ID: 945800052

View in Genome Browser
Species Human (GRCh38)
Location 2:214417677-214417699
Sequence ATGTGTCGGTGGAGAGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 330}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945800048_945800052 0 Left 945800048 2:214417654-214417676 CCTAGTAAGAGGCAAATTCAGAT 0: 1
1: 0
2: 3
3: 22
4: 191
Right 945800052 2:214417677-214417699 ATGTGTCGGTGGAGAGTGGATGG 0: 1
1: 0
2: 0
3: 24
4: 330

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945800052 Original CRISPR ATGTGTCGGTGGAGAGTGGA TGG Intronic
903215400 1:21840982-21841004 ATGAGTGGATGGAGAGAGGAAGG - Intronic
906552445 1:46676635-46676657 AGGTGTGGGGTGAGAGTGGATGG + Exonic
907325351 1:53634549-53634571 ATGTGAGGGTGGAGCGAGGAGGG + Intronic
907651155 1:56296067-56296089 ATGTGTGAATGGAGAGTGGATGG - Intergenic
907855686 1:58301220-58301242 ATGTGGGGGTGGAGAGGGGGGGG + Intronic
909463690 1:75948332-75948354 ATGTGTGGGTGGAGTGGAGAGGG + Intergenic
909577766 1:77194632-77194654 ATTTGTGGGTGGAGGGTGGGGGG + Intronic
910716338 1:90235696-90235718 CTATGTCTGTGGAAAGTGGAGGG - Intergenic
911799922 1:102122977-102122999 CTGTGGCGGTGAAGAGAGGATGG + Intergenic
911968110 1:104393894-104393916 TTGTGTAGATGGAGAGTAGAAGG + Intergenic
917184915 1:172342602-172342624 ATTTGAGGGTGGAGAGTGGGAGG + Intronic
917369467 1:174275038-174275060 ATATGTGTGTGGAGAGAGGAGGG - Intronic
917383000 1:174435796-174435818 TGGTGTCGGGGGAGAGGGGAGGG - Intronic
918205046 1:182300708-182300730 GTGTGTTGGTGGAGGGTGGGTGG + Intergenic
919664184 1:200276364-200276386 ATGTGTGGGAGGAGAGAGGATGG - Intergenic
921249226 1:213281019-213281041 GTGTGTGGGTGGGGAGGGGAGGG - Intergenic
1063261407 10:4393322-4393344 CTGAGTCTGTGGAGAGTTGAGGG - Intergenic
1063961992 10:11314443-11314465 ATCTGGGGGTGGAGAGTGGTTGG - Intronic
1064156861 10:12909659-12909681 ATGAGGCTGTGGAGAGTGGAAGG + Intronic
1065221586 10:23501435-23501457 ATGTGAGGGTGGAGAGTGGGAGG - Intergenic
1066753413 10:38683861-38683883 ATTTGAGGGTGGAGGGTGGAAGG + Intergenic
1067075755 10:43180729-43180751 ATGTGGTGGTGAAGTGTGGAGGG + Intronic
1067421471 10:46154510-46154532 ATGTGTGTGTGGTGTGTGGAGGG - Intergenic
1067506808 10:46860961-46860983 ATGTGTGTGTGGTGTGTGGAGGG - Intergenic
1067833695 10:49624892-49624914 ATGAGTGGGTGGTGGGTGGAAGG + Intronic
1071348115 10:84712759-84712781 ATGTGTATGTGGAGATTGGGTGG - Intergenic
1071371070 10:84952400-84952422 ATGGGGTGGTGGAGAGAGGAGGG + Intergenic
1071500628 10:86201524-86201546 ATGGGAGGGTGGAGAGTGGAGGG + Intronic
1073127631 10:101161746-101161768 ACCTGACAGTGGAGAGTGGAAGG + Intergenic
1074209428 10:111316175-111316197 ACGTGAGGGTGGACAGTGGAAGG + Intergenic
1074710418 10:116172685-116172707 ATGTGTAAGTGGAAAGTGGAGGG + Intronic
1076481896 10:130790192-130790214 ATGTGTGGGTTGAGTGTGGTGGG - Intergenic
1076481901 10:130790244-130790266 ATGTGTGGGTTGAGGGTGGTGGG - Intergenic
1076481908 10:130790296-130790318 ATGTGTGGGTTGAGGGTGGTGGG - Intergenic
1076481921 10:130790400-130790422 ATGTGTGGGTTGAGGGTGGTGGG - Intergenic
1076481970 10:130790765-130790787 ATGTGTGGGTAGAGTGTGGTGGG - Intergenic
1076481976 10:130790814-130790836 ATGTGTGGGTTGAGTGTGGTGGG - Intergenic
1076844994 10:133065612-133065634 ATGGGTGGGTGGATTGTGGATGG + Intergenic
1077357821 11:2126895-2126917 ATGGGTGGATGGTGAGTGGATGG + Intergenic
1078329540 11:10408253-10408275 AGGAGATGGTGGAGAGTGGAGGG + Intronic
1081622018 11:44624265-44624287 GTGTGGAGGTGGGGAGTGGAAGG + Intergenic
1082696280 11:56369005-56369027 TTGTGTAGGTGGAGATTGGGAGG - Intergenic
1082721167 11:56678986-56679008 ATGTTTCTGTGGGGAGAGGAGGG - Intergenic
1084485348 11:69444843-69444865 ATGTGGCTGGAGAGAGTGGACGG + Intergenic
1084556426 11:69878860-69878882 GTGTGTTGGTGGAGTGAGGATGG - Intergenic
1085122158 11:73974162-73974184 CTGTGGCTGTGGAGGGTGGAAGG + Intergenic
1085698317 11:78724547-78724569 ATATATCAGTGGAGAATGGATGG - Intronic
1086038549 11:82446001-82446023 ATCTGTAGGAGGAAAGTGGATGG + Intergenic
1087118352 11:94546179-94546201 CCTTGTTGGTGGAGAGTGGAAGG + Exonic
1087691673 11:101327449-101327471 AAGGGTCGGTGGGGTGTGGAAGG + Intergenic
1088065369 11:105711275-105711297 ATGAGTCGGGGGAGAGGGGAGGG + Intronic
1088775504 11:113078557-113078579 ATGTTTGGATGGGGAGTGGAGGG + Intronic
1089565935 11:119371805-119371827 ATGTGTGGGTGGTGGGTGGGTGG - Intronic
1089585843 11:119508988-119509010 GTGTGTGTGTGGAGTGTGGAGGG + Intergenic
1090061349 11:123466685-123466707 GTGCGTGTGTGGAGAGTGGAGGG + Intergenic
1091058208 11:132438621-132438643 ATGTGTCTGTGGAGATGGGCTGG + Intronic
1091427914 12:407482-407504 ATGTGTGAGTCTAGAGTGGAGGG + Intronic
1091525990 12:1301656-1301678 ATTGGAGGGTGGAGAGTGGAGGG + Intronic
1092118842 12:6029550-6029572 ATGGGCAGGTGTAGAGTGGAGGG - Intronic
1092986655 12:13852186-13852208 AGGTATGGGTTGAGAGTGGAAGG - Intronic
1094278543 12:28708060-28708082 TTGTGTCAATGGAGCGTGGATGG - Intergenic
1094719907 12:33052804-33052826 AAGTGTCGCTGGAGGGTGGCTGG - Intergenic
1095476473 12:42590929-42590951 GTGTGTGGGGGGAGTGTGGAGGG + Intergenic
1095677716 12:44938786-44938808 ATTTGAGGGTGGAGAGTGGGAGG - Intergenic
1095733978 12:45536112-45536134 ATGGGTAGGTGGAGAGCAGATGG - Intergenic
1095895803 12:47279494-47279516 ATGTGTGGGGGGACAGAGGAGGG - Intergenic
1097376376 12:58848197-58848219 ATGTGTGTGTGGAGAATAGAGGG - Intergenic
1098314360 12:69177584-69177606 ATTTTTCCATGGAGAGTGGAGGG + Intergenic
1098801960 12:74971826-74971848 ATCTGAGGGTGGAGAGTGGGAGG + Intergenic
1100114743 12:91290874-91290896 ATTTGAAGGTGGAGGGTGGAAGG - Intergenic
1100141737 12:91627276-91627298 ATGTGTTGGTGGAGGGCGGGGGG - Intergenic
1101698516 12:107149899-107149921 AGGGGTCGGGGGAGAGGGGAGGG - Intergenic
1102742415 12:115219868-115219890 CTGGGCCGGTGGAGAGGGGAAGG - Intergenic
1102920746 12:116789620-116789642 ATGGATGGGAGGAGAGTGGATGG + Intronic
1102920817 12:116789918-116789940 ATGGATGGGAGGAGAGTGGATGG + Intronic
1103179593 12:118898450-118898472 ATGTTTAAGTGGAGTGTGGAAGG + Intergenic
1105630261 13:22156834-22156856 ATGTCTGGGTATAGAGTGGAAGG - Intergenic
1106586221 13:31058515-31058537 AGGTGTGGGTTGAGAGTGGAGGG + Intergenic
1107102991 13:36614212-36614234 GTGAGTTGGTGGAGAGCGGAAGG - Intergenic
1108140091 13:47411389-47411411 ATGTTTGGGTGCAGATTGGAAGG - Intergenic
1108211268 13:48142083-48142105 ATGTGGGGGTGGGGAGTGGTGGG + Intergenic
1108625865 13:52228376-52228398 ATGTGTCTGTGTGGAGGGGATGG - Intergenic
1108660198 13:52578104-52578126 ATGTGTCTGTGTAGAGGGGATGG + Intergenic
1109568251 13:64149015-64149037 ATGTGTCAGGGGAGAGTATATGG - Intergenic
1111753686 13:92365407-92365429 ATGAGTGAGTGGTGAGTGGATGG + Intronic
1113997340 14:16099220-16099242 ATGTGTTGATGTGGAGTGGAGGG - Intergenic
1114330331 14:21630513-21630535 ACTTGAGGGTGGAGAGTGGAGGG - Intergenic
1115193262 14:30769686-30769708 ATATGTGTGGGGAGAGTGGAGGG - Intergenic
1116641239 14:47466163-47466185 ATGTGAGGGTGGAGGGTGGGAGG + Intronic
1117946662 14:61032273-61032295 ATATGTCGGTGGAAAGAGGAGGG + Intronic
1119922224 14:78457032-78457054 AGGTGGCGGGGGAGAGGGGATGG - Intronic
1120767419 14:88342183-88342205 ATGCATGGGTGGAGAGGGGAAGG - Intergenic
1121493531 14:94376987-94377009 ATGTATTTGTGGAGAGTGAAAGG + Exonic
1121513883 14:94536063-94536085 ACGTGTAGGTGGAGAGAGCAGGG + Intergenic
1121637813 14:95465685-95465707 GTGTGTGGGTGGATAGTGAAGGG + Intronic
1122643641 14:103177274-103177296 ATGAGTGGGAGAAGAGTGGATGG - Intergenic
1122958524 14:105083822-105083844 ATGGGTGGATGGAGGGTGGAGGG - Intergenic
1123044935 14:105507363-105507385 ACCTGTCTGTGGAGAGTGGGTGG - Intergenic
1125083786 15:35706072-35706094 GTGTGTGGGTGGAGAGGTGAAGG + Intergenic
1125532120 15:40420500-40420522 TTGTGTCCTTGGAGAGTGGCTGG + Intronic
1127304144 15:57685506-57685528 GTGTGTCGGGGGAGGGTGGGGGG + Intronic
1128543361 15:68551907-68551929 ATGTATGGGAGGAGAGGGGAAGG - Intergenic
1128734443 15:70044930-70044952 ATGTGTGGGTGGGTAATGGATGG + Intergenic
1128773675 15:70302591-70302613 ATGAGTGGTTGGAGAGTGGTTGG + Intergenic
1131656082 15:94460641-94460663 ATGTGTCTGAGGAGAGAAGAGGG + Intronic
1131764792 15:95663844-95663866 ATGTGTTGGAGGAGGGGGGAGGG + Intergenic
1132573582 16:654884-654906 GTGCGGCCGTGGAGAGTGGAAGG - Intronic
1132951734 16:2566650-2566672 GTGTGTTGGTGTAGAGTGGGAGG + Intronic
1132962616 16:2633520-2633542 GTGTGTTGGTGTAGAGTGGGAGG - Intergenic
1133372349 16:5254861-5254883 ATGTGTAGGTGGAGCGAAGAGGG + Intergenic
1133383180 16:5347956-5347978 ATGGGTTGGTGGGGAGTGGATGG - Intergenic
1133512023 16:6468938-6468960 ATCTGAGGGTGGAGGGTGGAAGG - Intronic
1134632211 16:15765028-15765050 ATGAGTTTCTGGAGAGTGGAGGG + Intronic
1136316757 16:29459065-29459087 ATGTGTGGGGGCAGAGTGAAGGG - Intergenic
1136431332 16:30198407-30198429 ATGTGTGGGGGCAGAGTGAAGGG - Intronic
1136729295 16:32393130-32393152 ATTTGAGGGTGGAGGGTGGAAGG - Intergenic
1137580049 16:49628087-49628109 ATGGGTAGATGGAGGGTGGATGG - Intronic
1138434202 16:56988280-56988302 ATGTCTGGGAGGTGAGTGGAAGG + Intergenic
1138613814 16:58148456-58148478 AAGTGTCGGTAGGGTGTGGAGGG - Intergenic
1140206267 16:72936176-72936198 ATATGTTGGTGTAAAGTGGATGG - Intronic
1140460199 16:75133417-75133439 ATCTGACGGTGGAGGGTGGGAGG - Intergenic
1140634556 16:76896163-76896185 GTGGGTCGGGGGAGAGGGGAGGG + Intergenic
1141048630 16:80740002-80740024 ATGTGGCTGTGGAGGGTGGTGGG + Intronic
1142124128 16:88401779-88401801 ATGGGTGGATGGATAGTGGATGG + Intergenic
1202997101 16_KI270728v1_random:124391-124413 ATTTGAGGGTGGAGGGTGGAAGG + Intergenic
1203023788 16_KI270728v1_random:436733-436755 ATTTGAGGGTGGAGGGTGGAAGG + Intergenic
1142801079 17:2346290-2346312 ATGGGTCGGTGTGGAGTTGAGGG - Intronic
1143436724 17:6934161-6934183 TTGTGAGGGTGGAGAGTGGGAGG - Intronic
1145864208 17:28229525-28229547 CTGTGTGGGTGGGGAGTGGGAGG + Intergenic
1145891958 17:28423376-28423398 ATGTTTTGGTGGAGTTTGGAGGG - Intergenic
1146918027 17:36690570-36690592 ATGTATCTGGGGAGAGTGGTTGG + Intergenic
1147926638 17:43950724-43950746 TTGTGTGGGTGGGGAGTGGGAGG - Intergenic
1148776781 17:50100325-50100347 CTGTTTTGGTGGAGACTGGACGG + Intronic
1150485223 17:65538446-65538468 ATGTTCGGGTGTAGAGTGGATGG + Intronic
1150829273 17:68504692-68504714 GTGTAGCGGTGGAGGGTGGAGGG + Intergenic
1152312472 17:79559502-79559524 TTGTATGGGTGGATAGTGGATGG + Intergenic
1153034160 18:743260-743282 ATGTTTCGGCGAAGTGTGGATGG - Exonic
1154158374 18:11960966-11960988 CTGTGAGGGTGGAGAGAGGAGGG + Intergenic
1155046249 18:22105959-22105981 ATGTGAAAGGGGAGAGTGGAAGG - Intergenic
1158366623 18:56744303-56744325 ATGTTTCTGTGGATAGTGGATGG + Intronic
1159684728 18:71404097-71404119 ATATATAGGTGGAAAGTGGATGG + Intergenic
1160185908 18:76675797-76675819 GTGTGGCGGTGGAGATTGCAGGG + Intergenic
1160692477 19:466319-466341 ATGGTTGGGTGGAGGGTGGATGG + Intronic
1160692575 19:466698-466720 ATGGTTGGGTGGAGGGTGGATGG + Intronic
1160692630 19:466888-466910 ATGGCTGGGTGGAGGGTGGATGG + Intronic
1160692641 19:466923-466945 ATGGTTGGGTGGAGGGTGGATGG + Intronic
1160692670 19:467018-467040 ATGGTTGGGTGGAGGGTGGAAGG + Intronic
1160692738 19:467234-467256 ATGGTTGGGTGGAGGGTGGATGG + Intronic
1160799211 19:960069-960091 CTGTGAGGGTGGAGAGGGGATGG - Intronic
1160878361 19:1308354-1308376 ATGTGTCGGGGGGGGGGGGAGGG + Intergenic
1161299181 19:3534650-3534672 ATGTGTCGGGGCAGTGTGGCAGG + Intronic
1161657502 19:5525117-5525139 ATGGGTGGGTGGTGGGTGGATGG - Intergenic
1161669675 19:5599178-5599200 CTGTGTGGGTTTAGAGTGGAGGG - Intronic
1166647659 19:44544076-44544098 CTGAGTTGGTGGAGAGTAGATGG - Intergenic
1167595896 19:50427959-50427981 AAGTCTCGGAGGAGGGTGGATGG + Intronic
1167598155 19:50438080-50438102 ATCAGTGGGTGGAAAGTGGAGGG - Intronic
1167691309 19:50985108-50985130 ATGAGAGGGTGGAGAGTGGGAGG - Intergenic
1168591001 19:57634102-57634124 ATCTGTCTGGGGAGGGTGGAGGG - Intronic
925363484 2:3295554-3295576 GTGTGTGTGTGGAGAGAGGATGG - Intronic
925363670 2:3296447-3296469 GTGTGTGTGTGGAGAGAGGATGG - Intronic
926358746 2:12065442-12065464 ATTAGTTGGAGGAGAGTGGAGGG + Intergenic
927105310 2:19818859-19818881 GTGTGTGGGTGGGGAGTGAAAGG - Intergenic
928455158 2:31414021-31414043 GTGTGTGGGTGGGGAGTGGGGGG + Intronic
929602542 2:43213350-43213372 AAGTGCCAGTGGAGAGGGGAAGG - Intergenic
930014679 2:46962245-46962267 CTGTGTCGGAGGAGAATGTAAGG - Intronic
930583801 2:53246075-53246097 ACTTGACGGTGGAGAGTGGAAGG + Intergenic
931014777 2:57964093-57964115 CTGTGTTGGGGGAGAGGGGAAGG - Intronic
931327808 2:61245209-61245231 ATGTTTTGGTGGAGAGATGACGG - Exonic
931779689 2:65568345-65568367 ATTTGAGGGTGGAGGGTGGAAGG - Intergenic
932006263 2:67930182-67930204 ATGTGTGGGTGAAGGGTGGATGG + Intergenic
932202318 2:69841599-69841621 ATGTATGTGTGGAGAGGGGAGGG + Intronic
932687029 2:73879933-73879955 ACCTGAGGGTGGAGAGTGGAGGG - Intergenic
933912656 2:86956949-86956971 CTGTGTCAGTGGCAAGTGGATGG + Intronic
934010338 2:87812941-87812963 CTGTGTCAGTGGCAAGTGGATGG - Intronic
934185595 2:89671041-89671063 ATTTGAGGGTGGAGGGTGGAAGG - Intergenic
934557830 2:95296794-95296816 CTGTGTCTGTGAAGAGTGGCAGG + Intergenic
934631199 2:95925036-95925058 ATGTTTCTATGGAGAGGGGAAGG - Intronic
934802845 2:97183948-97183970 ATGTTTCTATGGAGAGGGGAAGG + Intronic
934833358 2:97556621-97556643 ATGTTTCTATGGAGAGGGGAAGG - Intronic
934868987 2:97842555-97842577 CAGTGTTGGGGGAGAGTGGAGGG + Intronic
935327307 2:101948547-101948569 CTGTGGAGGTGGAGAGTGGATGG + Intergenic
935773905 2:106453661-106453683 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935906158 2:107842252-107842274 CTGTGTCAGTGGCAAGTGGATGG + Intronic
935992627 2:108734775-108734797 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936127946 2:109807417-109807439 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936216751 2:110564068-110564090 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936425890 2:112418649-112418671 CTGTGTCAGTGGCAAGTGGATGG - Intronic
937077871 2:119120106-119120128 ATGTGTCAGGGGAGAGCAGAAGG + Intergenic
937552875 2:123116148-123116170 ATTTGAGGGTGGAGAGTGGGAGG - Intergenic
939731893 2:145795056-145795078 ATATTTCAGAGGAGAGTGGATGG - Intergenic
940284424 2:152019531-152019553 ATGAGTGGGTGGATGGTGGATGG + Intronic
940596666 2:155802717-155802739 AAGTCTCAGTGGAGAGTGGTAGG - Intergenic
942379091 2:175369046-175369068 TTTTATAGGTGGAGAGTGGAGGG + Intergenic
943269486 2:185780711-185780733 ATATTTCTGTGGAGAGTGGGAGG + Intronic
943666670 2:190616172-190616194 ATGTGTGGATGGAGTGAGGAGGG + Intergenic
944260372 2:197669532-197669554 AGATGTGGGTGGGGAGTGGACGG + Intronic
945366833 2:208964927-208964949 ATCAGAGGGTGGAGAGTGGATGG + Intergenic
945800052 2:214417677-214417699 ATGTGTCGGTGGAGAGTGGATGG + Intronic
946076737 2:217079765-217079787 ATGAGTAGGAGTAGAGTGGATGG + Intergenic
946694564 2:222341278-222341300 ATCAGAGGGTGGAGAGTGGAAGG - Intergenic
947009349 2:225548498-225548520 ATGTGTCTCTGGAGAGTTGGAGG + Intronic
948610202 2:239162009-239162031 AGGAGTCAGTGGACAGTGGACGG - Intronic
1168997665 20:2145116-2145138 GAGTGTCGCTGGAGAGTGCAAGG - Exonic
1172780083 20:37431407-37431429 ATGGGTGGGTGATGAGTGGATGG - Intergenic
1174087473 20:48019366-48019388 ATGTGTGGCTGGAGGGTGAAGGG + Intergenic
1174128814 20:48327604-48327626 ATGTGTGGCTGGAGGGTGAAGGG - Intergenic
1174306881 20:49619577-49619599 ATGTGTGGGTGGGGGATGGATGG + Intergenic
1174575945 20:51537245-51537267 ATGTGTGGGTGGGGGGTGCAGGG + Intronic
1175720474 20:61283629-61283651 GTGTGTGTGTGGTGAGTGGATGG + Intronic
1175787371 20:61720439-61720461 ATGTAGGGGTGCAGAGTGGAGGG + Intronic
1180182412 21:46123903-46123925 ATGGGTGGGTGGATAGAGGATGG + Intronic
1180182473 21:46124159-46124181 ATGGGTGGGTGGACAGAGGATGG + Intronic
1180842474 22:18965781-18965803 AGGAGTGGGTGGGGAGTGGAAGG - Intergenic
1181059012 22:20273075-20273097 AGGAGTGGGTGGGGAGTGGAAGG + Intronic
1182497940 22:30723794-30723816 CTGTGTCGGGAGAGAGTAGATGG - Intronic
1184123708 22:42471705-42471727 ATGGGTGGGTGGATGGTGGATGG - Intergenic
1184444510 22:44539521-44539543 ATGGGTAGGTGGATGGTGGATGG + Intergenic
1184444604 22:44539903-44539925 ATGGGTAGGTGGACGGTGGATGG + Intergenic
1185154595 22:49185609-49185631 ATGGGTGGGTGGAGAGTGAAAGG - Intergenic
949781934 3:7699372-7699394 ATGTGTATGTAGAGAGTTGAAGG - Intronic
950930412 3:16783564-16783586 ATGGGTAGCTGGAGAGGGGATGG - Intergenic
950948590 3:16976226-16976248 ATGTGTGTGTGGAGAGGGGTTGG + Intronic
951098548 3:18659773-18659795 ATTTGTGGGTAGAGGGTGGAAGG + Intergenic
951284887 3:20798316-20798338 ACTTGAGGGTGGAGAGTGGAAGG - Intergenic
953003185 3:38953253-38953275 ATGGGAAGGTGGAGGGTGGAAGG + Intergenic
959104260 3:102048384-102048406 ATGTGAGGGTGAAGAGTGGGAGG - Intergenic
959724383 3:109527339-109527361 ATGGGGTGGTGGAGGGTGGAGGG + Intergenic
960231131 3:115228933-115228955 AGGTGTCACAGGAGAGTGGAAGG + Intergenic
962713489 3:138107373-138107395 ATCTCCTGGTGGAGAGTGGAAGG - Intronic
963700495 3:148619506-148619528 ATGTCTTGATGGAGAGTGGGAGG - Intergenic
963892716 3:150653589-150653611 ATGTGCGGGTGGAGGGAGGAGGG - Intergenic
967807625 3:193729624-193729646 ATGTGTTGGTGGGGAGGGGAGGG - Intergenic
968161903 3:196433533-196433555 ATATGTGGGTGGAGGTTGGAAGG - Intergenic
971958940 4:33459325-33459347 ATTTGAGGGTGGAGAGTAGAGGG + Intergenic
973186139 4:47331224-47331246 AGGGGTGGGTGGAGAGAGGAAGG + Intronic
977505706 4:97900768-97900790 ACTTGTGGGTGGAGGGTGGAAGG + Intronic
977911693 4:102544920-102544942 ATGTGTCAAGGAAGAGTGGAGGG - Intronic
977948698 4:102944223-102944245 ATTTGAGGGTGGAGGGTGGAAGG + Intronic
980693309 4:136323703-136323725 ATGTGTGTGTGGAGAGAGGGAGG + Intergenic
981375123 4:144006330-144006352 ATGTGTTGGGGGAGAGAGCATGG + Intronic
981664745 4:147211335-147211357 ATTTGAGGGTGGAGAGTGGGAGG - Intergenic
982822333 4:159956966-159956988 ATGTGTGTGTGGAGAGTGTGGGG - Intergenic
984943755 4:184955324-184955346 ATGTGTGTGTGGAGGGAGGAGGG + Intergenic
985269906 4:188184041-188184063 ATGGGGAGGTGGAGAGGGGATGG - Intergenic
986283092 5:6339366-6339388 GTGTGTGGGTGGGCAGTGGAGGG + Intergenic
986725742 5:10595098-10595120 CTGTGACTGTGGAGGGTGGAGGG + Intronic
986806189 5:11311063-11311085 ATGTGTGGGTTGAGGGTGCATGG - Intronic
986806214 5:11311225-11311247 ATGTGTGGGTTGAGGGTGCATGG - Intronic
986806270 5:11311568-11311590 ATGTGTGGGTTGAGGGTGCATGG - Intronic
987038566 5:14040887-14040909 ATCTGTAGGAGCAGAGTGGAGGG + Intergenic
987785671 5:22495281-22495303 ATGTTTCTGTGAAGAGTGGTAGG - Intronic
987915423 5:24206401-24206423 ACTTGACGGTGGAGAGTGGGAGG + Intergenic
989352159 5:40498874-40498896 AGGAGTCTCTGGAGAGTGGAGGG + Intergenic
990758017 5:59097464-59097486 ATGTGTGTTTAGAGAGTGGAGGG - Intronic
991470429 5:66963051-66963073 ATGGGTGGGTGGGGAGTGGGGGG + Intronic
991521951 5:67509788-67509810 ACTTGAGGGTGGAGAGTGGAAGG + Intergenic
993398033 5:87414920-87414942 AGGTGTGGGTGGAGGGTAGAAGG - Intergenic
993795952 5:92268072-92268094 CTGTGTTGGGAGAGAGTGGATGG - Intergenic
994397803 5:99240523-99240545 ATGGGTTGATGGACAGTGGAAGG + Intergenic
995429452 5:112058059-112058081 ACTTGACGGTGGAGGGTGGAAGG + Intergenic
995833293 5:116376897-116376919 CTGTGTGGGTGGGGTGTGGATGG + Intronic
995858425 5:116617574-116617596 ATGTGTCTGTTGAGAGTGTGTGG - Intergenic
996360622 5:122641445-122641467 ATGTGTGTGTGGGGAGGGGAGGG - Intergenic
996549403 5:124713762-124713784 ATCTGTTGGTGGAGAGGGGGAGG + Intronic
1000255828 5:159537365-159537387 GTGTGTCGGTGGATGATGGAGGG + Intergenic
1000289919 5:159860712-159860734 CTGTGTCTGTAGATAGTGGAAGG - Intergenic
1001025903 5:168224343-168224365 AGGTGTTGGGGGAGAGAGGAGGG - Intronic
1001034063 5:168284354-168284376 ATGGGGAGGTAGAGAGTGGAGGG + Intergenic
1001211208 5:169811824-169811846 ATGTGTAGATGCAGAGTGGGGGG - Intronic
1001888246 5:175315716-175315738 ATGGGTCTTTGGAGACTGGAGGG + Intergenic
1003848770 6:10200747-10200769 ATCAGAGGGTGGAGAGTGGAGGG + Intronic
1003976233 6:11347060-11347082 AGGTGAAGCTGGAGAGTGGAGGG - Intronic
1004050144 6:12069374-12069396 GTGAGTGGGTGGTGAGTGGATGG + Intronic
1004313096 6:14563259-14563281 ATGTGTGTGTGGAGTGGGGAAGG + Intergenic
1004955363 6:20722920-20722942 AAGTGGAGGTGGAGAGGGGATGG - Intronic
1008862753 6:56169751-56169773 AAGTGTTAGTGGAGTGTGGATGG - Intronic
1009886439 6:69629076-69629098 AGGTGTCAGTGGAGACTGAATGG + Intergenic
1011493375 6:87915348-87915370 ATGTGTGTGTGGAGGGTGGGAGG + Intergenic
1014303976 6:119717090-119717112 CTGGGTCAGTGGAGAGTGGAGGG + Intergenic
1015045549 6:128771503-128771525 ACTTGTGGGTGGAGAGTGGGAGG + Intergenic
1016117380 6:140303690-140303712 ATGGGTAGCTGGAGAGGGGATGG + Intergenic
1018013061 6:159689275-159689297 ATGTTTCAGTGGAGACTTGAAGG - Intronic
1018618520 6:165709404-165709426 ACATGGGGGTGGAGAGTGGAGGG - Intronic
1019323597 7:426469-426491 GAGTGTTGGTGGAGGGTGGAGGG - Intergenic
1019704687 7:2491876-2491898 ATGTGTGGGTGGATGATGGATGG - Intergenic
1019704694 7:2491915-2491937 ATGTGTGGGTGGATGATGGATGG - Intergenic
1019833303 7:3355650-3355672 ATTTGTCGGTGGAAAGCTGAGGG - Intronic
1020188352 7:5975443-5975465 TTGTGTCCCTGGAGAGGGGAAGG - Intronic
1020294563 7:6749325-6749347 TTGTGTCCCTGGAGAGGGGAAGG + Intergenic
1021226469 7:18033752-18033774 GGGAGTCGGGGGAGAGTGGAAGG - Intergenic
1025624240 7:63205253-63205275 ATGTGTGGGAGGTGAGAGGAAGG - Intergenic
1026181272 7:68043095-68043117 ATGTGTGGTTTAAGAGTGGATGG - Intergenic
1026877987 7:73890633-73890655 CTTTGTCGGTGGAGAGGAGACGG - Intergenic
1027566800 7:79805028-79805050 ATGTGTCGCTGTAGAGGTGAGGG + Intergenic
1032604479 7:133334717-133334739 ATTGGAGGGTGGAGAGTGGAGGG - Intronic
1033399980 7:141013518-141013540 ATGTGTCTGTGCACTGTGGAAGG - Intronic
1033957775 7:146873228-146873250 ACGTGTGGGTGGAGATGGGATGG - Intronic
1035288624 7:157822715-157822737 ATGGGTAGATGGATAGTGGATGG - Intronic
1035318493 7:158013365-158013387 ATGTGTAGGTGGATGATGGATGG - Intronic
1035786588 8:2266134-2266156 ATGTGACGGTGGAGCCTGGAGGG + Intergenic
1035806219 8:2455582-2455604 ATGTGACGGTGGAGCCTGGAGGG - Intergenic
1036662985 8:10720301-10720323 ATGGATGGATGGAGAGTGGATGG + Intergenic
1037576477 8:20209311-20209333 CTGTGTCTGTGAAGAGTAGAGGG + Intronic
1037759463 8:21732441-21732463 ATGAGTCTGCGGAGAGGGGAGGG + Intronic
1039798350 8:40933951-40933973 ATGTGTAGGAGGAGATTTGAAGG + Intergenic
1040543300 8:48378536-48378558 CAGTGCCGGTGGAGAGTGGCTGG - Intergenic
1040954638 8:52967389-52967411 ATGTGAAGGTGGAGGGTGGGAGG - Intergenic
1041750507 8:61255486-61255508 ATGTGTGTGTGGAGAGGTGAAGG + Intronic
1043467846 8:80530495-80530517 ATGTAACAGTGGAGATTGGAAGG + Intergenic
1045233419 8:100328111-100328133 AGGAGTGGGTGGAGAGTGGGGGG - Intronic
1045325446 8:101114431-101114453 ATGGTGGGGTGGAGAGTGGATGG + Intergenic
1045872199 8:106939754-106939776 ATGTGTCGGTGGCTGGTGGAGGG + Intergenic
1048989274 8:139751859-139751881 ATGGGTAGATGGTGAGTGGATGG - Intronic
1049096559 8:140551693-140551715 ATGGGTCGGTGGATAGTTGATGG + Intronic
1049421923 8:142520806-142520828 ATGTACCTGTGGAGAGTGCAGGG - Exonic
1049474752 8:142791648-142791670 ATGAGTGGATGGAGAATGGATGG - Intergenic
1049474809 8:142791949-142791971 ATGAGTGGATGGAGAATGGATGG - Intergenic
1049611011 8:143555330-143555352 ATGTGGCGGTGAAGGGTGGAGGG + Intronic
1050792290 9:9488185-9488207 ATGTGTAGGTGAATAGTGTAAGG - Intronic
1051605788 9:18916836-18916858 ATGAGAAGGTGGAGAGTGGAAGG - Intergenic
1051760744 9:20461023-20461045 ATGTGTGGATGGAGAGGAGAAGG - Intronic
1053577216 9:39364870-39364892 AGGTCTCTGTGGAGAGTGGGAGG - Intergenic
1053841716 9:42192795-42192817 AGGTCTCTGTGGAGAGTGGGAGG - Intergenic
1054098787 9:60923560-60923582 AGGTCTCTGTGGAGAGTGGGAGG - Intergenic
1054120187 9:61199189-61199211 AGGTCTCTGTGGAGAGTGGGAGG - Intergenic
1054587569 9:66983373-66983395 AGGTCTCTGTGGAGAGTGGGAGG + Intergenic
1055535989 9:77245021-77245043 ATGAGTGAGGGGAGAGTGGAGGG + Intronic
1055986002 9:82056861-82056883 ATGTGTAGGTGGGGGGTGGGGGG - Intergenic
1056776541 9:89516983-89517005 ATTTGAGGGTGGAGGGTGGAAGG - Intergenic
1056827683 9:89888044-89888066 ATGTGTGGGTTCTGAGTGGAAGG + Intergenic
1057008709 9:91583258-91583280 ATGAGTGGGTGGAGGTTGGATGG + Intronic
1057008719 9:91583289-91583311 ATGGGTGGGTGGAGGATGGATGG + Intronic
1057008726 9:91583320-91583342 ATGAGTGGGTGGAGGATGGATGG + Intronic
1057008742 9:91583382-91583404 ATGAGTGGGTGGAGGTTGGATGG + Intronic
1057022536 9:91710852-91710874 ATGTGTGGGTGGTGTGTGTAGGG + Intronic
1057494447 9:95549687-95549709 GTGAGTGGGTGGAGAGTGAATGG - Intergenic
1185583090 X:1226126-1226148 ATGGGTGGGTGGAGGGAGGAAGG + Intergenic
1185883828 X:3764139-3764161 ATGTATGGGTGGTGGGTGGATGG - Intergenic
1186293764 X:8126341-8126363 GTGTCTAGGTGGAGAGTGGGAGG - Intergenic
1186970724 X:14839668-14839690 ATATGGGGGTGGTGAGTGGATGG + Intergenic
1187223396 X:17352783-17352805 TTGTGCGGGTGGAGGGTGGAGGG - Intergenic
1189128916 X:38478371-38478393 ATGTGTGGGCGAAGAGTGGGTGG + Intronic
1189689563 X:43601781-43601803 ATTTGAGGGTGGAGAGTGGGAGG - Intergenic
1195270652 X:103226283-103226305 ACTTGATGGTGGAGAGTGGAAGG + Intergenic
1195557933 X:106248568-106248590 ATGTCTGGGTGGTGAGGGGAGGG + Intergenic
1195628185 X:107025879-107025901 ATTAGTATGTGGAGAGTGGAGGG + Intergenic
1198280805 X:135140239-135140261 ATGTGACGGTGGAGGGTGAGAGG - Intergenic
1198290154 X:135232275-135232297 ATGTGACGGTGGAGGGTGAGAGG + Intergenic
1198472327 X:136959094-136959116 TTGTGTATGTGGGGAGTGGAAGG - Intergenic
1198626894 X:138586064-138586086 ATTTGAGGGTGGAGAGTGGGAGG - Intergenic
1198791786 X:140354349-140354371 CTGTGTCTGTGGGGAGTGGGGGG - Intergenic
1198796528 X:140402510-140402532 ATTTGAGGGTGGAGGGTGGAAGG + Intergenic
1201120540 Y:10869410-10869432 ACGTGTTGGAGTAGAGTGGAGGG - Intergenic
1201184051 Y:11380660-11380682 ATTTGAGGGTGGAGGGTGGAAGG + Intergenic
1201672013 Y:16533466-16533488 ATCTGTGGGTGGAGTGTAGATGG + Intergenic