ID: 945800801

View in Genome Browser
Species Human (GRCh38)
Location 2:214427899-214427921
Sequence TGTATTGGAAAGGAAATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1162
Summary {0: 1, 1: 0, 2: 2, 3: 83, 4: 1076}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945800801_945800807 10 Left 945800801 2:214427899-214427921 CCATCCATTTCCTTTCCAATACA 0: 1
1: 0
2: 2
3: 83
4: 1076
Right 945800807 2:214427932-214427954 TTCACAGTGGGTTGAATCCATGG 0: 1
1: 4
2: 40
3: 119
4: 404
945800801_945800806 -2 Left 945800801 2:214427899-214427921 CCATCCATTTCCTTTCCAATACA 0: 1
1: 0
2: 2
3: 83
4: 1076
Right 945800806 2:214427920-214427942 CAGTATTTTTGATTCACAGTGGG 0: 1
1: 0
2: 17
3: 127
4: 482
945800801_945800808 25 Left 945800801 2:214427899-214427921 CCATCCATTTCCTTTCCAATACA 0: 1
1: 0
2: 2
3: 83
4: 1076
Right 945800808 2:214427947-214427969 ATCCATGGATATGAAACCCACGG 0: 1
1: 14
2: 49
3: 153
4: 472
945800801_945800805 -3 Left 945800801 2:214427899-214427921 CCATCCATTTCCTTTCCAATACA 0: 1
1: 0
2: 2
3: 83
4: 1076
Right 945800805 2:214427919-214427941 ACAGTATTTTTGATTCACAGTGG 0: 1
1: 0
2: 2
3: 24
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945800801 Original CRISPR TGTATTGGAAAGGAAATGGA TGG (reversed) Intronic
900245783 1:1635438-1635460 TGATTTGGAAAGGAACTGGTGGG - Intronic
900257013 1:1702595-1702617 TGATTTGGAAAGGAACTGGTGGG - Intronic
902296939 1:15474118-15474140 TGTATGGGTAAGAAAATGGGTGG - Intronic
902923825 1:19682884-19682906 TGAAAGGGAAAGGAAATGGAAGG - Exonic
903528449 1:24011079-24011101 TGTCTCGGAAAGGAAAGGAAAGG - Intergenic
904386929 1:30148975-30148997 TATGTTGGAAAGGGAATGGGAGG - Intergenic
904649062 1:31990659-31990681 TGAATAGGAGAGGAAATGGAGGG - Intergenic
905108523 1:35577843-35577865 GGTATTGGGCAGGAAATGGCAGG + Intronic
905297721 1:36964701-36964723 GGTAGTGGAAAGGACATGAATGG - Intronic
906019681 1:42616430-42616452 TATTTAGGAAAGAAAATGGAAGG + Intronic
906042248 1:42796698-42796720 TGTCTTGGAAAGTACATGGCTGG - Intergenic
906606478 1:47175950-47175972 TGTGTTGGAAAGAACCTGGAGGG + Intergenic
906767280 1:48445328-48445350 TGTAATGGAAGGGGAAAGGAGGG - Intronic
906905952 1:49892590-49892612 TGTAAAGGAAAAGAAATGGTAGG - Intronic
907099783 1:51819666-51819688 TGGGTTGGAAAGGAAGTAGATGG - Intronic
907868220 1:58419295-58419317 TGTATAGACAAGGAAATGGAAGG - Intronic
908065505 1:60399475-60399497 TTTATTGGCAAAGAAATGAAAGG - Intergenic
908206246 1:61852849-61852871 TGTGATGTAAAGGAAATGAAAGG + Intronic
908328868 1:63050895-63050917 TGTATGTTAAATGAAATGGATGG + Intergenic
909130838 1:71734919-71734941 TGTAATTAAATGGAAATGGAGGG - Intronic
909662361 1:78098141-78098163 AGTATTGGAATGGATTTGGAGGG + Intronic
910045262 1:82905568-82905590 TGTATCTGAAAGAGAATGGAAGG + Intergenic
910488897 1:87746343-87746365 GGAACTGGAAAGGAGATGGAGGG - Intergenic
910617234 1:89212193-89212215 TGTATAGGAAACAAAATGCATGG - Intergenic
910858525 1:91720084-91720106 TATCTGGGAAAGGAAACGGAAGG + Exonic
911170592 1:94767276-94767298 TTTATAGAAAAGGAAATGTAGGG - Intergenic
911380646 1:97109815-97109837 TATATTGGAAAGAAAATAAAAGG + Intronic
911401452 1:97379825-97379847 TTTCTAGGAAAGGAAGTGGAAGG - Intronic
911405572 1:97433697-97433719 TGAATTGGAAAGGCCTTGGAAGG + Intronic
912182888 1:107239349-107239371 TAGATTGGAATGGAAATGAATGG + Intronic
912260204 1:108103583-108103605 CGTAGTGGTAAGGAAAAGGATGG - Intergenic
912321751 1:108720178-108720200 TGAAAGGGAAAGGAAAGGGAAGG - Intronic
912911320 1:113761343-113761365 TGTCTAGGAAAGGAAAAGAAAGG - Intergenic
913181091 1:116322240-116322262 TGTATATGAAAGGAAATAGCTGG - Intergenic
913374695 1:118138058-118138080 TATATTGGAAAGGAGAAGGAGGG - Intronic
914463589 1:147907405-147907427 TATATTTGAAGGGAAGTGGAAGG - Intergenic
915312148 1:155010209-155010231 TGTCATGGAAAGAAAATGTAGGG + Intronic
916231671 1:162546629-162546651 TGTTTTGGAAAATAAATGGTTGG + Intergenic
917030975 1:170691435-170691457 AGGAAAGGAAAGGAAATGGAAGG - Intronic
917198741 1:172493849-172493871 TAGATTGGAAAGGCAATAGACGG + Intergenic
917210926 1:172631440-172631462 TTTTTTGGTAAGGGAATGGAGGG + Intergenic
918350941 1:183654989-183655011 TGTATTGGAAAGGAGATGCTTGG + Intronic
918922991 1:190739293-190739315 TGTGTTGGTAAGAATATGGAGGG + Intergenic
920174946 1:204094870-204094892 TTCATTGAAAAGGAAAAGGATGG + Intronic
920366449 1:205450554-205450576 GGTCTGAGAAAGGAAATGGAAGG - Intronic
920565803 1:206971939-206971961 AATAATGGAAAGGAAAAGGAAGG - Intergenic
920899510 1:210093008-210093030 GGTATTTGAAAGGGAATGGTGGG + Intronic
920964094 1:210687939-210687961 TGTACTGGACAGGTGATGGATGG + Intronic
921868801 1:220114954-220114976 TGAGTTGGAAAGGTAATAGATGG + Intronic
922030692 1:221794693-221794715 TGAAATGGAAAGGAAACAGAGGG - Intergenic
922048684 1:221970007-221970029 TACAATGGAAAGGAAATGAAAGG - Intergenic
922179293 1:223221235-223221257 TGTTTTGGAAAATAAATGTATGG + Exonic
922268765 1:224013105-224013127 TGTAATGGAAAGGAATGGAATGG + Intergenic
922269267 1:224016530-224016552 TGGAATGGAAAGGAAAGGAATGG + Intergenic
923075500 1:230605452-230605474 TACAATGGAAAGGAAATGAAAGG - Intergenic
923596734 1:235366196-235366218 TGAAGTGGAAAGGAAATTGAGGG - Intergenic
1062962219 10:1581122-1581144 TGTATTGGCGAGGATATAGAGGG - Intronic
1063701505 10:8389043-8389065 GGGAGGGGAAAGGAAATGGATGG + Intergenic
1064430996 10:15269733-15269755 TCCATTGGAGAGGAAAGGGATGG + Intronic
1064529918 10:16297372-16297394 TGGAAGGGAAAGGAAAGGGAAGG + Intergenic
1064825158 10:19390199-19390221 TTTATTGGAAAGGAAAGGGAAGG - Intronic
1065169362 10:23011039-23011061 AGGAATGGAAAGGAAAGGGAAGG - Intronic
1065292565 10:24245633-24245655 TGTCTCGGAAAGGAAAAGGAAGG - Intronic
1065662211 10:28017740-28017762 TGCATAGGAAAATAAATGGATGG + Intergenic
1066521685 10:36227153-36227175 TGTAAGGTAAAGGAAATGGGCGG + Intergenic
1066551019 10:36557221-36557243 AATATTGGAAAGGAGAGGGATGG - Intergenic
1066556934 10:36624571-36624593 GATATTGGAAAGGTAATGGTAGG + Intergenic
1066578607 10:36854491-36854513 AGTAGTTGAAAGTAAATGGAAGG - Intergenic
1066736361 10:38483794-38483816 TGGAATGGAAAGGAAAGGCATGG + Intergenic
1066736367 10:38483834-38483856 TGGAATGGAAAGGAAAGGAATGG + Intergenic
1066736492 10:38484879-38484901 TGGAATGGAAAGGAAAGGAATGG + Intergenic
1066736958 10:38488342-38488364 TCTAATGGAAAGGAATTGAATGG + Intergenic
1066737668 10:38493784-38493806 TGGAATGGAAAGGAAAGGAATGG + Intergenic
1066737909 10:38495508-38495530 TGTATTGGAATGGAATGGAATGG + Intergenic
1066737911 10:38495523-38495545 TGGAATGGAAAGGAATTGCATGG + Intergenic
1066738161 10:38497344-38497366 TGGAATGGAATGGAAATGAATGG + Intergenic
1066738832 10:38502380-38502402 TGGAATGGAAAGGAATGGGATGG + Intergenic
1066738836 10:38502410-38502432 TGTAATGGAAAGGATTTGAATGG + Intergenic
1066738852 10:38502500-38502522 TGGAATGGAAAGGAATGGGATGG + Intergenic
1066738856 10:38502530-38502552 TGTAATGGAAAGGACTTGAATGG + Intergenic
1066738995 10:38503594-38503616 TGGATAGGAATGGAAATGAATGG + Intergenic
1066739199 10:38505179-38505201 AGCATTGGAAAGGAAAGGAATGG + Intergenic
1066739670 10:38508630-38508652 TGTAATGGAATGGAATTGAAGGG + Intergenic
1066740244 10:38513204-38513226 TGGAATGGAATGGAAATGAATGG + Intergenic
1066740365 10:38514187-38514209 TGGATTGGAATGGAATTGAATGG + Intergenic
1066741509 10:38522738-38522760 TGGACTGGAAAGGAAAGGAATGG + Intergenic
1066741738 10:38524401-38524423 TGCAATGGAAAGGAAAGGAATGG + Intergenic
1066743193 10:38578862-38578884 TGTAATGGAATGGAACTGAATGG + Intergenic
1066743230 10:38579122-38579144 TGGAATGGAAAGGAAATAAATGG + Intergenic
1066764360 10:38789213-38789235 TGGAATGGAAAGGAAAGGAAAGG - Intergenic
1066764888 10:38793799-38793821 TGGAATGGAATGGAAATGAATGG - Intergenic
1066765971 10:38803061-38803083 TGGAATGGAAAGGAATCGGATGG - Intergenic
1066765986 10:38803176-38803198 TGGATTGGAAAGGAACAGAATGG - Intergenic
1066766115 10:38804423-38804445 TGGAATGGAAAGGAATTGAATGG - Intergenic
1066766440 10:38807193-38807215 TATAATGGAAAGGAAACGGATGG - Intergenic
1066766549 10:38808117-38808139 TATAATGGAATGGAAACGGATGG - Intergenic
1066766658 10:38809045-38809067 TATAATGGAATGGAAACGGATGG - Intergenic
1066766767 10:38809965-38809987 TATAATGGAATGGAAACGGATGG - Intergenic
1066766790 10:38810100-38810122 TTTAATGGAAAGATAATGGATGG - Intergenic
1066767580 10:38816693-38816715 TGTAATGGAAAGGAATGGAATGG - Intergenic
1066768818 10:38827077-38827099 TGTATTGGAAAGATATTGAATGG + Intergenic
1066769010 10:38828679-38828701 TGGATTGGAAAGGAATGGAATGG + Intergenic
1066769014 10:38828708-38828730 TATAATGGAATGGAAACGGATGG + Intergenic
1066770563 10:38841979-38842001 TGTAATTGAAAGGAATTGAAAGG + Intergenic
1066770578 10:38842109-38842131 TGGAGTGGAATGGAAATGAATGG + Intergenic
1066770814 10:38844112-38844134 TGGAATGGAATGGAAATGAATGG + Intergenic
1066770924 10:38845077-38845099 TGGAATGGAATGGAATTGGATGG + Intergenic
1066771083 10:38846392-38846414 TGGAATGGAATGGAATTGGATGG + Intergenic
1066771161 10:38847047-38847069 TGGAATGGAAAGGAAAGGAATGG + Intergenic
1066771165 10:38847067-38847089 TGGAATGGAAAGGAAAGGAATGG + Intergenic
1066771878 10:38852927-38852949 TGGATTGGAATGGAATTGAATGG + Intergenic
1066772985 10:38861967-38861989 TGGAATGGAAAGGAAAGGAATGG + Intergenic
1066774564 10:38874809-38874831 TGGAATGGAATGGAAATGAATGG + Intergenic
1066774630 10:38875319-38875341 TGGAATGGAAAGGAAAAGAACGG + Intergenic
1066775573 10:38883249-38883271 TGGATTGGAATGGACATGAATGG + Intergenic
1066775884 10:38885817-38885839 TGGAATGGAAAGGAAATGATTGG + Intergenic
1066776141 10:38887979-38888001 TGTATTGGAATGGAAAGGATTGG + Intergenic
1066776775 10:38893211-38893233 TGGAATGGAAAGGAATAGGATGG + Intergenic
1066776846 10:38893756-38893778 TGGAATGGAATGGAATTGGATGG + Intergenic
1066777018 10:38895270-38895292 TAGATTGGAATGGAAACGGATGG + Intergenic
1066777637 10:38900313-38900335 TGGAATGGAAAGGAAAAGAATGG + Intergenic
1066777685 10:38900748-38900770 TGTAATGGAATGGAAAGGAATGG + Intergenic
1066778060 10:38903924-38903946 TAGAATGGAATGGAAATGGATGG + Intergenic
1066937613 10:41858084-41858106 TGTAATGGAATGGAAAGGAATGG + Intergenic
1066938109 10:41861284-41861306 TGGAATGGAAAGGAAAGGAATGG + Intergenic
1066938228 10:41862062-41862084 TGGAATGGAAAGGAAAGGAAAGG + Intergenic
1066938500 10:41863900-41863922 TGAAATGGAATGGAAATGAAAGG + Intergenic
1066938553 10:41864250-41864272 TGGAATGGAAAGGAAATGAATGG + Intergenic
1066938689 10:41865070-41865092 TGGAATGGAAAGGAAAGGAATGG + Intergenic
1066938866 10:41866217-41866239 TGGAATGGAAAGGAAAGGAATGG + Intergenic
1066939153 10:41868060-41868082 TGGAATGGAAAGTAAATGAATGG + Intergenic
1066939211 10:41868449-41868471 TGTAATGGAAAGGAATGGAATGG + Intergenic
1066939471 10:41870047-41870069 TGTAATGGAAAGGAATGGAATGG + Intergenic
1066939927 10:41872985-41873007 TGGAATGGAAAGTAAATGAATGG + Intergenic
1066939982 10:41873364-41873386 TGTAATGGAAAGGAATGGAATGG + Intergenic
1066940192 10:41874719-41874741 TGGAATGGGAAGGAAATGAATGG + Intergenic
1066940316 10:41875459-41875481 TGGAATGGAATGGAAATGAATGG + Intergenic
1066940392 10:41875923-41875945 TGTAATGGAAAGGAATGGAATGG + Intergenic
1066940835 10:41878818-41878840 AGGAATGGAAAGGAAATGAATGG + Intergenic
1066940988 10:41879739-41879761 TGGAATGGAAAGGAAAGGAATGG + Intergenic
1066941203 10:41881101-41881123 TGGATTGGAAAGGAATGGAATGG + Intergenic
1066941206 10:41881116-41881138 TGGAATGGAAAGGAAAGGAATGG + Intergenic
1066941771 10:41884548-41884570 TGTATTGGAATGGAAAGGAATGG + Intergenic
1066942008 10:41886085-41886107 TGGAATGGAATGGAAATGAATGG + Intergenic
1066942568 10:41889723-41889745 TGGAATGGAATGGAAATGCATGG + Intergenic
1066942648 10:41890223-41890245 TGGAATGGAAAGGAAAGGAATGG + Intergenic
1066942794 10:41891128-41891150 TGGAATGGAATGGAAATGAATGG + Intergenic
1066942817 10:41891253-41891275 TGGAATGGAATGGAAATGAATGG + Intergenic
1066942835 10:41891363-41891385 TGGAATGGAATGGAAATGAATGG + Intergenic
1066943349 10:41894675-41894697 TGGAATGGAAAGGAAATGAATGG + Intergenic
1066943569 10:41896074-41896096 TGGAATGGAATGGAAATGAATGG + Intergenic
1066943617 10:41896359-41896381 TGGAATGGAAAGGAAAGGAATGG + Intergenic
1066943724 10:41897008-41897030 TGGATTGGAAAGGAATGGAAAGG + Intergenic
1066944048 10:41899177-41899199 TGGATTGGAATGGAAATGAATGG + Intergenic
1066944080 10:41899362-41899384 TGGAATGGAATGGAAATGAATGG + Intergenic
1066944319 10:41900937-41900959 TGGAATGGAAAGGAAAGGAATGG + Intergenic
1066944375 10:41901312-41901334 TGGAATGGAAAGGAATTGAATGG + Intergenic
1066944558 10:41902439-41902461 TGGAATGGAATGGAAATGAATGG + Intergenic
1066944694 10:41903309-41903331 TGGAATGGAATGGAAATGAATGG + Intergenic
1066944938 10:41904863-41904885 TGGAATGGAAAGGAAAGGCATGG + Intergenic
1066945061 10:41905657-41905679 TGGAATGGAAAGGAAATGAATGG + Intergenic
1066945467 10:41908203-41908225 TGGAATGGAAAGGAAATGAATGG + Intergenic
1066945669 10:41909513-41909535 TGGAATGGAATGGAAATGAATGG + Intergenic
1066945711 10:41909778-41909800 TGAAATGGAAAGGAAAGGAATGG + Intergenic
1066945877 10:41910806-41910828 TGGAATGGAAAGGAAACGAATGG + Intergenic
1066946276 10:41913322-41913344 TGGAATGGAATGGAAATGAATGG + Intergenic
1066946382 10:41913992-41914014 TGTAATGGAAAGGAATGGAATGG + Intergenic
1066946385 10:41914007-41914029 TGGAATGGAAAGGAAAGGAATGG + Intergenic
1066946524 10:41914890-41914912 TGGAATGGAATGGAAATGAATGG + Intergenic
1066946669 10:41915754-41915776 TGGAATGGAAAGGAAAGGAAAGG + Intergenic
1066968703 10:42295776-42295798 TGGAATGGAATGGAAATGAATGG - Intergenic
1066970441 10:42308182-42308204 TGGAATGGAAAGGAAAAGAATGG - Intergenic
1066970940 10:42311819-42311841 TGGATTGGAATGGAATTGAATGG - Intergenic
1066971025 10:42312386-42312408 TGTAATGGAATGGAAAGGAATGG - Intergenic
1066971762 10:42317807-42317829 TGCATTGGAATGGAATTGAATGG - Intergenic
1066971925 10:42319184-42319206 TGGATTGGAAAGGACACGAATGG - Intergenic
1069681655 10:70289999-70290021 TGCAGGGGAATGGAAATGGACGG - Intergenic
1069693807 10:70372317-70372339 TATGTAGGAAAGAAAATGGAAGG - Intronic
1070503522 10:77093425-77093447 TGTATGGAAAACAAAATGGAGGG - Intronic
1070533512 10:77358456-77358478 TGTATTAGAAGGGAGGTGGAGGG - Intronic
1071719450 10:88128829-88128851 AGTTTTGGAAAGGAAATGTCTGG + Intergenic
1072780248 10:98245884-98245906 TCCATTTGAAAGGAAATGCAGGG + Intergenic
1073804628 10:107083968-107083990 TGTGTTAGGTAGGAAATGGAAGG - Intronic
1075356334 10:121780393-121780415 GGCAATGGAGAGGAAATGGATGG - Intronic
1076022893 10:127089113-127089135 TGTATGGGCAGGGAAAAGGATGG - Intronic
1076615399 10:131751302-131751324 AGTATTTGGAAGGAAATGTATGG - Intergenic
1077129973 11:966640-966662 TGCATTGGTGAGGAAGTGGAAGG + Intronic
1078210565 11:9266144-9266166 TCTATGGGAAAGGAAATCGGAGG - Intergenic
1078372359 11:10759455-10759477 TGTATTCAAGAGAAAATGGAAGG + Intronic
1080111737 11:28575602-28575624 TGGAATGGAAAGGAAAAGGAAGG - Intergenic
1080348256 11:31350849-31350871 TGTATTTGAAATGAAAGGTATGG - Intronic
1080453580 11:32398733-32398755 TGTATTGCAGATGAAATGAAGGG + Intronic
1080575771 11:33597784-33597806 TGTATGGGACAGCAAAGGGAAGG + Intronic
1080739759 11:35052764-35052786 TTCATGGGCAAGGAAATGGAAGG + Intergenic
1081137600 11:39458424-39458446 TCCATTGGAAAGGAAAGGGATGG - Intergenic
1081305416 11:41505839-41505861 TGATTTTGAAAGGAAAAGGAGGG - Intergenic
1081718188 11:45266484-45266506 TGTATTTGAGAGGGAGTGGAAGG - Intronic
1082649083 11:55764969-55764991 AGTAAAGGAAAGGGAATGGAAGG + Intergenic
1082737492 11:56873018-56873040 TGGATTTGAAAGAAAATGGTTGG - Intergenic
1083254786 11:61489450-61489472 GGAAATGGAAATGAAATGGAAGG + Intronic
1083550193 11:63582564-63582586 TGTTTTGGGAGGGAAGTGGAGGG - Intronic
1084460220 11:69292986-69293008 TGTAGTGGAGGGGAATTGGAGGG - Intergenic
1085199113 11:74690982-74691004 TCTATTGGAATGGGAAGGGAAGG + Intergenic
1085587708 11:77726796-77726818 GGAATTGGAAAGGGAAAGGAGGG - Intronic
1085762535 11:79254776-79254798 TGTACAGGAAAGGATCTGGAAGG + Intronic
1086257192 11:84891255-84891277 TGTATTAGAAAAAGAATGGAAGG + Intronic
1086511874 11:87567058-87567080 TGAATTGGAAACAAAATGGGAGG + Intergenic
1087217192 11:95506795-95506817 TGCAGTGGGAAGGAAATGCAAGG + Intergenic
1088171315 11:107000397-107000419 TGTAATGGAACAGAGATGGAGGG - Intronic
1088287231 11:108201488-108201510 TGTATCAGAAAGGAAAGGAATGG + Intronic
1088724842 11:112624996-112625018 TGTACAGGTAAGGAAATGCAAGG - Intergenic
1088953177 11:114590632-114590654 TGTATCAGAAAGGAAAGGAATGG + Intronic
1090199766 11:124845832-124845854 TGTAGGGGAAAGGCAAGGGAAGG - Intergenic
1090886929 11:130885512-130885534 TGTCTTAGAAAAGAAATGAAGGG - Intronic
1090925203 11:131243564-131243586 TGACTTGGAAAGAAAATGGGAGG - Intergenic
1091151329 11:133331023-133331045 TGTATTGGAAAGCAGATAGAGGG - Intronic
1091259278 11:134221538-134221560 TGTATTAGAAAAGAATGGGAAGG - Intronic
1091667031 12:2426495-2426517 TGTATTTGAAAGGCAGTAGAAGG + Intronic
1092552392 12:9517364-9517386 TTTCTTGGAAAAGAAAGGGAAGG - Intergenic
1093202774 12:16209555-16209577 TGTGTTAAAAAGCAAATGGATGG + Intronic
1093410822 12:18864699-18864721 TGTAGTGGGAAGAAAATGGAAGG - Intergenic
1093787003 12:23204166-23204188 TGTATTGAAAAGACAATGGATGG + Intergenic
1094001504 12:25699984-25700006 CGTATTGGAAAGGAGAAGGCAGG + Intergenic
1094292352 12:28866145-28866167 TGGTTTGTAAGGGAAATGGATGG + Intergenic
1094438711 12:30451346-30451368 TTTATTGGAAACCAAATGTAAGG - Intergenic
1094519728 12:31173247-31173269 TTTCTTGGAAAAGAAAGGGAAGG + Intergenic
1096205607 12:49719161-49719183 TGCATTTGAAATGAAAAGGAGGG + Intronic
1098566081 12:71938013-71938035 TGTATTGCAAAGGAAAGGTAAGG - Intergenic
1099118141 12:78652847-78652869 TGTATTGCAAATGAAAATGATGG + Intergenic
1100034862 12:90237834-90237856 TGTAATGGATAGGGGATGGATGG + Intergenic
1101151322 12:101885212-101885234 TGTATTGGAAAAAGAATGCAAGG - Intronic
1101209874 12:102525061-102525083 TGTTGTGGAGAGGAGATGGAGGG + Intergenic
1101257548 12:102993390-102993412 TGTATTGGAAAGACATGGGAAGG + Intergenic
1101371207 12:104132697-104132719 AGAATGGGAAAGGAAAGGGAGGG + Intronic
1103365816 12:120382392-120382414 TGGGTTGGAGAGGAAAGGGAAGG + Intergenic
1105342644 13:19542261-19542283 TGACTTGGGAGGGAAATGGAAGG - Intergenic
1105491840 13:20895660-20895682 TGCATAGAAACGGAAATGGAAGG - Intronic
1106464985 13:30005412-30005434 TGGATTGGAGAGTGAATGGATGG + Intergenic
1106574951 13:30966198-30966220 TGGGGTGGAATGGAAATGGAAGG - Intronic
1107170039 13:37330554-37330576 GGAATTGGAAAGGGAATGGGGGG - Intergenic
1107215806 13:37917098-37917120 TGAACTGGAAAGGAAAGGGCAGG + Intergenic
1107474672 13:40724181-40724203 TGACTTGGGAGGGAAATGGAAGG - Intergenic
1107802324 13:44120249-44120271 TGTAAAGGAAAGGAAAGGAAAGG - Intergenic
1108090221 13:46841699-46841721 TGAAATGGAAAAGAAAAGGAAGG - Intronic
1108847454 13:54694716-54694738 TGTATTAGAAAGGAAGAGAATGG - Intergenic
1109762880 13:66853406-66853428 GGTCTGAGAAAGGAAATGGATGG - Intronic
1110880171 13:80561947-80561969 TGTTGTGAAAAGTAAATGGAGGG + Intergenic
1111401552 13:87743092-87743114 TGCTTTGGAAAGTAAAAGGAAGG + Intergenic
1111745470 13:92263420-92263442 TGTATTGGAGAGGAAAAAGAAGG - Intronic
1112484805 13:99810623-99810645 TGTATTCTAAGGGTAATGGAAGG + Intronic
1113197376 13:107824172-107824194 TTTAGTGGAAAGCAGATGGATGG - Intronic
1113417204 13:110137646-110137668 TGTGTTGGAAAGAAAGTGGATGG - Intergenic
1113997323 14:16099134-16099156 TGGATTGGAATGGAATGGGATGG - Intergenic
1113997473 14:16100253-16100275 TGGATTGGAAAGGAATGGAATGG - Intergenic
1113997752 14:16102185-16102207 TGGAATGGAAAGGAATTGAATGG - Intergenic
1113998190 14:16105234-16105256 TGAAGTGGAATGGAATTGGATGG - Intergenic
1114198000 14:20495758-20495780 GGTAAAGGAAAGGAAAAGGAAGG - Intergenic
1114224441 14:20725102-20725124 AATATTGGAAGGGTAATGGAAGG - Intergenic
1114866461 14:26599795-26599817 TGTAGTGGAAAGTATAGGGAAGG - Intergenic
1115056985 14:29140487-29140509 TGTAATGCAAAGTAACTGGAAGG + Intergenic
1115057137 14:29142524-29142546 TTTTTTGGAAAGGAAATCTAAGG + Intergenic
1115805170 14:37042991-37043013 TCAATTGGAAAGGAAGTGGTTGG - Intronic
1116201240 14:41799921-41799943 TGGAGGGGAAAGGAAAGGGAAGG + Intronic
1116253183 14:42514500-42514522 TATTTTGAAAAGTAAATGGAAGG - Intergenic
1116328823 14:43570082-43570104 TGTATTGGAAGATAAATGGGAGG - Intergenic
1116945847 14:50834545-50834567 AGTATAGGAAAGGGAAGGGAAGG + Intergenic
1117074810 14:52091224-52091246 TGTCTTCAGAAGGAAATGGAGGG - Intergenic
1117466820 14:56002089-56002111 TGTATTCCAAAGGAAGGGGAAGG - Intergenic
1117651147 14:57906951-57906973 GTTATTGGAAAGCAAAGGGAAGG - Intronic
1118180387 14:63486640-63486662 AGGATAGGAAAGGAAATGGGAGG - Intronic
1118233026 14:63971734-63971756 TGTATTGTAAAGTAAGTGAAAGG - Intronic
1119074425 14:71621579-71621601 TGAATTGGATATGAAATGGGAGG - Intronic
1119706788 14:76788079-76788101 TTTTCTAGAAAGGAAATGGAAGG + Exonic
1119915772 14:78400254-78400276 TGTATTAGTAATGGAATGGATGG - Intronic
1120455603 14:84726220-84726242 TGAATTGGAATGGAAAATGATGG + Intergenic
1120541447 14:85755951-85755973 TCTAGAGAAAAGGAAATGGAAGG + Intergenic
1120918276 14:89729781-89729803 AGTATAGGAAAGGAAATTGTTGG - Intergenic
1123159781 14:106267329-106267351 TGTATTGCAATTGAAATGTATGG + Intergenic
1202873774 14_GL000225v1_random:189759-189781 TGGATTGGAATGGAATTGAATGG + Intergenic
1202874859 14_GL000225v1_random:197923-197945 TGGAATGGAAAGGAATTGAAAGG + Intergenic
1123228993 15:17081719-17081741 TGGATTGGAAAGGAACGGAATGG + Intergenic
1125111526 15:36039916-36039938 TGTATTTGTAGGGAAAAGGAAGG + Intergenic
1125403477 15:39329001-39329023 TGTTTTGGAAATCAAATGGCAGG - Intergenic
1125405081 15:39343995-39344017 TGTATGAGAAAAGAAAAGGAAGG - Intergenic
1127189985 15:56519111-56519133 AATATTGGAAAGGAAAGGAAAGG + Intergenic
1130555601 15:84920440-84920462 TGTCTTGGAAAGGAAAGGAAAGG + Intronic
1130785766 15:87094366-87094388 TGTCTTATAAAGGAACTGGAAGG + Intergenic
1133317320 16:4892758-4892780 TGTATAGGAAAGGAGGTGGGGGG + Intronic
1134442108 16:14304352-14304374 TGGATTGGAAAGGAATTAGTAGG + Intergenic
1134515165 16:14881336-14881358 TGTATGAGAAAAGAAATTGATGG + Intronic
1134702840 16:16279981-16280003 TGTATGAGAAAAGAAATTGATGG + Intronic
1134758897 16:16695657-16695679 TGTAATTCAAAGGAAATGAAAGG - Intergenic
1134964703 16:18432134-18432156 TGTATGAGAAAAGAAATTGATGG - Intronic
1134968990 16:18514669-18514691 TGTATGAGAAAAGAAATTGATGG - Intronic
1134987178 16:18663527-18663549 TGTAATTCAAAGGAAATGAAAGG + Intergenic
1135460868 16:22641689-22641711 ACCATTGGAAATGAAATGGATGG - Intergenic
1135659749 16:24285773-24285795 TGTATTGAAAAGCAACTGGCAGG - Intronic
1135769662 16:25207699-25207721 TGTATTGGTTAGCAATTGGATGG - Intergenic
1136669978 16:31847514-31847536 TTTATTAGGAAGGAAATGGAGGG + Intergenic
1136968763 16:34947291-34947313 TGGAATGGAATGGAAATGAATGG - Intergenic
1136987444 16:35122420-35122442 TGTATTAAGAAGGAAATGGAGGG + Intergenic
1137259851 16:46817115-46817137 TGAAAAGAAAAGGAAATGGAGGG + Intronic
1137384894 16:48032336-48032358 TTTATAGCAAATGAAATGGATGG - Intergenic
1138544625 16:57708741-57708763 AGTATTGGCAAGGATGTGGATGG - Intronic
1138835408 16:60428863-60428885 TGTACTGGAAGGGAAAGAGAAGG + Intergenic
1139836197 16:69840568-69840590 TGTATTGGGAAGGAAAATAATGG - Intronic
1140214146 16:72993956-72993978 TGTTTGGAGAAGGAAATGGAGGG - Intronic
1140383584 16:74513115-74513137 TTTATCTTAAAGGAAATGGAAGG + Intronic
1140976426 16:80064086-80064108 TTTATTGAAAAGGAAAAGAAAGG + Intergenic
1141323185 16:83030995-83031017 TTCAGAGGAAAGGAAATGGATGG + Intronic
1141323358 16:83032860-83032882 TTCAGAGGAAAGGAAATGGATGG + Intronic
1141539483 16:84708493-84708515 TCTAGTGCAAAGGCAATGGATGG - Intronic
1142638905 17:1273748-1273770 TGTTTTGGAGAGTAAATGGGAGG + Intergenic
1143722257 17:8821291-8821313 TTTACTGGAGAGGAAATGGAAGG - Intronic
1143737587 17:8923906-8923928 TGTCTTGAAAAGGGAAGGGAAGG - Intronic
1143737633 17:8924080-8924102 TGTCTTGAAAAGGAAAGGGAAGG - Intronic
1143999237 17:11037224-11037246 TGTATTGGAGGGGAAAGGCAGGG + Intergenic
1144863006 17:18317545-18317567 TGTATTGGGAAGGAGAGCGATGG + Exonic
1145328777 17:21853443-21853465 TGGAATGGAAAGGAAAGGAATGG + Intergenic
1145329438 17:21858841-21858863 TGGAATGGAAAGGAAAAGAATGG + Intergenic
1145329698 17:21861071-21861093 TGGAATGGAATGGAAATGAATGG + Intergenic
1145331082 17:21872740-21872762 TGCAATGGAAAGGAAGAGGATGG + Intergenic
1145332010 17:21880443-21880465 TGGATTGGAAAGGAATGGAATGG + Intergenic
1145332800 17:21886988-21887010 TGTAATGGAAAGGAATAGAATGG + Intergenic
1145333081 17:21889222-21889244 TGGAATGGAAAGGAAAGGAATGG + Intergenic
1145334551 17:21901345-21901367 TTTAATGGAATGGAAATGAATGG + Intergenic
1145334852 17:21903637-21903659 TATAATGGAATGGAATTGGAGGG + Intergenic
1145335133 17:21906015-21906037 TGGAATGGAATGGAATTGGACGG + Intergenic
1145335139 17:21906050-21906072 TGGATTGGAAAGGAATAGAATGG + Intergenic
1145335306 17:21907465-21907487 TGTAGTGGAAAGACAATGAATGG + Intergenic
1145336074 17:21913708-21913730 TGGATTGGAAAGGAATGGAATGG + Intergenic
1145336165 17:21914552-21914574 TCGAATGGAAAGGAAATGAATGG + Intergenic
1145336401 17:21916529-21916551 TGTAATGGAATGGAAAGGAAAGG + Intergenic
1145337083 17:21922168-21922190 TGGAATGGAAAGGAAAAGAATGG + Intergenic
1145339214 17:21939483-21939505 TGTAATGGAAAGGAGAAGAATGG + Intergenic
1145339343 17:21940617-21940639 TGTAATGGAAAAGAAATTAATGG + Intergenic
1145339853 17:21944762-21944784 TGGATTGGAACGGAATTGCATGG + Intergenic
1145340011 17:21946100-21946122 TGTAATGGAAAGGAATGGAATGG + Intergenic
1145340228 17:21947940-21947962 TGCATTGGAATGGAAATGAACGG + Intergenic
1145341081 17:21955179-21955201 TGGACTGGAATGGAAATGAATGG + Intergenic
1145342145 17:21964205-21964227 TGGAATGGAAAGGAATTGAATGG + Intergenic
1145343881 17:21976335-21976357 TGGATTGGAATGGAAAGGAATGG + Intergenic
1145344290 17:21979151-21979173 TGGATTGGAAAGGAATGGAACGG + Intergenic
1145344675 17:21981522-21981544 TGTAATGGAATGGAATTGAATGG + Intergenic
1145344689 17:21981672-21981694 TGTAATGGAATGGAATTGAATGG + Intergenic
1145344754 17:21982186-21982208 TGTAAAGGAAAGGAATTGAATGG + Intergenic
1145345455 17:21987197-21987219 TGTAATGGAATGGAATTGAATGG + Intergenic
1145345492 17:21987491-21987513 TGGAATGGAAAGGAAAGGAATGG + Intergenic
1145345524 17:21987736-21987758 TGTAATGGAATGGAATTGAAAGG + Intergenic
1145345553 17:21988013-21988035 TGTAATGGAATGGAATTGAATGG + Intergenic
1145345598 17:21988376-21988398 TGGAATGGAAAGGAAAGGAATGG + Intergenic
1145346134 17:21991857-21991879 TGTAATGGAAAGGAATGGAATGG + Intergenic
1145622051 17:25735830-25735852 AGGAATGGAAAGGAAAGGGAGGG + Intergenic
1145695489 17:26784183-26784205 TGGAATGGAATGGAATTGGATGG + Intergenic
1145698705 17:26811051-26811073 TGGAATGGAAAGGAAAGGAAAGG + Intergenic
1145699561 17:26818200-26818222 TGTAATGGAATGGAATTGAATGG + Intergenic
1145701215 17:26831774-26831796 TGGATTGGAATGGAATTGAATGG + Intergenic
1145702265 17:26840627-26840649 TCTATTGGAAAGGAATCGAATGG + Intergenic
1145704395 17:26858725-26858747 TGGAATGGAAAGGAAAAGAATGG + Intergenic
1145706764 17:26878316-26878338 TGGATTGGAATGGAATGGGAAGG + Intergenic
1145872549 17:28287203-28287225 TGAATTGAAAAGGAAAAGTAAGG + Intergenic
1146313206 17:31786926-31786948 TGGATTTGAAAGGACATGGTGGG - Intergenic
1146691372 17:34878426-34878448 TGGTTTGGAGAGGAAAGGGATGG - Intergenic
1148087013 17:45000304-45000326 TTTATTGATAAGGAAATGAAGGG - Intergenic
1148436115 17:47686970-47686992 AGTGCTGGGAAGGAAATGGATGG - Intergenic
1149219237 17:54396571-54396593 TGTTTTAGGATGGAAATGGAGGG + Intergenic
1149313569 17:55419522-55419544 TAAATTGCAAAGGAACTGGAGGG - Intronic
1149373224 17:56017464-56017486 TGTGTAGGCAAGGAAATGCATGG - Intergenic
1151142816 17:72011211-72011233 TGTGTTGGAAAGCCAGTGGAAGG - Intergenic
1203175634 17_KI270729v1_random:10980-11002 TGTATTGGAATGGAATGGAATGG - Intergenic
1203175935 17_KI270729v1_random:13084-13106 TGGAATGGAAAGGAAAGGAAAGG - Intergenic
1203176857 17_KI270729v1_random:25233-25255 TGGATTGGAATGGAATTGAATGG + Intergenic
1203177293 17_KI270729v1_random:28333-28355 TGTAATGGAATGGAATTGAATGG + Intergenic
1203177537 17_KI270729v1_random:30238-30260 TGGAATGGAATGGAAATGAATGG + Intergenic
1203177710 17_KI270729v1_random:31601-31623 TGTACTGGAAAGGAATGGAATGG + Intergenic
1203177869 17_KI270729v1_random:32765-32787 TGGATTGGAAAGGAAGGGAATGG + Intergenic
1203178363 17_KI270729v1_random:36680-36702 TGTACTGGAAAGGAATGGAATGG + Intergenic
1203178606 17_KI270729v1_random:38573-38595 TGGATTGGAATGGAAATGAATGG + Intergenic
1203178977 17_KI270729v1_random:41431-41453 TGGAATGGAATGGAAATGAATGG + Intergenic
1203179178 17_KI270729v1_random:42966-42988 TGGATTGGAAAGGAATGGAATGG + Intergenic
1203179184 17_KI270729v1_random:42996-43018 TGGATTGGAAAGGAATGGAATGG + Intergenic
1203179193 17_KI270729v1_random:43066-43088 TGTAATGGAATGGAAAAGAATGG + Intergenic
1203179672 17_KI270729v1_random:46860-46882 TGGAATGGAAAGGAATTGAATGG + Intergenic
1203179757 17_KI270729v1_random:47425-47447 TGGAATGGAATGGAAATGAATGG + Intergenic
1203180670 17_KI270729v1_random:54301-54323 TGCATTGGAAAGGACTTGAATGG + Intergenic
1203180876 17_KI270729v1_random:55869-55891 TGCATTGGAAAGGACTTGAATGG + Intergenic
1203181005 17_KI270729v1_random:56753-56775 TGGAATGGAACGGAAAAGGATGG + Intergenic
1203193398 17_KI270729v1_random:209943-209965 TTGATTGGAATGGAAATGAATGG + Intergenic
1203193982 17_KI270729v1_random:214878-214900 TGGAATGGAAAGGAATTGAATGG + Intergenic
1203194297 17_KI270729v1_random:217542-217564 TTTAATGGAATGGAAATGAATGG + Intergenic
1203194717 17_KI270729v1_random:220939-220961 TCTAATGGAAAGGAATTGAATGG + Intergenic
1203195116 17_KI270729v1_random:224431-224453 TGGATTGGAAAGGAATGGAATGG + Intergenic
1203195476 17_KI270729v1_random:227455-227477 TGTATTGGAAATGAACTGAATGG + Intergenic
1203195715 17_KI270729v1_random:229590-229612 TGTAATGGAAAGGAATAGAATGG + Intergenic
1203195936 17_KI270729v1_random:231486-231508 TGTAATGGAAAGGAATAGAATGG + Intergenic
1203195939 17_KI270729v1_random:231501-231523 TAGAATGGAATGGAAATGGATGG + Intergenic
1203196590 17_KI270729v1_random:237754-237776 TGGAATGGAATGGAATTGGATGG + Intergenic
1203197951 17_KI270729v1_random:249435-249457 TGTATTGGAATGGAATGGAATGG + Intergenic
1203198417 17_KI270729v1_random:253405-253427 TGGATTTGAAAGGAAACGAAAGG + Intergenic
1203199769 17_KI270729v1_random:264932-264954 TGGAATGGAAAGGAATTGAATGG + Intergenic
1203200312 17_KI270729v1_random:269428-269450 TGGATTGGAATGGAATTGAATGG + Intergenic
1203202761 17_KI270730v1_random:9373-9395 TTGATTGGAATGGAAATGAATGG + Intergenic
1203203346 17_KI270730v1_random:14308-14330 TGGAATGGAAAGGAATTGAATGG + Intergenic
1203203659 17_KI270730v1_random:16968-16990 TTTAATGGAATGGAAATGAATGG + Intergenic
1203204072 17_KI270730v1_random:20335-20357 TCTAATGGAAAGGAATTGAATGG + Intergenic
1203204470 17_KI270730v1_random:23822-23844 TGGATTGGAAAGGAATGGAATGG + Intergenic
1203204954 17_KI270730v1_random:27847-27869 TGTATTGGAAATGAACTGAATGG + Intergenic
1203205188 17_KI270730v1_random:29952-29974 TGTAATGGAAAGGAATAGAATGG + Intergenic
1203205406 17_KI270730v1_random:31844-31866 TGTAATGGAAAGGAATAGAATGG + Intergenic
1203205409 17_KI270730v1_random:31859-31881 TAGAATGGAATGGAAATGGATGG + Intergenic
1203206195 17_KI270730v1_random:38520-38542 TGGAATGGAATGGAATTGGATGG + Intergenic
1203207555 17_KI270730v1_random:50189-50211 TGTATTGGAATGGAATGGAATGG + Intergenic
1203208022 17_KI270730v1_random:54164-54186 TGGATTTGAAAGGAAACGAAAGG + Intergenic
1203209364 17_KI270730v1_random:65641-65663 TGGAATGGAAAGGAATTGAATGG + Intergenic
1203209906 17_KI270730v1_random:70139-70161 TGGATTGGAATGGAATTGAATGG + Intergenic
1203212078 17_KI270730v1_random:87012-87034 TGCATTGGAATGGAAATGAATGG + Intergenic
1203212397 17_KI270730v1_random:91117-91139 TGCAATGGAATGGAAATGAATGG + Intergenic
1154414424 18:14168230-14168252 TTTATTGCAAAGGAAATGTAGGG - Intergenic
1155307865 18:24496710-24496732 TGTTATGAAAAGGAACTGGATGG - Intergenic
1155558068 18:27043682-27043704 TGGATTGGAAGAGAAATTGACGG - Intronic
1155857586 18:30852512-30852534 TATATGGGAAAGGAAATGAGTGG - Intergenic
1157508093 18:48245841-48245863 TGTATTTGAAAGGATTAGGAAGG + Intronic
1157922040 18:51723089-51723111 TGTATTGCAAAGGTCAGGGAAGG + Intergenic
1157959029 18:52131902-52131924 GGTATTGGAAAAGAAGTGCAGGG + Intergenic
1158128597 18:54128314-54128336 TGTATTGGGAAGGGACTGGATGG - Intergenic
1158375758 18:56862840-56862862 TTTATTGGAAATCAATTGGAAGG - Intronic
1158669158 18:59459215-59459237 TGTATTGAAAAGGTGATGTAAGG - Intronic
1159498967 18:69243467-69243489 CACACTGGAAAGGAAATGGAGGG - Intergenic
1160055775 18:75478675-75478697 TGTCATGGTAAGGAAATGAATGG - Intergenic
1160442251 18:78901807-78901829 AGAATTGGAAAATAAATGGAGGG - Intergenic
1161635832 19:5388567-5388589 TGTCTTGGAAAAGGAAGGGAAGG + Intergenic
1162102663 19:8349396-8349418 TCTATTGTAAGGGAAAGGGAGGG - Intronic
1164286698 19:23823245-23823267 TGTATTGGGGAGGAAATGGGAGG - Intronic
1165021403 19:32927180-32927202 TGTATGGGAAAGTGGATGGATGG - Intronic
1165496726 19:36157065-36157087 TACAATGGAAAGGAAATGAAAGG + Intergenic
1165581382 19:36867918-36867940 TGTATTGAAAATGAAAAGGTAGG - Intronic
1167841753 19:52127410-52127432 AATTTTGGAAAGAAAATGGAGGG + Intronic
1168451821 19:56472385-56472407 TGAGTTGAAAAGGAAAAGGAAGG - Intronic
925674261 2:6343612-6343634 TGTTTTGAAAAACAAATGGAAGG + Intergenic
926264585 2:11303723-11303745 TGAATTGTAAAGGGAATGGGAGG - Intronic
926629099 2:15120601-15120623 GGTAATGGAAAGGAAATGACTGG - Intergenic
926638778 2:15212638-15212660 TGTAGTGGAAGGGAACTGGTGGG + Intronic
926690837 2:15732241-15732263 TGTGTTGGAGAGGGAATGAATGG + Intronic
926694338 2:15760622-15760644 TGTAAAGGAAAGGAAACCGAGGG - Intergenic
927313306 2:21654160-21654182 TGTATGTGAAGGGAAATGTAAGG + Intergenic
927959884 2:27234564-27234586 TGTCTTGGAAACGAAGGGGAAGG - Exonic
927968062 2:27284324-27284346 TGTTTTGGAAAGGAATGGGCTGG + Intronic
928137561 2:28699648-28699670 TGTAGTGGGAAGGAGATTGATGG - Intergenic
928196051 2:29217502-29217524 TGTTGTGGAAACGAAATGCATGG - Intronic
928492084 2:31794873-31794895 TGAATAAGAAAGGAAATGGTAGG - Intergenic
928572678 2:32624702-32624724 TGAATATGAAAGGAGATGGAAGG - Intergenic
929351830 2:40965624-40965646 AGGATGGGAAAGGAAGTGGATGG - Intergenic
929472183 2:42205112-42205134 TTTATTGGAAATAAAATGAAGGG + Intronic
929813741 2:45214014-45214036 TGTAATGGAAAGACAAAGGAAGG - Intergenic
930139792 2:47939825-47939847 GGTCTTGGAAAGGTAAAGGAGGG - Intergenic
930203151 2:48563388-48563410 TGTCTTGGAAAGCAAAGGCAGGG + Intronic
930237734 2:48903894-48903916 AGTATATCAAAGGAAATGGAAGG - Intergenic
930678259 2:54228073-54228095 TCTCTTTGAAAGGAAATGGAAGG + Intronic
931271739 2:60709448-60709470 TGGATAGGAAAAGAAGTGGAAGG - Intergenic
933108367 2:78362424-78362446 TGTGTTGGGAAGGAAATGTTCGG + Intergenic
934192590 2:89813307-89813329 TGGAATGGAATGGAATTGGATGG - Intergenic
934193418 2:89819956-89819978 TGGATTGGAATGGAAATGAATGG - Intergenic
934193956 2:89824405-89824427 TGGAATGGAATGGAAATGAATGG - Intergenic
934194036 2:89824980-89825002 TGGAATGGAATGGAAATGAATGG - Intergenic
934194052 2:89825090-89825112 TGGAATGGAAAGGAAAGGAATGG - Intergenic
934194637 2:89829163-89829185 TGGAATGGAAAGGAATTGAATGG - Intergenic
934194785 2:89830103-89830125 TGCAATGGAATGGAAATGAATGG - Intergenic
934195644 2:89835827-89835849 TGTAATGGAATGGAATTGAAAGG + Intergenic
934947538 2:98552767-98552789 TGTACTGGAAAGGATAAGAATGG - Exonic
936976028 2:118223664-118223686 GGTTTTGGAAAGGAAATTGGGGG + Intergenic
937383831 2:121407271-121407293 TGGATGGCAAAGCAAATGGATGG + Intronic
938008386 2:127808368-127808390 AGTATTGGAAAGGGCATGTATGG - Intronic
938640542 2:133273623-133273645 TGTATGGGAAAGGAAAATTAAGG + Intronic
938647150 2:133343616-133343638 TGTATTGGGTGGTAAATGGATGG - Intronic
940851005 2:158688239-158688261 TGTGTTAGTAAGGAAAAGGAGGG + Intergenic
941684649 2:168436142-168436164 TGACGTGGAAATGAAATGGAAGG - Intergenic
941875602 2:170429710-170429732 TGAGTTTGACAGGAAATGGAAGG - Intronic
941883416 2:170504424-170504446 TTTATTGGGAAGGAGATGAAAGG - Intronic
942505216 2:176634651-176634673 TTAAGTGGGAAGGAAATGGATGG + Intergenic
943280915 2:185931950-185931972 TGTAATGGACAGGAAATAAAAGG + Intergenic
943282512 2:185954923-185954945 TGGAATGGAAAAGAAATGGAAGG + Intergenic
943294551 2:186120151-186120173 TGCCTGGGGAAGGAAATGGAGGG - Intergenic
945778231 2:214133799-214133821 AGAATTGGAAAGGAAAGAGATGG + Intronic
945800801 2:214427899-214427921 TGTATTGGAAAGGAAATGGATGG - Intronic
946577109 2:221087522-221087544 TGTTGTGGAAAGGAACTGGTGGG - Intergenic
946895918 2:224323505-224323527 TGTTTTGGTGAGAAAATGGAGGG + Intergenic
947977258 2:234377643-234377665 TGCTCTGGAAAGGAAATGGCAGG + Intergenic
948024856 2:234768883-234768905 TATTTTAGAAAGGAAAGGGAGGG - Intergenic
948185132 2:236014942-236014964 TGTGTTGGAAAGGAAGGGGCGGG - Intronic
948200344 2:236125496-236125518 TATATTAGAAAGGAAAAAGAAGG + Exonic
948440304 2:237982849-237982871 TGTATGGGAAAGGCAGAGGATGG - Intronic
1168728886 20:60273-60295 TGGACTGGAATGGAAATGAAGGG - Intergenic
1169779395 20:9293166-9293188 TGGAATGGAAAGGAAAGGAAAGG + Intronic
1169916312 20:10687069-10687091 TGTGTTGGAAAGCAGATGAAAGG + Intergenic
1170015655 20:11778905-11778927 GGCATGGGAGAGGAAATGGATGG + Intergenic
1170169810 20:13398075-13398097 TCTATTTGAAAAGAAATGAAAGG + Intronic
1170171580 20:13419317-13419339 AGGATGGGAAAGCAAATGGAAGG + Intronic
1170512279 20:17090440-17090462 TGTAGTGGAAAGAGCATGGATGG + Intergenic
1171914557 20:31053312-31053334 TGGAATGGAAAGGAATTGAATGG + Intergenic
1171914636 20:31053842-31053864 TGAATTGGAATGGAAAGGAATGG + Intergenic
1171914930 20:31055726-31055748 TGGATTGGAATGGAAAGGAATGG + Intergenic
1171915238 20:31057671-31057693 TGGAATGGAAAGGAATTGAATGG + Intergenic
1171916118 20:31063383-31063405 TGGAATGGAAAGGAATTGAACGG + Intergenic
1171917265 20:31070660-31070682 TGAAATGGAAAGGAATTGAAAGG + Intergenic
1171917770 20:31073868-31073890 TGTAATGGAATGGAATTGAATGG + Intergenic
1171918172 20:31076360-31076382 TGTATTTGAATGGAATTGAATGG + Intergenic
1171919233 20:31084849-31084871 TGGAATGGAAAGGAAATCAATGG + Intergenic
1171919773 20:31089197-31089219 TGGAATGGAATGGAAATGCATGG + Intergenic
1171920886 20:31097776-31097798 TGGATTGGAATGGAATTGCATGG + Intergenic
1171920947 20:31098302-31098324 TGTAATGGAATGGAATTGAACGG + Intergenic
1171920993 20:31098611-31098633 TGGAATGGAATGGAAATGAATGG + Intergenic
1171921355 20:31101355-31101377 TGGAATGGAAAGGAATTGAATGG + Intergenic
1171922941 20:31165714-31165736 TGGAATGGAATGGAAATGAATGG + Intergenic
1171923222 20:31167801-31167823 TGGAATGGAAAGGAATTGGATGG + Intergenic
1171923342 20:31168710-31168732 TGGAATGGAAAGGAATGGGAAGG + Intergenic
1171924114 20:31174922-31174944 TGGATTGGAATGGAAAGGAATGG + Intergenic
1171924352 20:31176788-31176810 TGTAATGGAAAGGAATGGAATGG + Intergenic
1171924669 20:31179272-31179294 TGTAATGGAATGGAAATGAATGG + Intergenic
1171924825 20:31180522-31180544 TGTAATGGAATGGAATTGAAAGG + Intergenic
1171925061 20:31182405-31182427 TGGAATGGAAAGGAAAGGAATGG + Intergenic
1171925082 20:31182595-31182617 TGTAATGGAATGGAATTGAAAGG + Intergenic
1171925241 20:31183792-31183814 TGGAATGGAAAGGAATTGAATGG + Intergenic
1171925658 20:31186555-31186577 TGGAATGGAATGGAAATGAATGG + Intergenic
1171926658 20:31194448-31194470 TGTATTTGAATGGAATTGAATGG + Intergenic
1171927733 20:31202998-31203020 TGGAATGGAAAGGAAATCAATGG + Intergenic
1171928270 20:31207351-31207373 TGGAATGGAATGGAAATGCATGG + Intergenic
1171929390 20:31215936-31215958 TGGATTGGAATGGAATTGCATGG + Intergenic
1171929451 20:31216462-31216484 TGTAATGGAATGGAATTGAACGG + Intergenic
1171929499 20:31216781-31216803 TGGAATGGAATGGAAATGAATGG + Intergenic
1171929860 20:31219520-31219542 TGGAATGGAAAGGAATTGAATGG + Intergenic
1171932262 20:31239333-31239355 TTGAATGGAAAGGAAATGTATGG + Intergenic
1171932684 20:31242576-31242598 TGTAATGGAAAGGAATGGAATGG + Intergenic
1174701591 20:52614599-52614621 TATATTGGAAAGGGAAGAGAAGG - Intergenic
1174885322 20:54327904-54327926 TGAGTTGGAAAGTCAATGGAGGG + Intergenic
1175426282 20:58869360-58869382 TGTATAGGAAATCAAATGGTAGG + Intronic
1176526628 21:7924181-7924203 TGTATTGGAAAGGAGAGGAATGG - Intergenic
1176527455 21:7931154-7931176 TCGAATGGAAAGGAAATGAATGG - Intergenic
1176527527 21:7931799-7931821 TGGAATGGAATGGAATTGGATGG - Intergenic
1176527863 21:7934701-7934723 TAGAATGGAATGGAAATGGATGG - Intergenic
1176528740 21:7941700-7941722 TGGATTGGAAAGGAATGGAATGG - Intergenic
1176529096 21:7944376-7944398 TGAATTGGAATGGAATTGAATGG - Intergenic
1176529396 21:7946440-7946462 TGGATTGGAAAGGAATTGAATGG - Intergenic
1176529464 21:7946949-7946971 TGGAATGGAAAGGAATGGGAAGG - Intergenic
1176529749 21:7948925-7948947 TGGAATGGAAGGGAAATGAATGG - Intergenic
1176636161 21:9246606-9246628 TGGAATGGAATGGAATTGGATGG + Intergenic
1176746352 21:10655870-10655892 TGGAATGGAAAGGAATGGGATGG - Intergenic
1176747012 21:10660904-10660926 TGGAATGGAAAGGAATTGAATGG - Intergenic
1176747335 21:10663370-10663392 TGGAATGGAAAGGAATTGAAAGG - Intergenic
1176747699 21:10666367-10666389 TGGAATGGAAAGGAATTGAAAGG - Intergenic
1176748037 21:10669004-10669026 TGGAATGGAAAGGAATTGAATGG - Intergenic
1176748369 21:10671451-10671473 TGTAATGGAATGGAATTGAATGG - Intergenic
1176748395 21:10671656-10671678 TGGATTGGAATGGAATTGAATGG - Intergenic
1176749027 21:10676221-10676243 TGTATTGGAAAGCAATCGAATGG - Intergenic
1176749106 21:10676826-10676848 TGGAATGGAAAGGAAAGGTATGG - Intergenic
1176750428 21:10686877-10686899 TGGATTGGAAGGGAATTGAATGG - Intergenic
1176750822 21:10689887-10689909 TGTAATGGAATGGAAAGGAATGG - Intergenic
1176751130 21:10692136-10692158 TGGAATGGAATGGAAATGAATGG - Intergenic
1176751984 21:10698346-10698368 TGGATTGGAATGGACATGAATGG - Intergenic
1176753547 21:10709064-10709086 TGGAGTGGAATGGAAATGAATGG - Intergenic
1176754243 21:10713955-10713977 TGGATTGGAATGGAATTGAATGG - Intergenic
1176754526 21:10716058-10716080 TGGAATGGAATGGAATTGGAAGG - Intergenic
1176754749 21:10717566-10717588 TGCAATGGAAAGGAAAGGAATGG - Intergenic
1176754852 21:10718290-10718312 TGGATTGGAATGGAAAGTGATGG - Intergenic
1176755424 21:10722220-10722242 TGCAGTGGAAAGGAATTGAATGG - Intergenic
1176755466 21:10722500-10722522 TGGAATGGAAAGGAATGGGAAGG - Intergenic
1176756663 21:10730762-10730784 TGGATTGGAGAGGAAAGGAATGG - Intergenic
1176756751 21:10731322-10731344 TGGAATGGAAAGGAATGGGAAGG - Intergenic
1176757519 21:10736571-10736593 TGGATTGGAAAGGAGAGGAATGG - Intergenic
1177375648 21:20267831-20267853 TGTATTTGAAAAGAAATTCAGGG - Intergenic
1177401422 21:20610623-20610645 TGGCTGGGAAAGGTAATGGAGGG + Intergenic
1177622381 21:23612902-23612924 TGTATGGGAATGGATATGAAGGG - Intergenic
1179195677 21:39160389-39160411 TGTACTGGAAAGGAAATTCAAGG - Intergenic
1179408676 21:41145412-41145434 TGTGTCAGAAAGGAAATGAAAGG - Intergenic
1180283006 22:10720147-10720169 TGTATTCGAAAGGAATGGAATGG - Intergenic
1180283060 22:10720527-10720549 TGTAATGGAAAGGAATTAAATGG - Intergenic
1180283290 22:10722196-10722218 TGTAATGGAATGGAAAGGAATGG - Intergenic
1180283751 22:10725490-10725512 TGTATTTGAAAGGAATGGAATGG - Intergenic
1180283800 22:10725845-10725867 TGTAATGGAAAGGAATTAAATGG - Intergenic
1180530867 22:16349041-16349063 TGTAATGGAAAGGAAATGACTGG + Intergenic
1180531488 22:16353512-16353534 TGGAATGGAATGGAAATGAATGG + Intergenic
1180531661 22:16354760-16354782 TGGAATGGAATGGAATTGGATGG + Intergenic
1180531719 22:16355120-16355142 TGGATTGGAAAGGACTTGAATGG + Intergenic
1181071962 22:20349462-20349484 TGTATTGGGAAAGAAATTAATGG - Intergenic
1181537471 22:23554005-23554027 TGTCTTGGAAGGGAAAAGGAAGG - Intergenic
1182836913 22:33349645-33349667 GGAATTGGAAAGGAAAAGGAAGG - Intronic
1182899795 22:33888412-33888434 TTGGTTGGAAGGGAAATGGAAGG - Intronic
1184264850 22:43341542-43341564 TTCACTGGAATGGAAATGGATGG + Intronic
1184906751 22:47493035-47493057 TGTCATGGAAAGGAACTGGTGGG + Intergenic
1203291606 22_KI270736v1_random:674-696 TGCATTGGAACGGAAAGGAATGG + Intergenic
1203298103 22_KI270736v1_random:57634-57656 TGGATTGAAAAGGAAAGGAATGG + Intergenic
1203298600 22_KI270736v1_random:61376-61398 TGGAATGGAAAGGAATTGGGTGG + Intergenic
1203299030 22_KI270736v1_random:64195-64217 TGGATTGGAACGGAATTGAATGG + Intergenic
1203299325 22_KI270736v1_random:65930-65952 TGGAATGGAAAGGAATTGAATGG + Intergenic
1203301017 22_KI270736v1_random:77152-77174 TGGAGTGGAAAGGAATTGAATGG + Intergenic
1203302835 22_KI270736v1_random:89035-89057 TGTAATGGAATGGAATTGAATGG + Intergenic
1203304296 22_KI270736v1_random:98440-98462 TGTAGTGGAATGGAAAGGAAGGG + Intergenic
1203304298 22_KI270736v1_random:98445-98467 TGGAATGGAAAGGAAGGGGATGG + Intergenic
1203305338 22_KI270736v1_random:105248-105270 TGGAGTGGAAAGGAATTGAATGG + Intergenic
1203305580 22_KI270736v1_random:106752-106774 TGAATTGGAAAGCAAAGGAATGG + Intergenic
1203305730 22_KI270736v1_random:107752-107774 TGGATTGGAAAGGAATGGAATGG + Intergenic
1203307228 22_KI270736v1_random:117719-117741 TGGATTGGAAAGGAAAGGATTGG + Intergenic
1203308085 22_KI270736v1_random:123634-123656 TGTATTGGAGATGAAAGGAATGG + Intergenic
1203308118 22_KI270736v1_random:123819-123841 TGGAGTGGAAAGGAAAGGAATGG + Intergenic
1203308286 22_KI270736v1_random:124725-124747 TGGAATGGAATGGAAATGAATGG + Intergenic
1203308359 22_KI270736v1_random:125190-125212 AGAATTGGAAAGGAAAGGAATGG + Intergenic
1203308493 22_KI270736v1_random:126117-126139 TGGATTGGAGTGGAAAGGGATGG + Intergenic
1203308531 22_KI270736v1_random:126342-126364 TGCAATGGAATGGAAATGAATGG + Intergenic
1203308766 22_KI270736v1_random:127919-127941 TGGAATGGAAAGGAAACGAATGG + Intergenic
1203309088 22_KI270736v1_random:130047-130069 TGTAGTGGAATGGAATTGAATGG + Intergenic
1203309229 22_KI270736v1_random:130916-130938 TGGATTGGAATGGAAAGGAATGG + Intergenic
1203309429 22_KI270736v1_random:132261-132283 TGGAATGGAATGGAAAGGGATGG + Intergenic
1203310107 22_KI270736v1_random:136824-136846 TGGAATGGAAAGGAATTGAATGG + Intergenic
1203310428 22_KI270736v1_random:138862-138884 TGGAATGGAAAGGAATTGAATGG + Intergenic
1203310631 22_KI270736v1_random:140246-140268 TGGAGTGGAAAGGAATGGGATGG + Intergenic
1203310848 22_KI270736v1_random:141650-141672 TGTATTGGAATGGAAAGTGGTGG + Intergenic
1203311124 22_KI270736v1_random:143534-143556 TGTATTGGAATGGAATGGAATGG + Intergenic
1203311211 22_KI270736v1_random:144114-144136 TGGATTGGAATGGAAAGGAATGG + Intergenic
1203311691 22_KI270736v1_random:147222-147244 TGTATTGGAAAGAAATGGAATGG + Intergenic
1203311832 22_KI270736v1_random:148125-148147 TGGAATGGAAAGGAAAGGAAAGG + Intergenic
1203311886 22_KI270736v1_random:148458-148480 TGGAGTGGAAAGGAAATGAACGG + Intergenic
1203312546 22_KI270736v1_random:152892-152914 TGGATTGGAACGGAAAAGAATGG + Intergenic
1203312719 22_KI270736v1_random:154016-154038 TGGAGTGGAAAGGAAAGGAATGG + Intergenic
1203313400 22_KI270736v1_random:158483-158505 TGGAGTGGAATGGAAATGAATGG + Intergenic
1203313484 22_KI270736v1_random:162175-162197 TGGAGTGGAACGGAAATGAATGG + Intergenic
1203313598 22_KI270736v1_random:162889-162911 TGGAATGGAAAGGAAAGGAATGG + Intergenic
1203314235 22_KI270736v1_random:171994-172016 TGGATTGGAATGGAAAAGAATGG + Intergenic
1203314343 22_KI270736v1_random:172794-172816 TGGAGTGGAATGGAAAGGGATGG + Intergenic
1203315096 22_KI270736v1_random:181278-181300 TGGAGTGGAAAGGAATGGGATGG + Intergenic
1203317923 22_KI270737v1_random:30667-30689 TGGATTGGAAAGGACTTGAATGG - Intergenic
1203317981 22_KI270737v1_random:31027-31049 TGGAATGGAATGGAATTGGATGG - Intergenic
1203318153 22_KI270737v1_random:32270-32292 TGGAATGGAATGGAAATGAATGG - Intergenic
1203318779 22_KI270737v1_random:36766-36788 TGTAATGGAAAGGAAATGACTGG - Intergenic
950680034 3:14578874-14578896 TTTATTGGAGAGGAAATTGAGGG - Intergenic
951334812 3:21407569-21407591 TATATTGGATAGGAGAGGGAAGG - Intergenic
951347634 3:21565310-21565332 TGTCCTGGAAATAAAATGGAGGG - Intronic
951575012 3:24104470-24104492 TATATGGGAAAGGCAAAGGAAGG + Intergenic
952625307 3:35395875-35395897 TTTATAAGAAAGAAAATGGAAGG - Intergenic
953556762 3:43952240-43952262 CGTATTTGACAGGAAATGGATGG - Intergenic
954052067 3:47987843-47987865 TGAATTCAAGAGGAAATGGAAGG + Intronic
954716706 3:52530405-52530427 TGGAAGGGAAAGGAAAGGGAAGG + Intronic
954759794 3:52865831-52865853 TGTCTTTGAAAGGATATGTAAGG - Intronic
956024767 3:64971139-64971161 AGAATTGTAAAGGAAATGAATGG - Intergenic
956059622 3:65336352-65336374 TGTATTGGATGGGAAATAAAAGG + Intergenic
956754799 3:72373867-72373889 AGTCTTGGAAAGGATCTGGAAGG - Exonic
957117296 3:76043050-76043072 AGTCTTGGAAAGGAAAGGGAGGG + Intronic
957430305 3:80096327-80096349 TGAAATGGAAAGAAAATGTAAGG + Intergenic
957804530 3:85130334-85130356 TGTATTGGTAAGGAAAACTATGG - Intronic
958186281 3:90123748-90123770 TAGATTGGAGAGGAAATGGCTGG + Intergenic
958696170 3:97529424-97529446 TGTATTGGAAAAGAAAAAAAAGG + Intronic
960219181 3:115083813-115083835 TATATTGGAGAAGAAATGGTAGG + Intronic
960446188 3:117751738-117751760 GGTATTAGAAAGGATATTGATGG + Intergenic
961161775 3:124732549-124732571 TGTATTGGAAAGCATATTTACGG - Intronic
962038213 3:131676684-131676706 TGTTTTTGCAAGGACATGGATGG - Intronic
962374181 3:134846694-134846716 TGTTTTGGGAAGGAAAGGCATGG + Intronic
963500758 3:146122439-146122461 TGTAGTGGAAAGAACATAGAGGG - Intronic
964170750 3:153767645-153767667 TTTAATAGAAAGGCAATGGAAGG + Intergenic
965402710 3:168232149-168232171 TATTTTGGAAAAAAAATGGAGGG - Intergenic
965412293 3:168347077-168347099 AGTGTAGGAAAGGAAATGGTGGG + Intergenic
965840199 3:172896017-172896039 TGGATTGGAAATGAAATCAAAGG + Intronic
965879158 3:173367817-173367839 TATATATGCAAGGAAATGGAAGG - Intergenic
966932083 3:184682135-184682157 TGATTTGGAAAGGACAAGGAAGG - Intronic
969542618 4:7803168-7803190 TGTATCTGAAAGGAAGAGGAAGG + Intronic
970547236 4:17142272-17142294 AGTATTGGAAAGGGCATGGTGGG + Intergenic
971129185 4:23787169-23787191 TTTATTGAGGAGGAAATGGAGGG - Intronic
971400366 4:26270275-26270297 TTTGTCGGAAAGGAAAGGGAAGG + Intronic
971733403 4:30415801-30415823 TGTTTTGGAAGGGAACTGGTGGG + Intergenic
971982235 4:33767106-33767128 TTTATTGGTAAAGAAGTGGATGG - Intergenic
972053185 4:34765774-34765796 TTAATTATAAAGGAAATGGAAGG - Intergenic
972098717 4:35383707-35383729 GGTATTGGTAAGGAAAAGCAAGG - Intergenic
972661492 4:41120966-41120988 TGTACCTGAAAGAAAATGGAAGG + Intronic
973105976 4:46337825-46337847 AGGTTTGGAAAGTAAATGGAGGG + Intronic
973349476 4:49092910-49092932 TGGATTGGAAAGGAATGGAATGG - Intergenic
973350994 4:49102110-49102132 TGGATTGGAATGGAAAGGAATGG - Intergenic
973350998 4:49102130-49102152 TGGATTGGAAAGGAATGGAATGG - Intergenic
973351175 4:49103108-49103130 TGGATTGGAATGGAAAGGAATGG - Intergenic
973351918 4:49107913-49107935 TGGATTGGAATGGAAAGGAATGG - Intergenic
973352148 4:49109306-49109328 TGGATTGGAATGGAAAGGAATGG - Intergenic
973352152 4:49109326-49109348 TGGATTGGAAAGGAATGGAATGG - Intergenic
973352301 4:49110164-49110186 TGGATTGGAATGGAAAGGAATGG - Intergenic
973352471 4:49111221-49111243 TGGAATGGAAAGGAAAGGAATGG - Intergenic
973352488 4:49111340-49111362 TGTAATGGAATGGAAAGGAATGG - Intergenic
973352769 4:49113065-49113087 TGGAATGGAAAGGAAAGGAATGG - Intergenic
973352787 4:49113184-49113206 TGTAATGGAATGGAAAGGAATGG - Intergenic
973353250 4:49116001-49116023 TGGAGTGGAAAGGAATAGGATGG - Intergenic
973353933 4:49120200-49120222 TGGATTGGAATGGAAAGGAATGG - Intergenic
973353937 4:49120220-49120242 TGGATTGGAAAGGAATGGAATGG - Intergenic
973358288 4:49145950-49145972 TGAATTGGAATGGAAAGGAATGG - Intergenic
973359021 4:49150313-49150335 TGGATTGGAATGGAAAGGAAAGG - Intergenic
973359657 4:49154021-49154043 TGGAATGGAAAAGAAATGAATGG - Intergenic
973400291 4:49633102-49633124 TGGAATGGAAAAGAAATGAATGG + Intergenic
973400977 4:49637445-49637467 TGGATTGGAATGGAAAGGAATGG + Intergenic
973401305 4:49639486-49639508 TGGAATGGAAAAGAAATGAATGG + Intergenic
973401783 4:49642279-49642301 TGGAATGGAAAGGAAAGGAATGG + Intergenic
973402178 4:49644872-49644894 TGGAATGGAAAAGAAATGAATGG + Intergenic
973402441 4:49646474-49646496 TGGATTGGAATGGAAAGGAACGG + Intergenic
973403167 4:49651054-49651076 TGGAATGGAAAAGAAATGAATGG + Intergenic
973403577 4:49653508-49653530 TGGAATGGAATGGAAATGAATGG + Intergenic
973404234 4:49657728-49657750 TGGAATGGAAAGGAATTGAATGG + Intergenic
973606569 4:52593111-52593133 TATAAGGGAATGGAAATGGAAGG + Exonic
973964151 4:56144080-56144102 AGGAGTGGAAAGGAAAGGGAGGG + Intergenic
974221376 4:58976853-58976875 TGGCTTGGAGAGGAAATGAAAGG + Intergenic
974902015 4:68012406-68012428 TAAATTGGAAAGAAAATGGAAGG - Intergenic
975098435 4:70484423-70484445 TTTCTTGGAAAAGAAATTGAGGG + Intergenic
975571252 4:75820485-75820507 TGGATTAAAAAGGAAATTGATGG + Intergenic
976400406 4:84600863-84600885 TGAATGAGAATGGAAATGGAGGG + Intronic
978613882 4:110573978-110574000 TTTATTGGAAACAACATGGATGG + Intergenic
978824652 4:113007061-113007083 TGTTTTGGAAAAGCAATGGATGG - Intronic
979378081 4:119972880-119972902 TGTATTGGAAACGAAAGGAAAGG + Intergenic
979515157 4:121599489-121599511 TGTATGAGAAAGGAAATATAAGG + Intergenic
979787857 4:124739190-124739212 AGCATTGTAAAGGAAATGCATGG + Intergenic
980028051 4:127789938-127789960 TGTATTTGAAAGAAAATCGAAGG + Intronic
980187111 4:129475826-129475848 TGAATTGGAAAGAAATTGCAGGG - Intergenic
980458209 4:133072651-133072673 TGTATTAGCAAAGAAATTGAAGG + Intergenic
980925463 4:139132726-139132748 TGTAATGGAACGGAAAGGAAGGG - Intronic
981245549 4:142533008-142533030 TGCATTAGAAAGCAAATGAAAGG + Intronic
981591261 4:146364962-146364984 AGCATTAAAAAGGAAATGGAAGG - Intronic
981722760 4:147818016-147818038 TGTAATGGAAAGGACATTGGTGG + Intronic
981932248 4:150203169-150203191 TGTACAGAAAAGAAAATGGAAGG + Intronic
982740234 4:159050301-159050323 TGTATTGAAAGGGAAAAGAATGG + Intergenic
982745415 4:159101245-159101267 TGTGTTGGAAATGAACTGTATGG + Intergenic
983153783 4:164319113-164319135 AATATTAGAAAGGAAATGGATGG + Intronic
983168593 4:164510090-164510112 GGTGTTGGTAAGGAGATGGAAGG + Intergenic
984887587 4:184464384-184464406 TGTATAGGATAGGGAATGTATGG + Intronic
985395494 4:189539001-189539023 TGTGTTGGCAAAGCAATGGAGGG - Intergenic
1202750576 4_GL000008v2_random:2015-2037 TAGAGTGGAAAGGAATTGGATGG + Intergenic
1202750765 4_GL000008v2_random:3244-3266 TGTAGTGGAATGGAATTGAATGG + Intergenic
1202751057 4_GL000008v2_random:5076-5098 TGGAATGGAATGGAATTGGAAGG + Intergenic
986310461 5:6547219-6547241 TGGAGTGGAAAGGGAAGGGAAGG - Intergenic
987379389 5:17270848-17270870 TTTATTTTAAAGGAAACGGAAGG + Intronic
987543102 5:19280200-19280222 TGAAATGGTAAGAAAATGGATGG - Intergenic
987551779 5:19392194-19392216 AGTATTGCAAATGAAAGGGATGG + Intergenic
989343258 5:40400833-40400855 TGTATTGGAATGGAATGGGATGG + Intergenic
989722796 5:44549908-44549930 TGTATTAGAAAGGGACTAGAAGG - Intergenic
989909359 5:49602616-49602638 TGTAATGGAATGGAAAGGAATGG + Intergenic
989911116 5:49657316-49657338 TGGAATGGTAAGGAAATGAAAGG - Intergenic
989911486 5:49659642-49659664 TGGAATGGAAAGGAATGGGATGG - Intergenic
989911776 5:49661432-49661454 TGTAATGGAAAGGAATGGAATGG - Intergenic
990077438 5:51866908-51866930 TGTATATGAAAGAAAATGTATGG - Intergenic
990478313 5:56183836-56183858 TGTATTGGAAAGGAACCTGAGGG + Intronic
991494992 5:67217895-67217917 TGCATTGGAAAGGGAGTGGAGGG + Intergenic
991547913 5:67804097-67804119 TGTTTTGGAAAGGAGCAGGAAGG - Intergenic
991598249 5:68326456-68326478 TTTATAGGTAAGGAAATTGATGG + Intergenic
991910854 5:71559280-71559302 TTTATTGGAGAGCAGATGGATGG - Intronic
992030613 5:72717698-72717720 AGGATTAGTAAGGAAATGGAAGG + Intergenic
992221611 5:74579392-74579414 TGTATTGTCCAGCAAATGGAAGG + Intergenic
992238556 5:74739004-74739026 TGTAATGGACAGAAAGTGGAAGG - Intronic
994532280 5:100985900-100985922 TATGATGGAAAGGAAATGAAAGG + Intergenic
994810173 5:104507074-104507096 AGTTTTGGAAACAAAATGGAGGG - Intergenic
995133312 5:108653857-108653879 TGTTTTTTAAAGGAAAAGGAAGG - Intergenic
995734513 5:115285747-115285769 TTTTTTGGAGAGGAAATTGATGG + Intronic
996298201 5:121949901-121949923 TGAATTAGAAAGAAAATAGATGG - Intergenic
996951925 5:129137364-129137386 TGTCTTTGCAAGGACATGGATGG + Intergenic
998074802 5:139226942-139226964 TGTATTTAAAGGGAAATGTATGG + Intronic
998687161 5:144541399-144541421 TTTATTGGAGAGGCAATGGAAGG + Intergenic
998774908 5:145588377-145588399 TTTATGGGAAAGGAAAGGTAGGG - Intronic
999586251 5:153092839-153092861 TGTATTAGAAAGGCAAGGAAGGG + Intergenic
999979638 5:156945423-156945445 TTTATAGGTAAAGAAATGGAGGG - Intronic
1000110597 5:158104670-158104692 AGTATTGGAAAGAAAATGTATGG - Intergenic
1000207377 5:159075432-159075454 TGTTTTGAAAAGGAAAATGAAGG - Intronic
1000667479 5:164016290-164016312 TGTAAGGGAAAGGAAATACAAGG - Intergenic
1001118415 5:168958816-168958838 TGTATTGGGAGGGAGAAGGATGG - Intronic
1001459064 5:171893103-171893125 TTTATAGAAAAGGAAATGGAGGG + Intronic
1002361989 5:178679508-178679530 GATATTTGAAAGTAAATGGAAGG - Intergenic
1003246310 6:4385142-4385164 AGTATTGGAAAGATAATGAAAGG + Intergenic
1003408784 6:5845193-5845215 TCTATTAACAAGGAAATGGAGGG + Intergenic
1004790466 6:19020931-19020953 AGGAAAGGAAAGGAAATGGAAGG - Intergenic
1005503382 6:26449583-26449605 TGGATGCGAAAGGAAGTGGAAGG + Intronic
1006813716 6:36837414-36837436 TGGAGAGGAAAGGAGATGGAGGG - Intronic
1007135664 6:39519604-39519626 AGTCTAGGAAGGGAAATGGATGG + Intronic
1008792596 6:55255604-55255626 TCTTTTGGATAGGAAATGAAAGG + Intronic
1008885426 6:56427562-56427584 TGAATTGGGAAAGAAAAGGAGGG - Intergenic
1009161385 6:60287556-60287578 TGTTTTGGAATGGAATTGTAGGG + Intergenic
1009456673 6:63865033-63865055 GGTCTTGGAAAGGAAAACGAAGG - Intronic
1009918305 6:70024408-70024430 TGTTTTGGAAAGGACCTGAAGGG + Intronic
1010051586 6:71510741-71510763 TCTGTTAAAAAGGAAATGGAGGG + Intergenic
1010176527 6:73033874-73033896 TGTATTGGAAGAGAATTTGAGGG - Intronic
1010248864 6:73687624-73687646 TATGTGGGAAAGGATATGGATGG - Intergenic
1011765443 6:90614898-90614920 TGTATCGGGGAGGAAATGCATGG + Intergenic
1011837266 6:91448554-91448576 TTTATTTGAAATAAAATGGAAGG - Intergenic
1012571293 6:100732905-100732927 GGAAATGGAAGGGAAATGGAGGG - Intronic
1012660609 6:101885817-101885839 TGTATGGAAATGGAAAGGGAGGG - Intronic
1012968125 6:105697551-105697573 AGTGCTGGAAAGGAAATGAATGG + Intergenic
1013119193 6:107126370-107126392 TGTATTGGAGAAGAAATGGGTGG - Intergenic
1013532569 6:111033585-111033607 TGTATTTGAAAGAAAATGCTTGG - Intergenic
1014500120 6:122177658-122177680 TGTATTGGAAGAGAAAGGGAAGG + Intergenic
1016304624 6:142670821-142670843 TGCTTAGGAAGGGAAATGGACGG + Intergenic
1017223996 6:151998805-151998827 TGTTTTGGACAGCAAATGGAGGG - Intronic
1017236442 6:152121543-152121565 TGTATATTAAAGGAAAAGGATGG - Intronic
1017659250 6:156657626-156657648 TGGATTTGAAGGGAATTGGAAGG - Intergenic
1018590729 6:165418668-165418690 GATATTGGAGAGGAAAAGGAAGG - Exonic
1020215755 7:6188906-6188928 TGTATTTGAAAGGTAATTCATGG - Intronic
1020520860 7:9185064-9185086 TGCATTAGAATGGAAAAGGAAGG - Intergenic
1020706393 7:11549617-11549639 TGTCTTTGAAGGGACATGGATGG + Intronic
1022373891 7:29795203-29795225 TGGAGAGGAAAGGAACTGGAGGG - Intergenic
1022600305 7:31751822-31751844 TTTATTGGAAATGAACTGCAGGG + Exonic
1022841154 7:34165107-34165129 AATAAGGGAAAGGAAATGGATGG - Intergenic
1023190371 7:37574173-37574195 TGTTTTGGAAATGGAAAGGAAGG + Intergenic
1023200116 7:37687845-37687867 TGTGTTTGAGAGGGAATGGAAGG - Intronic
1023564784 7:41513339-41513361 TGTAATGTAAAAGAAATAGAAGG - Intergenic
1023670193 7:42568211-42568233 TGTAATGCAAAAGAAATTGATGG + Intergenic
1024047436 7:45594525-45594547 GGTATGGAAAAGGAAATGGGAGG - Intronic
1024423152 7:49193588-49193610 TGGATGGAAAAGGATATGGATGG + Intergenic
1024425223 7:49217084-49217106 TGTTTTGGAAAGGAAAGTGCTGG + Intergenic
1025134445 7:56398797-56398819 TGCATAGGAAAGGCAATGTATGG + Intergenic
1025318822 7:58067716-58067738 TGAAATGGAAAGGAATTGAATGG - Intergenic
1026251099 7:68671452-68671474 TGTAGTGTTAAGGCAATGGAAGG - Intergenic
1026546330 7:71326159-71326181 TGTATTAAAAAGGCAGTGGATGG + Intronic
1026978758 7:74514554-74514576 TGCATTGGAAAGGAGATGAGAGG - Intronic
1027841650 7:83319931-83319953 TGTCTGGGAAATGAAATGGGAGG + Intergenic
1027915794 7:84319119-84319141 TGTACAGGTAAGAAAATGGAGGG + Intronic
1027918201 7:84354448-84354470 GGTATAGGAAAAGAAATGGAAGG - Intronic
1028483869 7:91337194-91337216 AGGATTGGAAAGAACATGGAAGG - Intergenic
1028678711 7:93499616-93499638 TATATTGGAAAAGAAATCGCAGG + Intronic
1029958423 7:104664328-104664350 TGTATTCAAAAAGAATTGGAGGG - Intronic
1030341495 7:108385782-108385804 TGTATTGGAGAGAATATGGAAGG + Intronic
1030399002 7:109025428-109025450 TTTATATGAAAGAAAATGGAAGG - Intergenic
1031025692 7:116677270-116677292 AATACTGGAAAGGAAAAGGAAGG - Intronic
1031411910 7:121449331-121449353 TGTATAGGATAGGAGAAGGATGG + Intergenic
1032131498 7:129232565-129232587 AGTATTGGGAAGATAATGGATGG - Intronic
1032431304 7:131864345-131864367 TGTTTTGGAAAGCAAAATGAAGG - Intergenic
1032667378 7:134050190-134050212 TCTCTAGGAAAGGAAATGGTGGG + Intronic
1033982347 7:147181032-147181054 TATTTTGAAAAGGAAATGGCAGG + Intronic
1034293000 7:149947239-149947261 GGCATTTGGAAGGAAATGGATGG - Intergenic
1034813073 7:154149634-154149656 GGCATTTGGAAGGAAATGGATGG + Intronic
1034856590 7:154554426-154554448 AGTAATGGAAGGGAAATGAATGG - Intronic
1036047120 8:5155834-5155856 TGTAAAGGAATGGAAATGCAAGG - Intergenic
1036091085 8:5666076-5666098 TGGATGTGAGAGGAAATGGAGGG + Intergenic
1036465600 8:8994121-8994143 TACATGGGAAAGGAGATGGAAGG + Intergenic
1036481114 8:9140510-9140532 TGTGCTGGAAAGGGTATGGATGG - Exonic
1037888351 8:22607047-22607069 TGCATTGGAAAGGGAAGGGATGG + Intronic
1038884394 8:31647530-31647552 TCTACTGAGAAGGAAATGGATGG + Intronic
1039082208 8:33744550-33744572 TGTCATGGAAAGGAACTGGTGGG - Intergenic
1039294182 8:36131431-36131453 AGTCTTGGCAAGGAAATAGAAGG - Intergenic
1039617920 8:38971307-38971329 TGTATAGGAAAGGCAGGGGAAGG - Exonic
1041306973 8:56471642-56471664 TGTATTTTAAATGAAAAGGAAGG - Intergenic
1041698764 8:60764771-60764793 TGTATGGGAGAAGAAATGCAGGG + Intronic
1042824132 8:72963206-72963228 AGTATAGGAAAGGAAAGGAAAGG - Intergenic
1043354861 8:79400563-79400585 TGCTTTGGGAAGGAAAGGGAAGG - Intergenic
1043376776 8:79658426-79658448 TGTATTGGGAAAGACATGGTTGG - Intronic
1043668310 8:82846891-82846913 TGAATATGAAAGGAAATGTAAGG + Intergenic
1044559591 8:93599732-93599754 TGTATTCAAAAGCAAATAGATGG - Intergenic
1044861093 8:96524733-96524755 TGTATTGGAAAGGAGAAAAAAGG - Intronic
1046376776 8:113393497-113393519 TGTATTGAAGTGGAAATGGCAGG - Intronic
1047893528 8:129339824-129339846 TTTATAGGTAAGGAAATCGAGGG - Intergenic
1048078295 8:131097389-131097411 TGTCTTTGCAAGGACATGGATGG + Intergenic
1052575229 9:30282505-30282527 TGTATCAGAAAGGAAAGGAATGG - Intergenic
1053244780 9:36525784-36525806 TGAATTGAAAAGGAAAAGGGGGG + Intergenic
1053684009 9:40505024-40505046 TGTCATGGAAAGGACATGGGAGG + Intergenic
1054395124 9:64644996-64645018 TGTCATGGAAAGGACATGGGAGG + Intergenic
1054429771 9:65150196-65150218 TGTCATGGAAAGGACATGGGAGG + Intergenic
1054740593 9:68802417-68802439 TGTGATGGATAGAAAATGGATGG + Intronic
1054869774 9:70038571-70038593 TGGATTGGAATGGAAAGGAATGG + Intergenic
1055392076 9:75833723-75833745 TGTATTGGATATGACATGTAGGG + Intergenic
1056823212 9:89859171-89859193 TTTATTCAAAAGGCAATGGAGGG + Intergenic
1058964991 9:110028863-110028885 AGTGTTGCAAAGGAAATGAAGGG + Intronic
1059032942 9:110720386-110720408 TTTATTAGAAATGAAATGGAAGG + Intronic
1059899108 9:118902675-118902697 TGGATTGGAAAGGAACTAGGCGG - Intergenic
1059949306 9:119445267-119445289 AGGAATGGAAAGGAAAGGGAGGG - Intergenic
1060376604 9:123120206-123120228 AGTCTTGGAAAGGAGATGGGTGG - Intronic
1060702517 9:125770022-125770044 TGTATAGAAGAGGAAATGGAAGG + Intronic
1060731992 9:126044610-126044632 TGTCTGTGATAGGAAATGGAAGG - Intergenic
1060959802 9:127672237-127672259 TTTATTAGAAAAGAAATGAAAGG + Intronic
1061039744 9:128133112-128133134 TTTATTCAAAAGGCAATGGAGGG - Intergenic
1061244521 9:129394584-129394606 TGTCTTGGAAGGGAAAAGGATGG + Intergenic
1061822496 9:133236390-133236412 GGTAATGGAAAGCAAAGGGATGG - Intergenic
1062236805 9:135514148-135514170 GGTAATGGAAAGCAAAGGGATGG + Intergenic
1203719113 Un_GL000216v2:281-303 TGGAATGGAAAGGAAAAGTAGGG - Intergenic
1203719185 Un_GL000216v2:775-797 TGGATTGGAATGGAAAGGAATGG - Intergenic
1203719440 Un_GL000216v2:2605-2627 TGTAATGGAAAGGAATAGAATGG - Intergenic
1203719454 Un_GL000216v2:2710-2732 TGTAATGGAACGGAAAGGAATGG - Intergenic
1203719552 Un_GL000216v2:3366-3388 TGGAATGGAAAGGAATTGAATGG - Intergenic
1203719554 Un_GL000216v2:3381-3403 TGGATTGGAAAGGAATGGAATGG - Intergenic
1203720310 Un_GL000216v2:8782-8804 TGGAATGGAATGGAAATGAATGG - Intergenic
1203721556 Un_GL000216v2:17045-17067 TTTAATGGAATGGAAATGAATGG - Intergenic
1203722043 Un_GL000216v2:20543-20565 TGTATTGGAATGCAATTGAATGG - Intergenic
1203722377 Un_GL000216v2:22995-23017 TGTATGGGAAAGGAATCGAATGG - Intergenic
1203722848 Un_GL000216v2:26266-26288 TGGAATGGAATGGAAATGAATGG - Intergenic
1203723149 Un_GL000216v2:28262-28284 TTTAATGGAATGGAAATGAATGG - Intergenic
1203723434 Un_GL000216v2:30321-30343 TGTATTGGAATGCAATTGAATGG - Intergenic
1203723715 Un_GL000216v2:32594-32616 TGGATTGGAAAGGAATGGAATGG - Intergenic
1203724628 Un_GL000216v2:39712-39734 TGTATTGGAAGGGACTTGAATGG - Intergenic
1203724717 Un_GL000216v2:40386-40408 TGGAATGGAAAGGAAAGGAATGG - Intergenic
1203725301 Un_GL000216v2:44792-44814 TGTACTGGAATGGAAAGGAATGG - Intergenic
1203725829 Un_GL000216v2:48814-48836 TGTATTGGAATGAAAAGGAATGG - Intergenic
1203725843 Un_GL000216v2:48899-48921 TGTATTGGAAAGGACTCGAATGG - Intergenic
1203726418 Un_GL000216v2:53330-53352 TGGAATGGAAAGGAATTGAATGG - Intergenic
1203727063 Un_GL000216v2:58525-58547 TGGAATGGAATGGAAATGAATGG - Intergenic
1203727461 Un_GL000216v2:61740-61762 TGGAATGGAATGGAAATGAATGG - Intergenic
1203727525 Un_GL000216v2:62313-62335 TGGAATGGAAAGGAAAGGAATGG - Intergenic
1203727824 Un_GL000216v2:64680-64702 TGGAATGGAAAGGAACTGAATGG - Intergenic
1203728075 Un_GL000216v2:66915-66937 TGTAATGGAATGGAAATAAATGG - Intergenic
1203386774 Un_KI270438v1:62567-62589 TGAATTGGAATGGAATGGGAAGG + Intergenic
1203387312 Un_KI270438v1:67458-67480 TGGAATGGAAGGGAAATGAATGG + Intergenic
1203387435 Un_KI270438v1:68372-68394 TGGAGTGGAAAGGAATGGGAAGG + Intergenic
1203387554 Un_KI270438v1:69212-69234 TGGATTGGAAAGGAATTGAATGG + Intergenic
1203388222 Un_KI270438v1:74062-74084 TGGATTGGAAAGGAATGGAATGG + Intergenic
1203388632 Un_KI270438v1:77252-77274 TGGAATGGAATGGAATTGGATGG + Intergenic
1203389279 Un_KI270438v1:82693-82715 TAGAATGGAATGGAAATGGATGG + Intergenic
1203389626 Un_KI270438v1:85691-85713 TGGAATGGAATGGAATTGGATGG + Intergenic
1203390383 Un_KI270438v1:92020-92042 TGGATTGGAAAGGAATGGAACGG + Intergenic
1203390929 Un_KI270438v1:96505-96527 TAGAATGGAAAGGAATTGGATGG + Intergenic
1203391209 Un_KI270438v1:98828-98850 TGGAATGGAATGGAAATGAACGG + Intergenic
1203391297 Un_KI270438v1:99586-99608 TGGAATGGAATGGAAATGAATGG + Intergenic
1203392645 Un_KI270438v1:111040-111062 TGGAATGGAAAGGAATTGAAAGG + Intergenic
1203392742 Un_KI270438v1:111843-111865 TCGAATGGAAAGGAAATGAATGG + Intergenic
1203342655 Un_KI270442v1:4269-4291 TGGAATGGAATGGAAATGAATGG + Intergenic
1203342854 Un_KI270442v1:10283-10305 TGTAGTGGAATGGAAAGGAATGG + Intergenic
1203343398 Un_KI270442v1:14295-14317 TGAATTGGAATGGAATGGGAAGG + Intergenic
1203343705 Un_KI270442v1:16555-16577 TGGCTTGGAAAGGAATTGAATGG + Intergenic
1203343981 Un_KI270442v1:18440-18462 TGGAATGGAAAGGAAAGGAATGG + Intergenic
1203344088 Un_KI270442v1:19225-19247 TGTAATGGAATGGAAAGGGAAGG + Intergenic
1203344281 Un_KI270442v1:22381-22403 TGGAGTGGAATGGAAATGAATGG + Intergenic
1203344681 Un_KI270442v1:25276-25298 TGTATTGGAATGGAAGGGAATGG + Intergenic
1203344923 Un_KI270442v1:27173-27195 TGGAATGGAAAGGAATTGAATGG + Intergenic
1203345302 Un_KI270442v1:29906-29928 TGGATTGGAAAGGAATGGAATGG + Intergenic
1203345682 Un_KI270442v1:32437-32459 TGGAATGGAAAGGAAATGGAAGG + Intergenic
1203345967 Un_KI270442v1:34463-34485 TGGAATGGAAAGGAAAGGAATGG + Intergenic
1203346562 Un_KI270442v1:38882-38904 TGGAGTGGAAAGGAAAGGAATGG + Intergenic
1203347378 Un_KI270442v1:44641-44663 TGGAATGGAAAGGAATGGGAAGG + Intergenic
1203347545 Un_KI270442v1:45716-45738 TGGAATGGAATGGAAATGAATGG + Intergenic
1203347633 Un_KI270442v1:46381-46403 TCAAATGGAAAGGAAATGAACGG + Intergenic
1203348356 Un_KI270442v1:55891-55913 TGGATTGGAATGGAATGGGATGG + Intergenic
1203348574 Un_KI270442v1:57439-57461 TGGATTGGAATGGAATTGAATGG + Intergenic
1203350203 Un_KI270442v1:75378-75400 TGTAATGTAATGGAATTGGAAGG + Intergenic
1203350558 Un_KI270442v1:78059-78081 TGCAATGGAAAGGAAAGGAATGG + Intergenic
1203350707 Un_KI270442v1:79114-79136 TGTATTGGAATGGAAAGGAAAGG + Intergenic
1203350709 Un_KI270442v1:79119-79141 TGGAATGGAAAGGAAAGGGAAGG + Intergenic
1203350970 Un_KI270442v1:81119-81141 TGTAATGGAATGGAAACGGAAGG + Intergenic
1203351263 Un_KI270442v1:83222-83244 TGCAATGGAATGGAAAGGGAAGG + Intergenic
1203351770 Un_KI270442v1:87026-87048 TGGAATGGAATGGAATTGGATGG + Intergenic
1203352044 Un_KI270442v1:89220-89242 TGGAATGGAATGGAATTGGATGG + Intergenic
1203352235 Un_KI270442v1:90663-90685 TGGAATGGAATGGAATTGGATGG + Intergenic
1203352498 Un_KI270442v1:92699-92721 TGTATTGGAATGGAATGGAATGG + Intergenic
1203352753 Un_KI270442v1:94761-94783 TGGAATGGAAAGGAACTGAATGG + Intergenic
1203352796 Un_KI270442v1:95106-95128 TGGAATGGAAAGGAACTGAATGG + Intergenic
1203352943 Un_KI270442v1:96286-96308 TGGATTGGAATGGAATGGGATGG + Intergenic
1203403359 Un_KI270519v1:137342-137364 TGTATTGGAATGGAATGGAATGG + Intergenic
1203673484 Un_KI270756v1:1784-1806 TGTATTGGAATGGAATGGAATGG - Intergenic
1203674175 Un_KI270756v1:7618-7640 TAGAATGGAATGGAAATGGATGG - Intergenic
1203674555 Un_KI270756v1:10804-10826 TGTAATGGAATGGAAAGGAATGG - Intergenic
1203674603 Un_KI270756v1:11239-11261 TGGAATGGAAAGGAAAAGAATGG - Intergenic
1203675504 Un_KI270756v1:18827-18849 TAGATTGGAATGGAAACGGATGG - Intergenic
1203675679 Un_KI270756v1:20351-20373 TGGAATGGAATGGAATTGGATGG - Intergenic
1203675754 Un_KI270756v1:20926-20948 TGGAATGGAAAGGAATAGGATGG - Intergenic
1203676042 Un_KI270756v1:23339-23361 TGGAATGGAATGGAAATGAATGG - Intergenic
1203676410 Un_KI270756v1:26373-26395 TGTATTGGAATGGAAAGGATTGG - Intergenic
1203676654 Un_KI270756v1:28359-28381 TGGATTGGAATGGAATTGAAAGG - Intergenic
1203676908 Un_KI270756v1:30446-30468 TGGAATGGAAAGGAAATGATTGG - Intergenic
1203677222 Un_KI270756v1:33015-33037 TGGATTGGAATGGACATGAATGG - Intergenic
1203678165 Un_KI270756v1:40960-40982 TGGAATGGAAAGGAAAAGAACGG - Intergenic
1203678229 Un_KI270756v1:41460-41482 TGGAATGGAATGGAAATGAATGG - Intergenic
1203679823 Un_KI270756v1:54406-54428 TGGAATGGAAAGGAAAGGAATGG - Intergenic
1203680927 Un_KI270756v1:63430-63452 TGGATTGGAATGGAATTGAATGG - Intergenic
1203681640 Un_KI270756v1:69290-69312 TGGAATGGAAAGGAAAGGAATGG - Intergenic
1203681644 Un_KI270756v1:69310-69332 TGGAATGGAAAGGAAAGGAATGG - Intergenic
1203681722 Un_KI270756v1:69965-69987 TGGAATGGAATGGAATTGGATGG - Intergenic
1203681881 Un_KI270756v1:71280-71302 TGGAATGGAATGGAATTGGATGG - Intergenic
1203681991 Un_KI270756v1:72245-72267 TGGAATGGAATGGAAATGAATGG - Intergenic
1203682227 Un_KI270756v1:74248-74270 TGGAGTGGAATGGAAATGAATGG - Intergenic
1203682242 Un_KI270756v1:74378-74400 TGTAATTGAAAGGAATTGAAAGG - Intergenic
1186544047 X:10430338-10430360 CTCATTGGAAAGGAAATGGTTGG + Intergenic
1188647409 X:32587626-32587648 TGTATTGGAAGGGACATTGGAGG + Intronic
1188921236 X:35980230-35980252 GGTATGGGAAAGAAACTGGATGG - Intronic
1189168933 X:38890375-38890397 TTTATAGGAAAGAAAATTGAAGG - Intergenic
1189802454 X:44704536-44704558 AGTATGGGAAAAGAAATGTATGG + Intergenic
1189828759 X:44948582-44948604 TGTACTGTGAAGGAAATGGTGGG + Intronic
1191697279 X:64003215-64003237 TGGATTGGAAAGCCACTGGAGGG + Intergenic
1192084064 X:68078099-68078121 TGTATTCAAAACCAAATGGAAGG - Intronic
1192329693 X:70165367-70165389 ACTATAGTAAAGGAAATGGATGG + Intronic
1194228149 X:91287236-91287258 GGTAGTTGAAAGGACATGGATGG - Intergenic
1196194673 X:112827156-112827178 GGTTTTGAAAAGGATATGGAGGG - Intronic
1196934391 X:120715237-120715259 TATATTGGAAAGGATAGGGATGG - Intergenic
1197502424 X:127258277-127258299 GGGATTGGAAAGGAAAGGAAAGG + Intergenic
1198530131 X:137544349-137544371 CACATTGGAAAGGAAATGAAGGG + Intergenic
1198991245 X:142517127-142517149 TGTTTTGGAAAAGAAATGAAGGG - Intergenic
1201096898 Y:10628336-10628358 TGGAATGGAAAGGAATTGAATGG - Intergenic
1201097144 Y:10630048-10630070 TGGAGTGGAATGGAAAGGGATGG - Intergenic
1201097174 Y:10630248-10630270 AGTATTGGAAAGGAAAGGAGTGG - Intergenic
1201097488 Y:10632514-10632536 TGGAGTGGAAAGGAATTGGGTGG - Intergenic
1201097719 Y:10646510-10646532 TGGAATGGAAAGGAATTGAATGG - Intergenic
1201097995 Y:10648478-10648500 TGGAGTGGAATGGAAAGGGATGG - Intergenic
1201098025 Y:10648678-10648700 AGTATTGGAAAGGAAAGGAGTGG - Intergenic
1201098882 Y:10656319-10656341 TGGATTGGAAAGGAATGGAATGG - Intergenic
1201098937 Y:10656691-10656713 TGGATTGGAATGGAAGTGAATGG - Intergenic
1201099175 Y:10658467-10658489 TGGATTGGAATGGAATGGGATGG - Intergenic
1201099924 Y:10663751-10663773 TGGAATGGAATGGAATTGGATGG - Intergenic
1201100191 Y:10665736-10665758 CGGATTGGAATGGAAATGAACGG - Intergenic
1201100527 Y:10668249-10668271 TGGAGTGGAAATGAAAGGGAAGG - Intergenic
1201100758 Y:10670960-10670982 TGGAGTGGAAAGGAAAGGAATGG - Intergenic
1201100937 Y:10672233-10672255 TGGAATGGAAAGGAAAGGAATGG - Intergenic
1201101480 Y:10678657-10678679 TGGAATGGAATGGAAAGGGAAGG - Intergenic
1201101500 Y:10678794-10678816 TGGAATGGAAAGGAAAGGAATGG - Intergenic
1201102564 Y:10689157-10689179 TGGATTGGAATGGAATGGGATGG - Intergenic
1201102700 Y:10690171-10690193 CGGATTGGAATGGAAATGAACGG - Intergenic
1201103145 Y:10693738-10693760 TGGAATGGAAAGGAATTGAATGG - Intergenic
1201103550 Y:10746637-10746659 TTGAGTGGAAAGGAAATGAATGG - Intergenic
1201103705 Y:10747798-10747820 TGTAATGGAATGGAAAGGAATGG - Intergenic
1201104594 Y:10754099-10754121 TGGAATGGAAAGGAAAGGAACGG - Intergenic
1201104659 Y:10754584-10754606 TGGAATGGAAAGGAAAGGAATGG - Intergenic
1201105401 Y:10759764-10759786 TGGAGTGGAATGGAAATGAAGGG - Intergenic
1201106262 Y:10765673-10765695 TGGAATGGAAAGGAAAGGAATGG - Intergenic
1201106421 Y:10766701-10766723 TGTAGTGGAATGGAATGGGATGG - Intergenic
1201106569 Y:10767765-10767787 TGGAATGGAATGGAAAGGGATGG - Intergenic
1201106683 Y:10768637-10768659 TGGATTGGAATGGAACTGAATGG - Intergenic
1201106981 Y:10770622-10770644 TGGAATGGAAAGGAAAGGAATGG - Intergenic
1201108438 Y:10781131-10781153 TGGATTGGAATGGAAATGAATGG - Intergenic
1201108595 Y:10782273-10782295 TGAATTGGAATGGAATGGGATGG - Intergenic
1201108612 Y:10782373-10782395 TGTAGTGGAATGGAATGGGATGG - Intergenic
1201108729 Y:10783140-10783162 TGAATTGGAATGGAATAGGATGG - Intergenic
1201108745 Y:10783230-10783252 TGTAGTGGAATGGAATGGGATGG - Intergenic
1201109495 Y:10788867-10788889 TGTATTGGAATTGAAAGGAAAGG - Intergenic
1201109846 Y:10791200-10791222 TGGAATGGAAAGGAATGGGATGG - Intergenic
1201112578 Y:10811124-10811146 TGGAATGGAAAGGAAAGGAAAGG - Intergenic
1201112618 Y:10811364-10811386 TGTATTGGAATGGAAAGGAGTGG - Intergenic
1201112740 Y:10812295-10812317 TGCATTGGAAAGGAATGGAATGG - Intergenic
1201114581 Y:10825726-10825748 TGCAGTGGAAAGGAAAGGAATGG - Intergenic
1201114869 Y:10827824-10827846 TGGATTGGAATGGAAAGGGGAGG - Intergenic
1201114889 Y:10827939-10827961 TGGAGTGGAAAGGAATTGAATGG - Intergenic
1201115024 Y:10828887-10828909 TGCAGTGGAAAGGAAAGGAATGG - Intergenic
1201115792 Y:10834445-10834467 TGGATTGGAATGGAATAGGAAGG - Intergenic
1201116008 Y:10835916-10835938 TGGAATGGAAAGGAACTGAACGG - Intergenic
1201117151 Y:10843510-10843532 TGGAATGGAAAGGAAAGGAATGG - Intergenic
1201117327 Y:10844717-10844739 TGGAATGGAAAGGAAAGGAATGG - Intergenic
1201117484 Y:10845760-10845782 TGGAATGGAAAGGAATTGAATGG - Intergenic
1201117886 Y:10848441-10848463 TGAATTGGAAAGGAATGGAATGG - Intergenic
1201118582 Y:10855676-10855698 TGGAGTGGAATGGAAATGAATGG - Intergenic
1201118597 Y:10855801-10855823 TGGAATGGAAAGGAAAAGAATGG - Intergenic
1201118694 Y:10856536-10856558 TGGATTGGAAAGGAAGGGAATGG - Intergenic
1201119027 Y:10858814-10858836 TGGAATGGAATGGAAATGAATGG - Intergenic
1201119446 Y:10861814-10861836 TGCAATGGAATGGAAAGGGATGG - Intergenic
1201120466 Y:10868937-10868959 GGTAATGGAAAGGAAAGGAATGG - Intergenic
1201121707 Y:10878383-10878405 TGGATTGGAAAGGAAAGGAGTGG - Intergenic
1201121718 Y:10878448-10878470 TGAATTGGAACGGAATGGGATGG - Intergenic
1201121790 Y:10878998-10879020 TGCATTGGAATGGAATTGAATGG - Intergenic
1201121866 Y:10879471-10879493 CGTAATGGAAAGGAAAGGAATGG - Intergenic
1201122720 Y:10885360-10885382 TGTAATGGAAGGGAATTGAATGG - Intergenic
1201123091 Y:10888161-10888183 TGCATTGGAAAGGAATAGAATGG - Intergenic
1201127062 Y:10925062-10925084 TGTAATGGAATGGAATTGAAGGG - Intergenic
1201127297 Y:10926737-10926759 TGGAGTGGAATGGAAATGAACGG - Intergenic
1201127435 Y:10927698-10927720 TGGAATGGAATGGAAATGAAAGG - Intergenic
1201127526 Y:10928277-10928299 TGTAGTGGAAAGGAGAGGAATGG - Intergenic
1201129735 Y:10943545-10943567 TGGAATGGAAAGGAAATGAGTGG - Intergenic
1201132788 Y:10967492-10967514 TGGAATGGAAAGGAAAGGAATGG - Intergenic
1201135146 Y:10984873-10984895 TGGAATGGAATGGAAATGAATGG - Intergenic
1201137017 Y:10997738-10997760 TGTATTGGAATGGAATGGAATGG - Intergenic
1201137098 Y:10998250-10998272 AGTAGTGGAATGGAAAGGGATGG - Intergenic
1201137647 Y:11002067-11002089 TGTAATGGAAAGGAATGGAATGG - Intergenic
1201142322 Y:11039148-11039170 TGGATTGGAATGGAATGGGATGG - Intergenic
1201173555 Y:11293703-11293725 TGTAGTGGAATGGAAAAGAATGG - Intergenic
1201174160 Y:11297622-11297644 TGCAATGGAAAGGAAAGGAATGG - Intergenic
1201174295 Y:11298535-11298557 TGGAATGGAAAGGAAAGGAATGG - Intergenic
1201174737 Y:11301440-11301462 TGGAATGGAAAGGAAAAGAATGG - Intergenic
1201174845 Y:11302159-11302181 TGTAATGTAATGGAATTGGATGG - Intergenic
1201196030 Y:11495396-11495418 TGTAATGGAAAGGAATGGAATGG + Intergenic
1201196464 Y:11499335-11499357 TGTAATGGAAAGGCATTGAATGG + Intergenic
1201198355 Y:11516307-11516329 TGGAATGGAATGGAAACGGATGG + Intergenic
1201198515 Y:11517777-11517799 TGTAATTGAAAGGAAATGAATGG + Intergenic
1201198941 Y:11521616-11521638 TGCAATGGAATGGAATTGGATGG + Intergenic
1201200324 Y:11534188-11534210 TGGAATGGAAAGGAATTGAATGG + Intergenic
1201200942 Y:11539759-11539781 TGGAATGGAAAGGAATTGAATGG + Intergenic
1201201328 Y:11543120-11543142 TGGAATGGAAAGGAATTGAATGG + Intergenic
1201201718 Y:11546481-11546503 TGGAATGGAAAGGAATTGAATGG + Intergenic
1201202154 Y:11550201-11550223 TGGATTGGAAAGGAATAGAATGG + Intergenic
1201203022 Y:11557761-11557783 TGGAATGGAAAGGAATTGAATGG + Intergenic
1201203447 Y:11561428-11561450 TGGATTGGAAAGGAATGGAATGG + Intergenic
1201203677 Y:11563363-11563385 TGGAATGGAAAGGAATTGAATGG + Intergenic
1201204101 Y:11567030-11567052 TGGATTGGAAAGGAATGGAATGG + Intergenic
1201204325 Y:11568970-11568992 TGGAATGGAAAGGAATTGAATGG + Intergenic
1201204751 Y:11572632-11572654 TGGATTGGAAAGGAATGGAATGG + Intergenic
1201204974 Y:11574572-11574594 TGGAATGGAAAGGAATTGAATGG + Intergenic
1201205403 Y:11578244-11578266 TGGATTGGAAAGGAATGGAATGG + Intergenic
1201206052 Y:11583850-11583872 TGGATTGGAAAGGAATGGAATGG + Intergenic
1201206701 Y:11589457-11589479 TGGATTGGAAAGGAATGGAATGG + Intergenic
1201207470 Y:11646161-11646183 TCGAATGGAAAGGAAATGAATGG + Intergenic
1201207476 Y:11646196-11646218 TGGAATGGAATGGAATTGGATGG + Intergenic
1201207712 Y:11648607-11648629 TGGAATGGAAAGGAATTGAATGG + Intergenic
1201207821 Y:11649581-11649603 TGCAATGGAAAGGAAAAGAATGG + Intergenic
1201208974 Y:11660050-11660072 TGTAATGGAATGGAATTGGATGG + Intergenic
1201209136 Y:11663250-11663272 TGGAATGGAAAGGAAAAGAATGG + Intergenic
1201210265 Y:11673724-11673746 TGGAATGGAAAGGAATTGAATGG + Intergenic
1201210547 Y:11676615-11676637 TGGATTGGAAAGGATTTGAAGGG + Intergenic
1201210632 Y:11677320-11677342 TGGATTGGAATCGAATTGGAAGG + Intergenic
1201211195 Y:11682200-11682222 TAGAATGGAATGGAAATGGAAGG + Intergenic
1201211559 Y:11685450-11685472 TGGAATGGAATGGAAATGAAAGG + Intergenic
1201212054 Y:11689801-11689823 TGGAATGGAAAGGAATTGAATGG + Intergenic
1201212608 Y:11694355-11694377 TATATTGGAATGGAAATAAAAGG + Intergenic
1201213051 Y:11698185-11698207 TGGATTGGAATGGAATTGAATGG + Intergenic
1201213414 Y:11701316-11701338 TGGAATGGAAAGGAAAGGAATGG + Intergenic
1201213418 Y:11701336-11701358 TGGAATGGAAAGGAATAGGATGG + Intergenic
1201213446 Y:11701515-11701537 TGGAATGGAAAGGAAATGAATGG + Intergenic
1201213874 Y:11705134-11705156 TGGAATGGAAAGGAAACGAATGG + Intergenic
1201214201 Y:11707819-11707841 TGGAATGGAAAGGAATAGGATGG + Intergenic
1201214957 Y:11714547-11714569 TGTATTGGAATGGAATGGAATGG + Intergenic
1201216722 Y:11729314-11729336 TGGAATGGAAAGGAAAGGGGTGG + Intergenic
1201216766 Y:11729619-11729641 TGGAATGGAATGGAATTGGATGG + Intergenic
1201217599 Y:11736708-11736730 TCGAATGGAAAGGAAATGAATGG + Intergenic
1201217954 Y:11739602-11739624 TGGATTGGAAAGGAATGGAATGG + Intergenic
1201218383 Y:11743448-11743470 TCTAATGGAAAGGAAATGAATGG + Intergenic
1201218994 Y:11748492-11748514 TGGAATGGAATGGAAATGAATGG + Intergenic
1201219055 Y:11748902-11748924 TGGATTGGAATGGAAAGGAAAGG + Intergenic
1201893124 Y:18964434-18964456 TGTCTTGCAAAGGGTATGGATGG - Intergenic
1202017639 Y:20428309-20428331 TGTCTTGGAAAGGTATTGGGAGG + Intergenic
1202589688 Y:26469405-26469427 TGACTTGGGAGGGAAATGGAAGG + Intergenic
1202606667 Y:26645069-26645091 TGGAGTGGAATGGAAAGGGAAGG + Intergenic
1202607406 Y:26650832-26650854 TGGAGTGGAATGGAAAGGGAAGG + Intergenic
1202608251 Y:26657357-26657379 TGGAGTGGAATGGAAAGGGAAGG + Intergenic
1202609360 Y:26665936-26665958 TGGAGTGGAATGGAAAGGGAAGG + Intergenic
1202609665 Y:26668193-26668215 TGTAATGGAATGGAATTGAATGG + Intergenic
1202609868 Y:26669787-26669809 TGGAGTGGAATGGAAAGGGAAGG + Intergenic
1202610556 Y:56675064-56675086 TGGATTGGAAAGGAATAGAATGG + Intergenic
1202610650 Y:56675922-56675944 TGGAATGGAAAGGAATTGAATGG + Intergenic
1202611211 Y:56680617-56680639 TGGATTGGAAAGGAATAGAATGG + Intergenic
1202611308 Y:56681475-56681497 TGGAATGGAAAGGAATTGAATGG + Intergenic
1202611728 Y:56685059-56685081 TGGAATGGAAAGGAATTGAATGG + Intergenic
1202612049 Y:56687759-56687781 TGGATTGGAAAGGAATAGAATGG + Intergenic
1202612141 Y:56688617-56688639 TGGAATGGAAAGGAATTGAATGG + Intergenic
1202612471 Y:56691338-56691360 TGGATTGGAAAGGAATAGAATGG + Intergenic
1202612566 Y:56692196-56692218 TGGAATGGAAAGGAATTGAATGG + Intergenic
1202612890 Y:56694897-56694919 TGGATTGGAAAGGAATAGAATGG + Intergenic
1202612987 Y:56695755-56695777 TGGAATGGAAAGGAATTGAATGG + Intergenic
1202613402 Y:56699334-56699356 TGGAATGGAAAGGAATTGAATGG + Intergenic
1202613731 Y:56702055-56702077 TGGATTGGAAAGGAATAGAATGG + Intergenic
1202613827 Y:56702913-56702935 TGGAATGGAAAGGAATTGAATGG + Intergenic
1202614154 Y:56705639-56705661 TGGATTGGAAAGGAATAGAATGG + Intergenic
1202614249 Y:56706482-56706504 TGGAATGGAAAGGAATTGAATGG + Intergenic
1202614567 Y:56709168-56709190 TGGATTGGAAAGGAATAGAATGG + Intergenic
1202614657 Y:56709996-56710018 TGGAATGGAAAGGAATTGAATGG + Intergenic
1202614983 Y:56712722-56712744 TGGATTGGAAAGGAATAGAATGG + Intergenic
1202615077 Y:56713580-56713602 TGGAATGGAAAGGAATTGAATGG + Intergenic
1202615400 Y:56716296-56716318 TGGATTGGAAAGGAATAGAATGG + Intergenic
1202615494 Y:56717154-56717176 TGGAATGGAAAGGAATTGAATGG + Intergenic
1202615818 Y:56719855-56719877 TGGATTGGAAAGGAATAGAATGG + Intergenic
1202615912 Y:56720699-56720721 TGGAATGGAAAGGAATTGAATGG + Intergenic
1202616237 Y:56723429-56723451 TGGATTGGAAAGGAATAGAATGG + Intergenic
1202616331 Y:56724287-56724309 TGGAATGGAAAGGAATTGAATGG + Intergenic
1202616662 Y:56727023-56727045 TGGATTGGAAAGGAATAGAATGG + Intergenic
1202616756 Y:56727881-56727903 TGGAATGGAAAGGAATTGAATGG + Intergenic
1202617080 Y:56730605-56730627 TGGATTGGAAAGGAATAGAATGG + Intergenic
1202617175 Y:56731463-56731485 TGGAATGGAAAGGAATTGAATGG + Intergenic
1202617500 Y:56734179-56734201 TGGATTGGAAAGGAATAGAATGG + Intergenic
1202617595 Y:56735037-56735059 TGGAATGGAAAGGAATTGAATGG + Intergenic
1202617916 Y:56737723-56737745 TGGATTGGAAAGGAATAGAATGG + Intergenic
1202618010 Y:56738581-56738603 TGGAATGGAAAGGAATTGAATGG + Intergenic
1202618336 Y:56741302-56741324 TGGATTGGAAAGGAATAGAATGG + Intergenic
1202618431 Y:56742160-56742182 TGGAATGGAAAGGAATTGAATGG + Intergenic
1202618757 Y:56744881-56744903 TGGATTGGAAAGGAATAGAATGG + Intergenic
1202618849 Y:56745739-56745761 TGGAATGGAAAGGAATTGAATGG + Intergenic
1202619176 Y:56748471-56748493 TGGATTGGAAAGGAATAGAATGG + Intergenic
1202619271 Y:56749329-56749351 TGGAATGGAAAGGAATTGAATGG + Intergenic
1202619597 Y:56752050-56752072 TGGATTGGAAAGGAATAGAATGG + Intergenic
1202619681 Y:56752803-56752825 TGGAATGGAAAGGAATTGAATGG + Intergenic
1202620009 Y:56755509-56755531 TGGATTGGAAAGGAATAGAATGG + Intergenic
1202620105 Y:56756367-56756389 TGGAATGGAAAGGAATTGAATGG + Intergenic
1202620425 Y:56759058-56759080 TGGATTGGAAAGGAATAGAATGG + Intergenic
1202620519 Y:56759916-56759938 TGGAATGGAAAGGAATTGAATGG + Intergenic
1202620846 Y:56762647-56762669 TGGATTGGAAAGGAATAGAATGG + Intergenic
1202620938 Y:56763490-56763512 TGGAATGGAAAGGAATTGAATGG + Intergenic
1202621260 Y:56766196-56766218 TGGATTGGAAAGGAATAGAATGG + Intergenic
1202621352 Y:56767039-56767061 TGGAATGGAAAGGAATTGAATGG + Intergenic
1202621677 Y:56769769-56769791 TGGATTGGAAAGGAATAGAATGG + Intergenic
1202621771 Y:56770627-56770649 TGGAATGGAAAGGAATTGAATGG + Intergenic
1202622380 Y:56827521-56827543 TGGAATGGAAAGGAAAGGAAAGG - Intergenic