGTGATAGAAAAGG + Intergenic
1066866621 10:40423518-40423540 TTCAAAGACAGTGATAGAAAAGG + Intergenic
1066867421 10:40439136-40439158 TTCAAAGACAGTGATAGAAAAGG + Intergenic
1066869451 10:40479546-40479568 TTCAAAGACAGTGATAGAAAAGG + Intergenic
1066876395 10:40617116-40617138 TTCAAAGACAGTGATAGAAAAGG + Intergenic
1066876655 10:40622208-40622230 TTCAAAGACAGTGATAGAAAAGG + Intergenic
1066882179 10:40730878-40730900 TTCAAAGACAGTGATAGAAAAGG + Intergenic
1066895038 10:40985343-40985365 TTCAAAGACAGTGATAGAAAAGG + Intergenic
1066900577 10:41095028-41095050 TTCAAAGACAGTGATAGAAAAGG + Intergenic
1066911088 10:41300861-41300883 TTCAAAGACAGTGATAGAAAAGG + Intergenic
1067225002 10:44369935-44369957 ATCAAAGACACTCAGAGAAAAGG + Intergenic
1067335654 10:45361014-45361036 TGCAAAGACACACATAGGGATGG + Intergenic
1068283924 10:54910392-54910414 AACATAGACACTCAAATATAAGG - Intronic
1068636503 10:59353927-59353949 TTCTAAGTCACTCATAGATTTGG + Intronic
1070534574 10:77365963-77365985 TCCAAAGACAATAATATATAAGG + Intronic
1070982209 10:80658360-80658382 CACAGAGACACACATAGACATGG - Intergenic
1071467569 10:85955474-85955496 TACAGAGACCCTCCTAGGTAGGG - Intronic
1072081258 10:92034384-92034406 TACAAAAACAATCACACATATGG + Intergenic
1072486285 10:95858964-95858986 TACAAACACACACATATAAAGGG - Intronic
1074780237 10:116797193-116797215 TCCTGAGACACTAATAGATATGG + Intergenic
1077548811 11:3190182-3190204 TGCAAAGACACAAATAAATAGGG + Intergenic
1078078322 11:8181742-8181764 TCCAAATACATTCATAGAAATGG - Intergenic
1079870244 11:25789335-25789357 TAAAAAGACAGTAATAGATATGG + Intergenic
1080118678 11:28649125-28649147 TACAAGAACACTCATACATATGG - Intergenic
1080208872 11:29762007-29762029 AACAGAGACAATCATAGAAAAGG + Intergenic
1080479332 11:32629697-32629719 TATAAAGACACTTATAAAGATGG + Intronic
1081460167 11:43265436-43265458 TACTAAGACACACCTAGATTGGG + Intergenic
1081475131 11:43422147-43422169 CAAAAAGACACTCCTAGAAAGGG + Intronic
1081881343 11:46455477-46455499 CACAAAGACATTCACAGACATGG + Intronic
1085802526 11:79603660-79603682 GACAAATACACTCATATATGTGG + Intergenic
1086971273 11:93083695-93083717 TACACAGACTGTCACAGATAAGG + Intergenic
1087626058 11:100597344-100597366 TGAAAAGATAATCATAGATATGG - Intergenic
1087872227 11:103310573-103310595 TACAAAAACCACCATAGATAAGG - Intronic
1087904658 11:103681766-103681788 TACCAAGACATTCCTAGCTAAGG + Intergenic
1087919510 11:103850109-103850131 TACAATGTAACTCATGGATAGGG + Intergenic
1090521631 11:127486083-127486105 TACAAAGACACTATTACAGAGGG - Intergenic
1091432350 12:447173-447195 TACCAAGTTACTCATATATATGG - Intergenic
1095648101 12:44573701-44573723 TAGAATGAAACTAATAGATATGG + Intronic
1096133208 12:49177269-49177291 TACACACACACACAGAGATAGGG - Intergenic
1096814093 12:54190831-54190853 TACATAGACACACAGAGATGGGG - Intergenic
1096888769 12:54744760-54744782 TACAAAGACATTCATTAAGAAGG + Intergenic
1096928742 12:55180008-55180030 TAAAATCACAGTCATAGATAGGG - Intergenic
1097869707 12:64591011-64591033 TACAAAAACTCTCAAAGATAAGG - Intergenic
1097975251 12:65678898-65678920 AACAAAGACACACAAAGATAAGG + Intergenic
1098438610 12:70495701-70495723 CACAAAGACACTCCTAGAGAAGG - Intergenic
1098966120 12:76790582-76790604 TACAAATACATGTATAGATAGGG + Intronic
1099543586 12:83947220-83947242 TACAAAAACACTCCTATATATGG - Intergenic
1099721730 12:86370843-86370865 TAGAAATACACACATAAATAAGG + Intronic
1099851844 12:88108763-88108785 TACAAAGTAACTTACAGATAAGG + Intronic
1099868369 12:88314407-88314429 CAAAAATACACTCATAGAAATGG - Intergenic
1100512456 12:95289872-95289894 TACAGATACATACATAGATAAGG - Intronic
1101589077 12:106110527-106110549 TACAAAGAAACACAGAGGTAAGG + Intronic
1105904873 13:24797958-24797980 TTCAAAAACAATCATAAATAAGG - Intronic
1106146178 13:27052047-27052069 TACACATACACACATATATATGG + Intergenic
1106211840 13:27656332-27656354 GACACAGACACACACAGATATGG - Intronic
1106512961 13:30427255-30427277 TACAAATACACTCATGCAAAGGG - Intergenic
1108586233 13:51872366-51872388 CAAAAAGACAAACATAGATAGGG + Intergenic
1109100093 13:58172823-58172845 TACAAATACATTTATATATAGGG + Intergenic
1109558999 13:64022608-64022630 CACAAACACACACATATATAAGG - Intergenic
1109744387 13:66603553-66603575 TACATTGACATTCATATATAGGG + Intronic
1110685461 13:78368025-78368047 TACAAAGACACTCATTGGTGAGG - Intergenic
1111518448 13:89365791-89365813 TACAAAGACACAAATACACATGG + Intergenic
1112116247 13:96358343-96358365 TACCAAGAAACACATGGATAAGG - Intronic
1112905321 13:104411494-104411516 TACAAAGTCATTCATAGCTGTGG + Intergenic
1112961794 13:105136004-105136026 TACAAAAACATGCATAGATAAGG + Intergenic
1114721142 14:24883161-24883183 TACAAACACACACATAGATATGG + Intronic
1114817836 14:25980821-25980843 TACAAAGATACTCCTTGAGAAGG + Intergenic
1116921049 14:50575491-50575513 TACAGAGACAAACAGAGATAAGG - Intronic
1117425444 14:55590619-55590641 TACAAATAAACTCATACAGAAGG - Intronic
1117838404 14:59831600-59831622 TACATACACACACATACATATGG - Intronic
1119583453 14:75809341-75809363 AACAAAGATACTCATAGATTTGG - Intronic
1120939859 14:89937330-89937352 TTCAAAGACACTGTTGGATAGGG - Intronic
1121056351 14:90857559-90857581 AACACAGAAACTCATAGTTAGGG + Exonic
1121213047 14:92223589-92223611 TAAAATGACACACATACATATGG + Intergenic
1124442684 15:29698869-29698891 AACACAGACACACATATATAAGG - Intergenic
1124916785 15:33983233-33983255 TACACACACACACATATATATGG + Intronic
1125445269 15:39747589-39747611 CAGAAAGACATTCTTAGATATGG - Intronic
1125447587 15:39774650-39774672 TACAAAGTCACTTATAGCTAGGG + Intronic
1126524883 15:49642080-49642102 TACAAAAATATTCAGAGATATGG - Intronic
1127048089 15:55049058-55049080 TAGAGAGACAGACATAGATATGG + Intergenic
1127126113 15:55813465-55813487 TGCAAAAACAATCATAAATATGG + Intergenic
1127284201 15:57518292-57518314 ACCGAAGACACCCATAGATATGG - Intronic
1127379376 15:58417495-58417517 TACAAAGAAAATCATACATGTGG + Intronic
1129381409 15:75169840-75169862 TACAAACACACACAAAGACAAGG - Intergenic
1129693499 15:77727488-77727510 TACAAAAAGACACATATATATGG + Intronic
1131022200 15:89108370-89108392 TACAAAGACACAGATACAGAGGG - Intronic
1131969759 15:97880035-97880057 TACAAAAATACTCTTTGATAGGG - Intergenic
1133634293 16:7651372-7651394 TACACCTACACCCATAGATAGGG - Intronic
1135237742 16:20774539-20774561 TGTAAAGATACACATAGATAGGG - Intronic
1137511239 16:49102590-49102612 TACAAAGACACCCCTACATGAGG + Intergenic
1137784808 16:51129594-51129616 GACAAAGACTCTAAAAGATATGG - Intergenic
1138951302 16:61916674-61916696 AACACAGATACTAATAGATATGG + Intronic
1140464734 16:75172228-75172250 TACAAAGACACACATATATAAGG - Exonic
1141258468 16:82427283-82427305 TACAAAGTCACTATTATATATGG + Intergenic
1142781554 17:2185116-2185138 CACAAATACAGACATAGATACGG + Intronic
1144381331 17:14701481-14701503 TGCAAATACACTCAGAAATAGGG - Intergenic
1149106092 17:52967283-52967305 ATCAAAGACACTTATAAATATGG - Intergenic
1149121713 17:53176030-53176052 TACATAGATAGGCATAGATAGGG - Intergenic
1150869332 17:68887987-68888009 TACACACACACACATATATATGG + Intronic
1151079959 17:71317669-71317691 TACACACACACACATATATATGG + Intergenic
1153064294 18:1028129-1028151 TACAAATACACTCAACAATATGG - Intergenic
1153215036 18:2811702-2811724 TTCAAAGACACAAATAGATTAGG + Intergenic
1153545565 18:6201649-6201671 TACAGAGAGACTCAAAGAGAAGG + Intronic
1155325102 18:24657121-24657143 TACAAAGACAGACATTAATAAGG + Intergenic
1155716775 18:28953378-28953400 TATAAAGATACCCAAAGATATGG - Intergenic
1155732818 18:29182341-29182363 TACACATACACACATGGATATGG - Intergenic
1156044971 18:32867847-32867869 TACAAACACACACACACATAAGG - Intergenic
1156930117 18:42631570-42631592 AACAAAGACAGACATAGGTAAGG + Intergenic
1157423065 18:47562093-47562115 TAGGAAGACACTCACAGAGAAGG - Intergenic
1157564704 18:48672243-48672265 TTCAAAGCCCCTCATAAATAGGG + Intronic
1158032383 18:52982070-52982092 TTCAAAGACACTGATTGCTAAGG + Intronic
1159288110 18:66378767-66378789 TACATATACACACATAGACACGG + Intergenic
1159792719 18:72803407-72803429 TACAAAGAAATTCATCAATACGG + Intronic
1160575473 18:79850783-79850805 TACAAAGAAACTCACAGAAAAGG - Intergenic
1163446826 19:17351849-17351871 GACAACGACACCTATAGATATGG - Exonic
1163676357 19:18657338-18657360 GACACAGAGACTCAGAGATAGGG - Intronic
1164530530 19:29044885-29044907 TAGAAACACCCTCATTGATATGG - Intergenic
1166660260 19:44642508-44642530 AACAGACACACTCAGAGATAAGG - Intergenic
1167238990 19:48332113-48332135 AACAAAGACAGTCATAGAAGAGG - Intergenic
1167317705 19:48775410-48775432 TACATAGACACACATATATTAGG + Intergenic
925608793 2:5685801-5685823 GACAAAGATACTGATAGAAAGGG + Intergenic
925667104 2:6270017-6270039 AAAAAAAAAACTCATAGATAAGG + Intergenic
927603728 2:24467180-24467202 TAGAAAGTCACTCTTAGAAAGGG - Intergenic
928695664 2:33847464-33847486 TACAAAGACACTGATAAAGCAGG - Intergenic
929879274 2:45822185-45822207 TACAAAGGCACACAGAGACAGGG + Intronic
930697244 2:54424503-54424525 TCTCAAGACACTCATAAATAAGG - Intergenic
933674864 2:85045913-85045935 TAAAAAGACACTCAAATGTAAGG - Intronic
934886343 2:98028804-98028826 TACCAAGACACTGATGGAAACGG - Intergenic
935951534 2:108334232-108334254 TACTAAGACCCTCATAAATAGGG - Intergenic
937281990 2:120724170-120724192 AACAAAGACAGTCATATATTTGG - Intergenic
937693255 2:124779910-124779932 CACAAAGAAACTCCTAGAAAGGG - Intronic
939648080 2:144726381-144726403 CACAAACACACACATATATATGG - Intergenic
939785640 2:146507988-146508010 TACACAGACACACAGAGATGAGG - Intergenic
939917719 2:148068015-148068037 TACAGAGAGACCCAAAGATATGG - Intronic
940995985 2:160150110-160150132 TACAAAGATACTCCTCGAGAAGG + Intronic
941258280 2:163262106-163262128 TACAAACTCACTCCTAGAGATGG + Intergenic
941749559 2:169120409-169120431 TATAAAAACACTCCTAGAGAGGG + Intergenic
942477212 2:176339942-176339964 TACAAAAACACAGATAGCTAGGG - Intergenic
942926630 2:181440748-181440770 TACAAATACAAACATAAATAAGG - Intergenic
943960691 2:194259182-194259204 TACAAATTCACACATAGATGAGG - Intergenic
944128568 2:196320874-196320896 TAAAAGGACACTCACAGCTAAGG + Intronic
944234280 2:197427557-197427579 TACCATGACATTCATAAATAAGG + Intronic
945013474 2:205489567-205489589 TACACACACACACATATATATGG + Intronic
945787871 2:214266138-214266160 TACAAAGACACTCATAGATAAGG - Intronic
947834455 2:233165235-233165257 TAGACACACACTCATAGATATGG - Intronic
947834465 2:233165440-233165462 CACACACACACTCATAGATACGG - Intronic
947834469 2:233165530-233165552 CACTCACACACTCATAGATATGG - Intronic
947834480 2:233165718-233165740 TACTCACACACTCATAGATATGG - Intronic
1168920140 20:1526106-1526128 TAGAAATAGACTCATACATATGG - Intergenic
1168980071 20:1996511-1996533 TACACAGAGACTCTTAGAGAGGG + Intergenic
1169866240 20:10203021-10203043 TTCTAAGACACTCATAGTTAGGG + Intergenic
1171365855 20:24624431-24624453 AACAAAGATTATCATAGATAAGG + Intronic
1172059775 20:32179268-32179290 TAAATAGACCCTCATATATATGG - Intergenic
1174638999 20:52026890-52026912 TACATATACACACATAGACATGG - Intergenic
1174831560 20:53817806-53817828 TCCAAAGACACACATAGAGCTGG - Intergenic
1174852799 20:54012077-54012099 TACCAAGACACTCAGTGATTCGG + Intronic
1175744351 20:61444533-61444555 CACAAAGATACACATACATACGG - Intronic
1175744353 20:61444795-61444817 CACAAAGATACACATACATACGG - Intronic
1177410893 21:20729253-20729275 AACAAAGACAGACATTGATATGG + Intergenic
1177696472 21:24579506-24579528 CAAGAAGACACTCATAAATATGG + Intergenic
1177780686 21:25619878-25619900 TACACATACACATATAGATATGG + Intergenic
1179118392 21:38518216-38518238 TACACACACACACATAGTTATGG - Intronic
1180076200 21:45464334-45464356 AAAAAAGACCCTCTTAGATAAGG + Intronic
1180882579 22:19216781-19216803 TACAAAAACACTTACAAATAGGG + Intronic
1182151880 22:28033372-28033394 TAGAAAGTCACTCAGAGAAATGG - Intronic
1182511669 22:30824515-30824537 TACAAACACATACATAGCTAGGG + Intronic
1184840481 22:47049618-47049640 TACAAAAAAACTCGTAGAAAAGG - Intronic
1184890425 22:47375748-47375770 TCCTAAGACACTCACAGATGGGG + Intergenic
949843255 3:8343135-8343157 GTCAAACACACTTATAGATATGG - Intergenic
950236746 3:11328433-11328455 TACAAACAGGTTCATAGATATGG - Intronic
950260948 3:11543216-11543238 TACAAAGACAGTCATGGCCAAGG - Intronic
955669923 3:61392740-61392762 CACAAAGATACTCCTAGAGAAGG + Intergenic
956540064 3:70326779-70326801 TAGCAAGACAGTCATGGATAAGG + Intergenic
957396691 3:79648394-79648416 AACACAGACACACATATATAAGG + Intronic
957667141 3:83247513-83247535 TGCAAAGACACACATACAAAGGG - Intergenic
957688961 3:83542580-83542602 GCCAAAAACACACATAGATAGGG - Intergenic
957714780 3:83912807-83912829 TACAAGGAAATTCATAGAAAGGG - Intergenic
957975948 3:87445211-87445233 TATAAAGACACACTTAGAAAGGG - Intergenic
960007648 3:112796976-112796998 TACAAAAACAATTACAGATAGGG + Intronic
962686514 3:137853055-137853077 GACACACACACTCATACATACGG + Intergenic
963447448 3:145431432-145431454 TACAAAGACACAGATAGCTAGGG + Intergenic
963858970 3:150287130-150287152 TAGAAAGACAGGCATAGACAAGG + Intergenic
965458433 3:168931699-168931721 TAAAAAAAAACTCAAAGATAGGG - Intergenic
966031175 3:175349623-175349645 TACAAACACAGTTAAAGATAAGG - Intronic
967357776 3:188592285-188592307 TACAAAGCCACACATAAAGAGGG + Intronic
970940783 4:21630686-21630708 AACAAACACACTAACAGATATGG + Intronic
971640131 4:29120406-29120428 TACACACACACACATATATATGG - Intergenic
971795621 4:31223830-31223852 CAAAAAAAGACTCATAGATATGG - Intergenic
973905244 4:55522698-55522720 TACAAATACATACATATATATGG - Intronic
974108050 4:57493505-57493527 TACATATACACTCATATATGTGG + Intergenic
974582653 4:63825120-63825142 GAGAAAAACACTCATAGATCGGG - Intergenic
975968928 4:80010398-80010420 TACATGGACAGTCACAGATAGGG - Intronic
976094214 4:81490129-81490151 TACGAAGAAAGTCATAGACATGG - Intronic
977452944 4:97222748-97222770 TAAAAAGACACTCATCAATTTGG - Intronic
977611400 4:99036418-99036440 TAGAAAAACAATCATAGACAAGG + Intronic
978738324 4:112109459-112109481 TCCTAAGACTCTCATATATAGGG + Intergenic
979110578 4:116749978-116750000 TACAATGACTTTCATTGATATGG - Intergenic
980381397 4:132023604-132023626 TAAAAAGACACTCAGAGATAGGG - Intergenic
980650184 4:135703526-135703548 TACAAAGACATACACAGAAAAGG + Intergenic
980742837 4:136974241-136974263 TACAAAGATACTCAAAAATGTGG - Intergenic
981721408 4:147805322-147805344 TACAAAGACACACAGACAAATGG - Intronic
983629921 4:169839777-169839799 AACAAAATCACTTATAGATAGGG - Intergenic
985198050 4:187453452-187453474 TACAAAGAAACTCACAAATGTGG + Intergenic
987434652 5:17879921-17879943 AACAAAGACACTAAAATATAAGG - Intergenic
988155943 5:27448763-27448785 GACAAAGAAACTCTGAGATATGG - Intergenic
989427307 5:41311525-41311547 TACAGAAACACACACAGATATGG - Exonic
990352191 5:54929943-54929965 TGGAAAGCCACTCATAGTTAAGG + Intergenic
990489942 5:56294832-56294854 CACAAAGACCCTCATGGAGATGG - Intergenic
990522362 5:56592381-56592403 TTCACAGACACTCATATCTAGGG + Intronic
990635163 5:57717700-57717722 TAAAAAGACACCAATAGGTAGGG - Intergenic
992537258 5:77720021-77720043 TACAAAGGCAGTTAGAGATATGG - Intronic
996244213 5:121240520-121240542 TACAAACACATACATAGGTATGG + Intergenic
996547773 5:124698559-124698581 TACAAAGATATTCACAGAAATGG + Intronic
996691246 5:126342648-126342670 TAAAAAGAGTCTCATTGATAAGG - Intergenic
999724001 5:154419726-154419748 TACTAAGCCACTCATTGTTATGG + Exonic
999960210 5:156746923-156746945 GATAAAGAAACTCATAGATTGGG + Intronic
1000750139 5:165085200-165085222 CACACAGACACACAGAGATAGGG + Intergenic
1000787055 5:165558442-165558464 TACTAAGACACACATAAATATGG + Intergenic
1002848937 6:974149-974171 TACACACACACACATATATATGG - Intergenic
1003002964 6:2353542-2353564 TACACACACACACACAGATAAGG + Intergenic
1003337004 6:5183140-5183162 TAGAAAGACATTCAGAGATGAGG + Intronic
1003415460 6:5903599-5903621 TACACATATACTCATTGATATGG - Intergenic
1005248887 6:23921191-23921213 TACATATACACACATACATATGG - Intergenic
1008277034 6:49553712-49553734 TACAGAGGCACACAGAGATAAGG - Intronic
1008682373 6:53886510-53886532 TTCAAAGACAATCATGAATAGGG + Intronic
1008949571 6:57140868-57140890 TACAAAGACACATAGAAATAAGG - Intronic
1009190186 6:60620987-60621009 CACAAAGACACTCCTTGAAAAGG - Intergenic
1010357620 6:74952522-74952544 TCCAAAGACACTCAAAGTAAAGG + Intergenic
1011248306 6:85343214-85343236 TACACAGACACTCATAATTACGG + Intergenic
1011267771 6:85542272-85542294 TACAAAGCCACTCAGGCATATGG + Intronic
1012402491 6:98853968-98853990 TATAAAGACATTCATAGAAATGG - Intergenic
1012561737 6:100589469-100589491 GACTAAGATACCCATAGATAAGG - Intronic
1013491584 6:110651622-110651644 TACAACTACACTCATAGGTGAGG + Intronic
1013618357 6:111866093-111866115 TACACATACACACATACATATGG + Intronic
1015671502 6:135695613-135695635 TACAAAAACTCTCATTGAAATGG + Intergenic
1017612207 6:156200050-156200072 AACAAAGACATTTATATATAGGG - Intergenic
1018965367 6:168482585-168482607 GACAAAGACACTCTAAGAAAAGG + Intronic
1019901558 7:4025171-4025193 CACAAATACACTCGTGGATAGGG - Intronic
1021123548 7:16824712-16824734 TACTCAGACACTCAGAGATATGG + Intronic
1021362826 7:19737593-19737615 TACCAAGACACTCAAAGACATGG + Intronic
1022783107 7:33606313-33606335 TACAAAAACAATTATAGAGATGG + Intergenic
1024866767 7:53912102-53912124 TACACAGACACACATGGAGAAGG - Intergenic
1027510873 7:79078074-79078096 TACAATGGAACTTATAGATAAGG - Intronic
1027802395 7:82772073-82772095 TACAAAGACAAAGATAAATAAGG - Intronic
1027970551 7:85075113-85075135 CACAAAGACATTCGTACATAGGG + Intronic
1028469743 7:91192321-91192343 CAGAAAAACACTCATGGATAAGG + Intronic
1031289099 7:119909326-119909348 TACACACACACACATTGATATGG - Intergenic
1034195390 7:149242568-149242590 TACCAATACACTCTTAGAAAAGG + Intronic
1034408564 7:150923508-150923530 TAAAAAGAAACTCATTAATAGGG + Intergenic
1035533872 8:376429-376451 TACAAACACAGTCATGGAGAAGG - Intergenic
1036059557 8:5300738-5300760 TACACACACACACATATATATGG + Intergenic
1038280836 8:26162881-26162903 TCCTAAGAGACTCATAGATGGGG - Intergenic
1039246653 8:35615915-35615937 TACAAAGATTCTCATATACATGG + Intronic
1039591189 8:38750527-38750549 TACAATGTCACTTGTAGATAAGG - Intronic
1041206399 8:55502657-55502679 TAAAAAGACAGTCATAGAATGGG - Intronic
1041562913 8:59240807-59240829 AACAAAGACACTCATTCATAAGG + Intergenic
1041756186 8:61315561-61315583 TACCCAGATACTCACAGATAGGG + Intronic
1042231820 8:66564224-66564246 TACAAAGAAACACATTGAAAAGG - Exonic
1042313560 8:67401774-67401796 TACAAACCCACTCCAAGATAAGG + Intergenic
1043041185 8:75263902-75263924 TACACACACACACATATATATGG - Intergenic
1043117733 8:76280517-76280539 TATAAACACACTCATATATAGGG - Intergenic
1043757285 8:84019362-84019384 TACAAAGATACTCCTCGAGAAGG - Intergenic
1043769335 8:84178594-84178616 TACAAAGTCATCCCTAGATATGG - Intergenic
1044851157 8:96429997-96430019 TATAAAGACACACAAAGAAATGG - Intergenic
1044908762 8:97034432-97034454 TACCAAGACAATCAAAGACATGG - Intronic
1045882289 8:107055501-107055523 TACAAAGACAATCTTATATGTGG + Intergenic
1047811182 8:128410794-128410816 TACAAAGGCTCTGATAGAGAGGG + Intergenic
1048713029 8:137233295-137233317 CAGAAAGACAGTTATAGATATGG + Intergenic
1052546516 9:29887783-29887805 TAGAAGGCCACTTATAGATAAGG + Intergenic
1054703651 9:68439501-68439523 TATATATACACTCATATATATGG - Intronic
1056923137 9:90809751-90809773 GACAGAGACACTCACAGCTAGGG - Intronic
1057111393 9:92475297-92475319 TGCAAAGACACTTTTAAATATGG + Intronic
1057432853 9:95010745-95010767 TACAAAGCCACTCACAGTTAGGG - Intronic
1057996776 9:99826079-99826101 TACAAATACACCAATAGATTAGG + Intronic
1058368610 9:104237826-104237848 TACAAACACACACATATAGATGG + Intergenic
1060108972 9:120893161-120893183 AACAATGACATTCATAGATGAGG - Intronic
1185936692 X:4264433-4264455 TACAAATACACTCTGAAATATGG - Intergenic
1186025657 X:5307994-5308016 GAGAAAGTCACTCATAGCTATGG - Intergenic
1186094813 X:6088694-6088716 TACACAGACAGTAGTAGATATGG - Intronic
1186126833 X:6423475-6423497 TACAAAAGCAGTCATAGATGAGG - Intergenic
1186388613 X:9135436-9135458 TAAAAATACACACATAGATGTGG - Intronic
1187592360 X:20732308-20732330 TTCAAAGACATCCATAGGTAGGG - Intergenic
1187732077 X:22265369-22265391 GACAAAGACAGGCATAGAAAGGG - Intergenic
1188164177 X:26841404-26841426 CACACAGACACACATATATAAGG - Intergenic
1188366777 X:29325661-29325683 GACTAACACACTCACAGATAAGG - Intronic
1188666227 X:32824521-32824543 TTTCAAGACTCTCATAGATACGG - Intronic
1188673870 X:32914372-32914394 TACTAAGCGACTCATAGAAAAGG + Intronic
1191208267 X:57856641-57856663 CACAAAGACACTCCTCGAGAAGG + Intergenic
1193044298 X:77034977-77034999 TAGAAAGACACTAATAGGAAGGG + Intergenic
1193525732 X:82586098-82586120 AACAAAGACACCCATTCATATGG + Intergenic
1194104884 X:89756844-89756866 AACAAAGGCAGTCATAGTTATGG - Intergenic
1194261291 X:91699368-91699390 TACAAACACACACATGGATGTGG - Intergenic
1195448832 X:104986121-104986143 TACAGAGACATTCAGAGAAATGG - Intronic
1199414283 X:147562027-147562049 TACACACACACACATATATAAGG + Intergenic
1200456849 Y:3404633-3404655 AACAAAGGCAGTCATAGTTATGG - Intergenic
1200579942 Y:4938169-4938191 TACAAACACACACATGGATGTGG - Intergenic
1200798883 Y:7367586-7367608 CACTAAGACACTCATAGAGTGGG - Intergenic