ID: 945793570

View in Genome Browser
Species Human (GRCh38)
Location 2:214334246-214334268
Sequence CTATAGATAGATCCTGAGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 85}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945793564_945793570 -3 Left 945793564 2:214334226-214334248 CCAGGTTGCCAGGAGGGGAGCTA 0: 1
1: 0
2: 0
3: 14
4: 145
Right 945793570 2:214334246-214334268 CTATAGATAGATCCTGAGGGGGG 0: 1
1: 0
2: 1
3: 7
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945793570 Original CRISPR CTATAGATAGATCCTGAGGG GGG Intronic
900031781 1:377971-377993 CCATAGAGAGCTCCTGAAGGGGG - Intergenic
900052328 1:606162-606184 CCATAGAGAGCTCCTGAAGGGGG - Intergenic
900684649 1:3940318-3940340 CTCTAGGCAGGTCCTGAGGGAGG - Intergenic
907378764 1:54067309-54067331 CTATAGGGAGAGCCTGTGGGAGG + Intronic
913020192 1:114781372-114781394 CTAGAGATGGATGCTGATGGTGG - Intergenic
915450257 1:156000218-156000240 ATATAGATATATCCTGAGTCTGG + Intronic
915710678 1:157895347-157895369 ATATAGAGAGATCCTGAGGTAGG + Intronic
917303770 1:173606244-173606266 CTATAGAGAGATCCACAGGGAGG - Intergenic
1062998369 10:1890420-1890442 ATATGGAAAGATCCTGAGGTGGG - Intergenic
1063090160 10:2858160-2858182 CTATAGGTAGATACTTAGAGGGG - Intergenic
1064406944 10:15072516-15072538 CTTTAGATAAAACCTGAGAGGGG + Intronic
1065609267 10:27455244-27455266 CTATAGCTAGGTGCTTAGGGAGG + Intergenic
1075981261 10:126742017-126742039 TTATAAATTGATCCTGAGTGTGG - Intergenic
1078919928 11:15820343-15820365 CTATACATGAATTCTGAGGGTGG - Intergenic
1079315869 11:19407441-19407463 CTACAGATATAGCCCGAGGGTGG + Intronic
1080245357 11:30173942-30173964 CTGTAGATAGGTTCAGAGGGCGG - Intergenic
1080486562 11:32714051-32714073 CTGGAGATAGATCCTCAGGTTGG - Intronic
1084876487 11:72137359-72137381 CTCTAGATAGATCCTGAGAGTGG - Intronic
1084881508 11:72174735-72174757 CTCCAAATAGATCCTGAGAGTGG - Intergenic
1087534624 11:99427328-99427350 CAACAGTTAGAACCTGAGGGGGG + Intronic
1088588074 11:111377561-111377583 CTAAGGATAGATCCTCAGTGTGG + Intronic
1091399489 12:173612-173634 CAATAGAAAGATCCTCAGAGAGG + Intronic
1098200585 12:68051093-68051115 CTTTAAATAGATTCTAAGGGAGG + Intergenic
1098440272 12:70510398-70510420 CTCTGGAGAGATCCTTAGGGAGG - Intergenic
1100651375 12:96593172-96593194 CTATTGATAGATTCTCAGTGTGG + Intronic
1101287266 12:103327707-103327729 CTAGAGATAGATGCTGTGAGAGG - Intronic
1104182760 12:126398617-126398639 CTTTAGATAAAACCTGAGAGGGG + Intergenic
1106015798 13:25867842-25867864 CTATAGTAGGATTCTGAGGGTGG - Intronic
1111533525 13:89571915-89571937 CTTTAGATAAAACCTGAGAGGGG - Intergenic
1114791180 14:25660176-25660198 GTGGAGATAGATCCTGAGGTTGG + Intergenic
1115372694 14:32636460-32636482 ATATAGATAGGTGCTGAGAGTGG + Intronic
1117453526 14:55875252-55875274 CAATACATAGATCTTGAGGGAGG + Intergenic
1121835111 14:97085205-97085227 CAATAGATAAATTCTGGGGGGGG + Intergenic
1124859698 15:33426969-33426991 AGATAGTTAGATTCTGAGGGTGG - Intronic
1127566116 15:60190046-60190068 CTATAGATAGTTCCTCATGAAGG + Intergenic
1129270870 15:74418655-74418677 CTATAAATGGCTCCTGGGGGAGG - Intronic
1131778985 15:95833853-95833875 CTTTAGAAAGATCATGAGAGTGG - Intergenic
1135510712 16:23080800-23080822 CTATACGTAGCTCCTTAGGGTGG - Intronic
1141307031 16:82874562-82874584 CTAAAAATAGATCCTCTGGGAGG - Intronic
1152947876 17:83207743-83207765 CCATAGAGAGCTCCTGAAGGGGG + Intergenic
1156153572 18:34272777-34272799 CTATTCATAGTTCCTGAGAGGGG + Intergenic
1156201096 18:34832906-34832928 CTATAGATAGTTACTTAAGGAGG + Intronic
1157460432 18:47887486-47887508 CTATAGTTAGTTCCTGATGCAGG + Intronic
1163224223 19:15944625-15944647 CTTTAGATAAAACCTGAGGGGGG + Intergenic
924988543 2:291427-291449 CTATATATAGGTCCTGAGATGGG + Intergenic
934931513 2:98429591-98429613 CTATTGATAGATGCAGGGGGAGG + Intergenic
939970248 2:148650270-148650292 ATATAGATAGATATTGGGGGAGG - Intronic
941805228 2:169705695-169705717 TGAAAGATAGATCCTGAGGCAGG + Intronic
945793570 2:214334246-214334268 CTATAGATAGATCCTGAGGGGGG + Intronic
946051930 2:216870145-216870167 CTAGAAAGAGATCTTGAGGGAGG - Intergenic
946791552 2:223305537-223305559 CTATAGATAGTTCCTGTGCTGGG + Intergenic
1172750657 20:37248678-37248700 CTCTAGATACATTCTTAGGGCGG - Intergenic
1174542444 20:51300371-51300393 CTTTAGATAAAACCTGAGAGGGG + Intergenic
1184380412 22:44141894-44141916 CTGTATATAGTTGCTGAGGGAGG + Intronic
1184796745 22:46737647-46737669 CTGTGGATGGATCCCGAGGGGGG - Intronic
968894661 4:3392114-3392136 CTAGAAGTAGATCCTGAGTGTGG + Intronic
971112998 4:23609993-23610015 AGATAGATACATGCTGAGGGAGG - Intergenic
975936329 4:79585580-79585602 CTAGAAATAGATCCTGACGTGGG + Intergenic
976763410 4:88574071-88574093 CTATAGATTGATTCTGGGGGCGG - Intronic
986603692 5:9500285-9500307 CTACATATTGATCCTGATGGTGG + Intronic
986631396 5:9777081-9777103 CTGTTGATTGATCATGAGGGTGG + Intergenic
990439635 5:55831930-55831952 CTATAGATACAACCTGAGAGTGG - Intergenic
994536767 5:101040686-101040708 CTATAGTTTGATCATGGGGGTGG - Intergenic
995520977 5:113005015-113005037 CTCTAGATAGAGCCCGAGGCAGG + Intronic
995618800 5:113999600-113999622 CTAGGGATCGTTCCTGAGGGTGG - Intergenic
999896364 5:156038211-156038233 CATTAGATAGATCCTAAGGCAGG + Intronic
1001855634 5:175008060-175008082 CTAGAGTGAGAACCTGAGGGGGG + Intergenic
1002742039 5:181440897-181440919 CCATAGAGAGCTCCTGAAGGGGG + Intergenic
1003046531 6:2738241-2738263 CTAAAGATAGATCAGGAAGGTGG - Intronic
1003351726 6:5324130-5324152 CTTTAGATAAAACCTGAGAGGGG - Intronic
1007582501 6:42967799-42967821 CTTTAGAGGGATCCAGAGGGAGG - Intronic
1008295581 6:49772210-49772232 CTTTAGATACAACCTGAGAGGGG + Intergenic
1019247176 6:170716635-170716657 CCATAGAGAGCTCCTGAAGGGGG + Intergenic
1023266062 7:38407200-38407222 CTATAGATAGATATAGAGAGAGG - Intronic
1024064328 7:45720008-45720030 CTGTAGAGAGAGCCTCAGGGCGG + Exonic
1024103618 7:46058960-46058982 CTAGAGCAAGTTCCTGAGGGTGG - Intergenic
1033601626 7:142892856-142892878 CTATAGCTGGAAGCTGAGGGGGG - Intergenic
1033675138 7:143533440-143533462 CTGAAGATTGATCCTGAGGATGG - Intergenic
1033696698 7:143796001-143796023 CTGAAGATTGATCCTGAGGATGG + Intergenic
1035500960 8:91299-91321 CCATAGAGAGCTCCTGAAGGGGG - Intergenic
1037631446 8:20660453-20660475 CTTTAGATAAAACCTGAGAGGGG + Intergenic
1038683531 8:29693757-29693779 CTATATATCAAGCCTGAGGGGGG - Intergenic
1039313332 8:36343898-36343920 CTATAAATTGGTCCTGACGGTGG + Intergenic
1039842189 8:41302088-41302110 CTATAGATACAGATTGAGGGTGG - Intronic
1039931974 8:42000983-42001005 CTATAGATAAAACGTGAGGGAGG + Intronic
1039948848 8:42152623-42152645 CGGTTGATAAATCCTGAGGGCGG - Intergenic
1041919888 8:63169133-63169155 CTTAGGACAGATCCTGAGGGCGG + Intronic
1203607950 Un_KI270748v1:72113-72135 CCATAGAGAGCTCCTGAAGGGGG + Intergenic
1185788217 X:2908536-2908558 TTATAGATAGATGATGGGGGGGG - Intronic
1189947199 X:46191471-46191493 CTAGAAATAGACCCTGAGGCAGG + Intergenic
1192572840 X:72220802-72220824 CTTTAGATAAAACCTGAGAGGGG - Intronic
1192765884 X:74139108-74139130 CTTTAGATAAAACCTGAGAGGGG - Intergenic
1197979997 X:132207500-132207522 ATATAGATAAATCCTGAGTTAGG + Intronic
1198801163 X:140449074-140449096 CTCCAGAAAGAGCCTGAGGGGGG - Intergenic