ID: 945788984

View in Genome Browser
Species Human (GRCh38)
Location 2:214279469-214279491
Sequence TCTGAGCCACAACTCGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 100}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945788983_945788984 -6 Left 945788983 2:214279452-214279474 CCTGCTTTCAGAGAATTTCTGAG 0: 1
1: 0
2: 1
3: 17
4: 243
Right 945788984 2:214279469-214279491 TCTGAGCCACAACTCGAGAAAGG 0: 1
1: 0
2: 1
3: 4
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945788984 Original CRISPR TCTGAGCCACAACTCGAGAA AGG Intronic
907898020 1:58710936-58710958 TCTGAGCCAGAGTTCCAGAATGG - Intergenic
910570441 1:88695507-88695529 TTTGAGCCACAACTGGGGAATGG - Intronic
910989369 1:93039127-93039149 TTTGAGTCACAACTGGAGGATGG + Intergenic
915494519 1:156272218-156272240 TCTCAGCCACAGCTAGAGGAAGG + Intronic
916155250 1:161839086-161839108 ACTAACCCACAACTCAAGAATGG - Intronic
918041393 1:180916221-180916243 CCTGAGCCACAGCTGGATAACGG + Exonic
1062822919 10:548280-548302 TCTGGGCGACAACTCCAGAGAGG - Intronic
1063681277 10:8189958-8189980 TCCAAGCCACAAATGGAGAATGG + Intergenic
1076229250 10:128806560-128806582 TGTGAGCCCCAACTCGGGAGTGG - Intergenic
1078357894 11:10646491-10646513 TCTGAGCCAAAACAGGAGGAAGG + Intronic
1078408881 11:11095210-11095232 TCTTATTCACAACTTGAGAAGGG + Intergenic
1085318964 11:75562764-75562786 CCTGAGCCTCAACCCCAGAACGG - Exonic
1085687035 11:78632921-78632943 TCTGAGCCACAGAAGGAGAAGGG + Intergenic
1090610686 11:128467813-128467835 TCTGAGCCACAACAACAGAGGGG + Intronic
1093661560 12:21763484-21763506 TCTGAGCCACAGCTTGACATAGG + Intergenic
1099055530 12:77835112-77835134 TGTGAGCCACAAATCGATGATGG - Intronic
1099259487 12:80360120-80360142 AGTGAGCCACAGCTAGAGAAAGG - Intronic
1099315261 12:81076343-81076365 TCTGTGCCACAACTTGAACAAGG - Intronic
1099462647 12:82942648-82942670 TCTTGGCCAAAACTCAAGAATGG - Intronic
1100792090 12:98141964-98141986 TCACAGCCACAATTCTAGAAAGG + Intergenic
1101322772 12:103687773-103687795 TCTGAGCCACTACTCACCAACGG + Intronic
1102020083 12:109676156-109676178 TCTGAGCCACCTCTCAAAAATGG + Intergenic
1102863071 12:116353218-116353240 TCTGAGCCACAGGTGGACAAAGG - Intergenic
1105218684 13:18306016-18306038 TCTGAGGCATTACTCTAGAATGG + Intergenic
1106442226 13:29786076-29786098 TCTGTCCCACAACTCTAGAATGG - Intronic
1106653876 13:31721304-31721326 TCTGAGCCAGAACGGGAGAGAGG - Intergenic
1108082438 13:46750657-46750679 TCTGAGCCCCCAATGGAGAAGGG - Intronic
1111531356 13:89541523-89541545 TCTGCAACACAACTCAAGAAAGG - Intergenic
1116325723 14:43532714-43532736 TCTGAGCCCCTACTCGACAGGGG - Intergenic
1118917508 14:70120132-70120154 TCTAAGCCACAACTTGGGGATGG - Intronic
1121578546 14:95008857-95008879 TCAGAGGCACAAAACGAGAAGGG + Intergenic
1130155118 15:81343845-81343867 TCCCAGCCACAACATGAGAAAGG + Intronic
1132037938 15:98502085-98502107 TCTGAGCCTCACCTGGAAAATGG - Intronic
1136907970 16:34119761-34119783 TCTAGGCCACAGCTCAAGAAGGG - Intergenic
1138551471 16:57751197-57751219 TCAGAGCCACGACTGGAGGAAGG - Intronic
1140316918 16:73907392-73907414 TCTGTGCCACAATTTGAGGAGGG - Intergenic
1142887011 17:2919232-2919254 TCTGAGCCAGACCTGGAGGAAGG + Intronic
1144707734 17:17380594-17380616 TCTGAGCCTCAACTGCAAAATGG + Intergenic
1144904303 17:18627562-18627584 TTTGAGCCACCACTCCAAAATGG + Intergenic
1147398816 17:40166415-40166437 TCTGAGCAACAGCTGGACAAGGG - Intronic
1150759333 17:67946052-67946074 TCTGAGCCACAACCTGTGACTGG - Exonic
1152751494 17:82064571-82064593 CCTGAGCCACTCCTAGAGAATGG + Intronic
1153369870 18:4303240-4303262 TCTGAGCCAAAAGAAGAGAAAGG + Intronic
1156825679 18:41427660-41427682 TCTGAGCCCCACCTCCAGAGGGG + Intergenic
1160292308 18:77606281-77606303 TCAGAGTCACAACTCCACAAGGG + Intergenic
1162718540 19:12648341-12648363 TCGGAGCCACTAATGGAGAACGG - Exonic
1164412091 19:28014559-28014581 TCTGAGCCTCACCTCTAGAGTGG - Intergenic
1166107278 19:40603677-40603699 TCTGAGCCACAACTGTAGAGAGG - Intronic
925998539 2:9311675-9311697 TCTCGGCCAGAACTCGAGGATGG + Intronic
927849260 2:26488730-26488752 TCTGAGCCTCAACTGTAAAAGGG + Intronic
932288372 2:70554742-70554764 TCAGAGCCACAAATCCTGAAAGG - Intergenic
934295630 2:91740614-91740636 TCTGAGGCATTACTCTAGAATGG - Intergenic
936245357 2:110821460-110821482 TCTGAGCCACACACAGAGAAGGG - Intronic
943918946 2:193677372-193677394 TATAAGCAACAACTCAAGAAGGG - Intergenic
945788984 2:214279469-214279491 TCTGAGCCACAACTCGAGAAAGG + Intronic
1181038889 22:20182659-20182681 TCAGAGCCACAGGTTGAGAAGGG - Intergenic
949779842 3:7673969-7673991 TATGAGCCATAACTTCAGAAAGG + Intronic
954387357 3:50251156-50251178 TCTCAGCCACATTTTGAGAATGG + Intronic
954917404 3:54160552-54160574 TCAGAGCCCCAGCTCTAGAATGG + Intronic
955496480 3:59538540-59538562 TGTGGGCCATAATTCGAGAATGG + Intergenic
957279576 3:78133094-78133116 TCTGAGCTACATCTTGAAAAGGG + Intergenic
960167547 3:114420668-114420690 TCTGGGGCACAACTAGGGAAAGG + Intronic
960201500 3:114842343-114842365 CCTGAGGCAAAACTCGAGAGTGG + Intronic
961477020 3:127153327-127153349 TCAGAGTCACAACTCCAGCAAGG - Intergenic
961632569 3:128312133-128312155 TCTGAGACAGAACTTGAGAAAGG + Intronic
961835222 3:129652437-129652459 TTTGTGCCACAACTCAAAAAGGG - Intronic
968506289 4:972827-972849 TCTGGGCCACAGCATGAGAAGGG + Intronic
973089444 4:46114111-46114133 TCAGAGCTACAACCCTAGAAAGG - Intronic
976572990 4:86635009-86635031 TCAGAGACAGAACTGGAGAATGG - Intronic
977060077 4:92247406-92247428 TCTGAGCAACAACTCAAGAAAGG - Intergenic
977266706 4:94864241-94864263 TCTGTGCCAGAACCCCAGAATGG + Intronic
984878698 4:184391599-184391621 TCTGAGGCTCAACTGGGGAAGGG - Intronic
985021434 4:185695241-185695263 TCTTAGCCAAAACTGGGGAAAGG - Intronic
986071734 5:4291847-4291869 TCTGAGCCACAATGCAAGCAGGG + Intergenic
987181698 5:15374641-15374663 TCTGAGACACACCACGGGAAGGG - Intergenic
990533181 5:56694233-56694255 TCAGAGCCACTACTTGAAAAGGG - Intergenic
992066491 5:73114495-73114517 TCTGACCCAGAAATCCAGAAAGG - Intergenic
994287447 5:97986549-97986571 TCTGAGCCTCATCTAGAAAATGG - Intergenic
994449312 5:99921003-99921025 TCTGATCCACAGCTTGTGAAAGG + Intergenic
1002802951 6:543727-543749 ACTGAGCCACAGCTTGGGAATGG - Intronic
1003613221 6:7631584-7631606 TCTGAGACTTAACTGGAGAAAGG - Intergenic
1004875806 6:19952595-19952617 TCTGTACCTCAACACGAGAAAGG - Intergenic
1005453598 6:25997990-25998012 TTTGAGTCACCACTGGAGAAAGG + Intergenic
1014504470 6:122237288-122237310 TCAGAGGAACAACTCGACAATGG - Intergenic
1015081332 6:129228789-129228811 TTAGAGCCACAGCTGGAGAAAGG - Intronic
1017255778 6:152331541-152331563 TCTGAGCCATATCTGGAGGAGGG + Exonic
1020676750 7:11192809-11192831 TCTGAGGCCCATCTGGAGAATGG + Intergenic
1023219285 7:37902050-37902072 ACTGAGCCAGTACTAGAGAATGG - Intronic
1024637215 7:51300842-51300864 TCTGAGCCAGAAGTGGGGAAAGG - Intronic
1025866265 7:65384451-65384473 CCTGAGCAACAGCTCTAGAAAGG - Intronic
1028406950 7:90485666-90485688 TCTGAGCCCCAACCAGAGAGAGG + Intronic
1036557897 8:9876087-9876109 TCTGAGCCTCCACTCGAAGATGG - Intergenic
1039546932 8:38417208-38417230 TCTCAGCCACAGCTAGGGAAGGG - Intronic
1042711600 8:71723391-71723413 TCAGAGCCACAAATTGGGAAAGG - Intergenic
1050947073 9:11537885-11537907 TCTGACCCACAATTCAAAAAGGG + Intergenic
1051410655 9:16786666-16786688 TCTGAACCCCAACTGCAGAAAGG + Intronic
1051906229 9:22097621-22097643 CCTGAGCCACAACCCTAAAAGGG + Intergenic
1052036589 9:23688339-23688361 TATGAGCCAGAATTCTAGAAAGG + Intergenic
1058201192 9:102043004-102043026 TCTGAGCCATAACTACATAATGG + Intergenic
1059430797 9:114249076-114249098 TCTGAGCCTCATCTGCAGAATGG - Intronic
1062255360 9:135618245-135618267 TCTGAGCCACATCTGTAGAGTGG - Intergenic
1186398903 X:9238495-9238517 ACTGGGCCACAACTAGAGGAGGG + Intergenic
1187811075 X:23177650-23177672 TCTGAGGCTAAACTCGATAAAGG - Intergenic
1191602991 X:63031044-63031066 TCTGATCTACAACTCTAGCAAGG + Intergenic
1195428123 X:104758447-104758469 TCTGAGTCACCACCAGAGAAGGG - Intronic
1197839191 X:130727394-130727416 TCACACCCACAACTCAAGAATGG - Intronic