ID: 945793247

View in Genome Browser
Species Human (GRCh38)
Location 2:214331264-214331286
Sequence TATAGCAAACATAGGTAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 121}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945793243_945793247 5 Left 945793243 2:214331236-214331258 CCCAAACATACTTTTTGCTGTTT 0: 1
1: 1
2: 6
3: 46
4: 561
Right 945793247 2:214331264-214331286 TATAGCAAACATAGGTAGGTAGG 0: 1
1: 0
2: 0
3: 12
4: 121
945793244_945793247 4 Left 945793244 2:214331237-214331259 CCAAACATACTTTTTGCTGTTTG 0: 1
1: 0
2: 1
3: 25
4: 364
Right 945793247 2:214331264-214331286 TATAGCAAACATAGGTAGGTAGG 0: 1
1: 0
2: 0
3: 12
4: 121
945793242_945793247 12 Left 945793242 2:214331229-214331251 CCTGGGTCCCAAACATACTTTTT 0: 1
1: 0
2: 3
3: 14
4: 230
Right 945793247 2:214331264-214331286 TATAGCAAACATAGGTAGGTAGG 0: 1
1: 0
2: 0
3: 12
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945793247 Original CRISPR TATAGCAAACATAGGTAGGT AGG Intronic
901378724 1:8858372-8858394 GATGGCAAACACAGGTAGATAGG - Intergenic
905458891 1:38107906-38107928 TGTAGCCAACATATGGAGGTGGG + Intergenic
906841926 1:49148405-49148427 TATACCCACAATAGGTAGGTAGG - Intronic
908004822 1:59717133-59717155 TATAGCAATCAAAGGTTGATGGG + Intronic
910263057 1:85310087-85310109 AATAGCAAACATTGGTAAGGAGG - Intergenic
911546191 1:99220049-99220071 AATAGCAAAAATAGGTAAATGGG - Intergenic
913308214 1:117455033-117455055 GATAGTAAACTTAGGTTGGTAGG + Intronic
922097053 1:222451445-222451467 CATAGCACACATAGGGAGTTTGG + Intergenic
1062847819 10:721434-721456 AAAAGCAAACATAGATAAGTGGG + Intergenic
1064846987 10:19666666-19666688 TATAGAAAAGATAGGTAGTTGGG - Intronic
1065408538 10:25395515-25395537 CAAAGCAAAGGTAGGTAGGTGGG - Intronic
1069234759 10:66056956-66056978 TTTGGCAAATATAGGTAAGTTGG - Intronic
1069242248 10:66157399-66157421 TCTATCATAGATAGGTAGGTAGG + Intronic
1070205458 10:74255097-74255119 TATAGAAAACAATAGTAGGTTGG + Intronic
1071856749 10:89633543-89633565 TAAATCAAACATAGGTAGTTGGG + Intronic
1073347171 10:102792462-102792484 GATAGGAAAGTTAGGTAGGTGGG - Intronic
1083973444 11:66097880-66097902 TATTTTAAAAATAGGTAGGTTGG + Intronic
1084342673 11:68517352-68517374 TATAGCAAACAAAGCTGGGAAGG - Intronic
1089097910 11:115934924-115934946 GAGAGAAAACACAGGTAGGTGGG + Intergenic
1090336827 11:125974327-125974349 TGCAGCAAACATTTGTAGGTAGG + Intronic
1090988367 11:131793882-131793904 TATACCAAAGAAAGGTAGATTGG + Intronic
1099542638 12:83932213-83932235 TCTAGGAAACATATGTAGTTTGG + Intergenic
1099913753 12:88865710-88865732 AATTGCAATCCTAGGTAGGTTGG - Intergenic
1100881523 12:99023123-99023145 TATAGCAAACATTGGTATATTGG - Intronic
1107461957 13:40612805-40612827 TATAACTATCATAGGTATGTAGG + Intronic
1108243006 13:48486554-48486576 TATAGCTAGCACAGGAAGGTGGG + Intergenic
1111526693 13:89480478-89480500 AATAGAAAAGATAGGAAGGTTGG + Intergenic
1111554203 13:89858644-89858666 TATAGCAACCATATGTAAGCAGG + Intergenic
1112606402 13:100910759-100910781 CATAGTAAACAAAGGTGGGTGGG + Intergenic
1112610281 13:100948636-100948658 AACAGCAAACAGAGGTAGGTGGG - Intergenic
1112696563 13:101955544-101955566 TATAAAATGCATAGGTAGGTAGG + Intronic
1113124802 13:106965533-106965555 TACAGCAAGCATATGTAAGTAGG - Intergenic
1115115564 14:29877499-29877521 AAAAGCAAACATTGATAGGTGGG - Intronic
1115773134 14:36687247-36687269 TATAGAAAACAAAGGTGGGCCGG - Intronic
1117934182 14:60883090-60883112 TAAAGCAAAAATAGGTAAGTAGG - Intronic
1119655239 14:76412780-76412802 TATTGCAAAGAAAGGTGGGTGGG + Intronic
1119792573 14:77365856-77365878 TATGGCAGCCATAGGTAGGATGG + Intronic
1120624588 14:86809327-86809349 TATACAATAGATAGGTAGGTAGG - Intergenic
1124486581 15:30122594-30122616 TATACCAAATATAGGCAGCTAGG - Intergenic
1125165599 15:36701068-36701090 TCTAACTAAAATAGGTAGGTAGG + Intronic
1127504606 15:59586066-59586088 AATAGCAAATATAGGAAGCTAGG + Intergenic
1130016494 15:80190770-80190792 GAAAGCAAACATATCTAGGTAGG - Intergenic
1133682350 16:8131592-8131614 TATAGAGAAAATAGGTAGGTGGG - Intergenic
1134888314 16:17814986-17815008 TAGTGGATACATAGGTAGGTAGG + Intergenic
1136181615 16:28556641-28556663 TAAAAAAAACATAAGTAGGTTGG - Intronic
1137345752 16:47657383-47657405 AACAGAAAACAAAGGTAGGTTGG + Intronic
1138430915 16:56968484-56968506 TAGATCAAAAATAGGTTGGTGGG - Intronic
1139962290 16:70724944-70724966 TCTAGCAAACAGACTTAGGTTGG + Intronic
1141247317 16:82320430-82320452 AAAAGCAAAAATAGGTAAGTGGG - Intergenic
1145839474 17:27982431-27982453 TATAGCACACACAGGCGGGTAGG + Intergenic
1146362988 17:32194317-32194339 TTTAGCACACATGGGGAGGTGGG + Intronic
1147511591 17:41073957-41073979 TAAAGGAAACACAGGTAGCTGGG - Intergenic
1147756669 17:42773151-42773173 TAGAGGAAACAAAGGTAGGCTGG + Intergenic
1148126498 17:45240084-45240106 TAAAGCAATCATAGATAGCTGGG - Intronic
1151266508 17:72960373-72960395 TCTTGTATACATAGGTAGGTAGG + Intronic
1152434820 17:80269801-80269823 TATAGAATATGTAGGTAGGTAGG - Intronic
1153452951 18:5249816-5249838 CATAGAAAACATTTGTAGGTAGG - Intergenic
1156022527 18:32616395-32616417 TATAGGAGTCATAGGTGGGTGGG + Intergenic
1156150524 18:34235927-34235949 AATAGAAAAAATAGGTAAGTTGG + Intergenic
1159277907 18:66244959-66244981 AATAGGATAGATAGGTAGGTAGG + Intergenic
1163099901 19:15088844-15088866 GATAGGATAGATAGGTAGGTAGG + Intergenic
1165769451 19:38370307-38370329 TATAACAAGCATAGGTATGGAGG - Intronic
1167682410 19:50932108-50932130 GAAAGCAAACATAGGTACATAGG - Intergenic
925560552 2:5188794-5188816 TAAAGCAAACATAGTTATATGGG + Intergenic
938628981 2:133144332-133144354 TATTACAAAAATAGGTAGGGAGG + Intronic
939356446 2:141109217-141109239 TTTTGCAAACATAGCTTGGTGGG - Intronic
942938567 2:181589092-181589114 AAAAGCAAAAATAGGTACGTTGG - Intronic
943290476 2:186064780-186064802 TATAGGAAACATAGCTAGGGAGG - Intergenic
945271154 2:207941601-207941623 AAGAGCAAAAATAGATAGGTAGG + Intronic
945793247 2:214331264-214331286 TATAGCAAACATAGGTAGGTAGG + Intronic
947427293 2:229995326-229995348 TACATCAAACATAGTTAGATAGG + Intronic
1168989214 20:2079893-2079915 TATAGCAAACAGAGGCAGGATGG + Intergenic
1174893293 20:54421127-54421149 TGTAGCAAAAATACGTAGCTGGG + Intergenic
1182218384 22:28738546-28738568 GATAGCAAGCATGGGTGGGTGGG - Intronic
949274929 3:2268654-2268676 TAGATGATACATAGGTAGGTAGG - Intronic
949618190 3:5779534-5779556 TTTAATAAACATAGATAGGTAGG - Intergenic
951816114 3:26756915-26756937 TGTAGTAAACATATGGAGGTTGG + Intergenic
952582349 3:34849336-34849358 TAAAGCAAACATGGTTAAGTGGG + Intergenic
952713799 3:36457877-36457899 AATAGCAAATAGAGTTAGGTTGG - Intronic
956159251 3:66331792-66331814 TATAGCAAAGACAAGTTGGTGGG - Intronic
957411279 3:79844119-79844141 TATAGACCAGATAGGTAGGTAGG - Intergenic
958716475 3:97788899-97788921 TACAGCAGAGAGAGGTAGGTGGG - Intronic
959461676 3:106633756-106633778 TATAGATAACATAGATAGATAGG - Intergenic
959856674 3:111166903-111166925 TTTAATAAAGATAGGTAGGTAGG + Intronic
960254393 3:115496305-115496327 TATAGTAGGCCTAGGTAGGTAGG - Intergenic
962030451 3:131594678-131594700 AAAAGCAAAAATAGATAGGTAGG + Intronic
963376499 3:144472650-144472672 TAAATCAAACATAGGTACATAGG - Intergenic
965579716 3:170254315-170254337 CAAAGCAAAAATAGGTAAGTGGG - Intronic
970761397 4:19493259-19493281 TAGACCAATTATAGGTAGGTAGG - Intergenic
972836773 4:42880482-42880504 CAGACCAAAAATAGGTAGGTAGG + Intergenic
974368499 4:60984462-60984484 TGAAGCAAACAAAAGTAGGTGGG + Intergenic
974793757 4:66722277-66722299 AGTTGCAAAGATAGGTAGGTAGG + Intergenic
975502629 4:75103838-75103860 TAACGCAAACCTGGGTAGGTGGG - Intergenic
976936807 4:90646198-90646220 TATAGCAAAAATAGGAATTTTGG + Intronic
977008025 4:91596737-91596759 TGGAGTAGACATAGGTAGGTTGG - Intronic
977018053 4:91719032-91719054 TAAAGAAAAAATAGGTATGTTGG + Intergenic
980259495 4:130429917-130429939 TATAGCAAAAATACGGAGGTAGG - Intergenic
981447257 4:144854383-144854405 TATAGGAACATTAGGTAGGTAGG + Intergenic
983967498 4:173830868-173830890 TATAGAAAAGATAGAAAGGTAGG + Intergenic
986042719 5:4009188-4009210 TAGATGATACATAGGTAGGTAGG + Intergenic
986118626 5:4806739-4806761 AGTTGGAAACATAGGTAGGTAGG - Intergenic
990147654 5:52780885-52780907 TCCTTCAAACATAGGTAGGTTGG + Intergenic
991945040 5:71891483-71891505 TTTAGCAAATATAGGAAAGTGGG - Intergenic
992342093 5:75834795-75834817 TATAGCAAAAATTCCTAGGTGGG - Intergenic
995163241 5:109006665-109006687 TATAACAAAAATAGGAAGGGTGG + Intronic
996502159 5:124229639-124229661 TATAGCAAACATGGGTATTCCGG - Intergenic
1001656281 5:173353048-173353070 TTTAGCAAACATTGTTGGGTAGG + Intergenic
1004090051 6:12491910-12491932 AATAGCAAACATAATTAGGGAGG + Intergenic
1004673221 6:17816838-17816860 TATAGTAAACATACTTAGGGTGG + Intronic
1009275742 6:61676889-61676911 TCTTGCAGACATATGTAGGTAGG + Intergenic
1009772176 6:68157975-68157997 TATAGTAAAAATAGGCAGGTAGG + Intergenic
1010856093 6:80841990-80842012 TATAGTCAACAAAGGTAGTTTGG + Intergenic
1014082382 6:117302698-117302720 TATAGGAAACAAAGGAAGTTTGG + Intronic
1016420620 6:143878861-143878883 TACAGCAAACACAGATAGGTAGG - Intronic
1022038856 7:26560174-26560196 TACAGAAAACAGAGGTAGGATGG - Intergenic
1023267110 7:38418248-38418270 TATAGCTATCATAGGTAAGTGGG - Intronic
1027341272 7:77210739-77210761 TACAGGAAACATGGGTAGGGAGG + Intronic
1030853486 7:114520634-114520656 AAATACAAACATAGGTAGGTAGG + Intronic
1030880357 7:114870317-114870339 TCTAGCAAATAAAGGTAGCTGGG + Intergenic
1032103138 7:128999974-128999996 TCTAGCAAACCTCGGTAAGTAGG + Intronic
1032931872 7:136681633-136681655 CATAGGAAAAATAGGTAAGTAGG + Intergenic
1033956533 7:146856211-146856233 TATAGAGATGATAGGTAGGTAGG + Intronic
1042025392 8:64417314-64417336 CACAGCAAACATAGGTAGCATGG + Intergenic
1043244292 8:77978368-77978390 TATACCAATCAAATGTAGGTTGG + Intergenic
1043470452 8:80557086-80557108 TAAAGAAAAAATAGGTAGTTTGG - Intergenic
1045442769 8:102230675-102230697 TATAACAAAGATGGGTAAGTGGG + Intronic
1045914366 8:107448796-107448818 TTGTGCAAACTTAGGTAGGTGGG - Intronic
1046517512 8:115282500-115282522 TAAAGCAAAGATAGGCAAGTGGG + Intergenic
1058279237 9:103090698-103090720 TTTAGCAATCAAAGCTAGGTGGG + Intergenic
1187619347 X:21032574-21032596 AACAGCAAAAATAGGCAGGTGGG + Intergenic
1189169022 X:38891215-38891237 TATAGGAAACCTACCTAGGTTGG + Intergenic
1193585987 X:83321846-83321868 AAAAGCAAACATTGGTAAGTGGG + Intergenic
1196335395 X:114526087-114526109 AAAAGCAAAAATAGGTAAGTTGG + Intergenic
1199654839 X:149983994-149984016 TATAGAAAGCAGAGGGAGGTAGG - Intergenic