ID: 945801830

View in Genome Browser
Species Human (GRCh38)
Location 2:214442297-214442319
Sequence TCTTTTAGGCAGAAGTGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 383
Summary {0: 1, 1: 0, 2: 4, 3: 46, 4: 332}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945801830 Original CRISPR TCTTTTAGGCAGAAGTGAGA AGG Intronic
900323144 1:2094886-2094908 TTTTATAGGCAGGAGAGAGAGGG - Intronic
900478750 1:2888272-2888294 TCTTTTGGGCAGACCAGAGAAGG + Intergenic
901440694 1:9276295-9276317 CCTTTGGGGTAGAAGTGAGAAGG - Intergenic
901957398 1:12796686-12796708 TCATTTAGGCTGGAGTGCGATGG + Intergenic
902828933 1:18997261-18997283 TCATTTAGGCAGAAATAACATGG + Intergenic
905387741 1:37615886-37615908 GTTTTTAAGCAGAAGTGTGATGG + Intronic
905882424 1:41473368-41473390 GCTTTTGGGCAGATGTGGGAGGG + Intergenic
908731250 1:67228822-67228844 TCTTATAAGCAGAAGGGAGAAGG - Intronic
908839229 1:68261615-68261637 TCTTTTGGGGAGAAGTAAGTTGG + Intergenic
908905931 1:69008860-69008882 TCTTTTGGCCAAAATTGAGATGG - Intergenic
909122229 1:71617807-71617829 TCTTATACACAGAAGTGAGATGG + Intronic
911013955 1:93312044-93312066 TCTTTTAGGCAGAATATAGTTGG - Intergenic
911062592 1:93760993-93761015 TCCTGTTGGAAGAAGTGAGATGG + Intronic
912856621 1:113174185-113174207 TCTTTTAGGCAGCATTTAGTTGG - Intergenic
913361113 1:117981199-117981221 TCTTTTTGGCATATGGGAGATGG - Intronic
914324176 1:146595336-146595358 TGTTATAGGAAGAAGTGAGAGGG - Intergenic
916273913 1:162972846-162972868 CCTTTTCAGCAGAAGTTAGAGGG + Intergenic
916354869 1:163893677-163893699 TCTTTAAGGGAGAAGAGAGAGGG + Intergenic
916443916 1:164854546-164854568 GCTTTTATGCAGGAATGAGAGGG - Intronic
917034035 1:170726580-170726602 GGTTTGGGGCAGAAGTGAGAGGG + Intronic
917510008 1:175662054-175662076 TGTTTTAGGAAGAAGAGAGCAGG + Intronic
917757723 1:178119299-178119321 TCTTACACACAGAAGTGAGATGG - Intronic
918064852 1:181093375-181093397 GCTTTTACGCAGCAGTCAGAAGG - Intergenic
918286545 1:183060983-183061005 TTTTTTTGTCAGAAGTGACATGG + Intronic
918750998 1:188269233-188269255 TCTTATACACAGATGTGAGATGG - Intergenic
919091258 1:192980909-192980931 TCTTATACCCAGAAGTGAGATGG + Intergenic
921375963 1:214474032-214474054 ACTTTTAGTCAGTGGTGAGATGG + Intronic
924578073 1:245298716-245298738 TCTTTAAGGCAGGAGGAAGATGG + Intronic
1064217661 10:13414030-13414052 GCTTTTAGGCAGAAAGAAGAAGG - Intergenic
1065625283 10:27623650-27623672 TCTTTTAGCTAGAATTGAAATGG + Intergenic
1066661357 10:37740522-37740544 CCTTCTAGGCAGAACTGTGAGGG + Intergenic
1068108476 10:52650418-52650440 TCTCTTACACAGAAGTGAGAGGG + Intergenic
1068538396 10:58266922-58266944 TTTTTTAGGGGGAGGTGAGAAGG - Intronic
1068561638 10:58521394-58521416 GCTTTTAGGCAGAAGTGGTTGGG - Intronic
1068762333 10:60726315-60726337 TGTTTTAGGCAGAAATTAGATGG - Intronic
1069615965 10:69806333-69806355 TGTATGAGGCAGAAGGGAGAGGG + Intronic
1070704859 10:78630338-78630360 ACTTTGAGGCAGAAGAGAGGAGG + Intergenic
1071288141 10:84167590-84167612 TCTTTTAAGAAAAAGTGACAAGG - Intergenic
1071745278 10:88411776-88411798 TGTTTTGGGAAGAAGTAAGAAGG + Intronic
1071800893 10:89058767-89058789 CCTTTCAGGTAGGAGTGAGAAGG - Intergenic
1072294796 10:93998582-93998604 GCTTTGAGGCCAAAGTGAGATGG + Intronic
1072303327 10:94083575-94083597 TCTTTAGGCCAGAAATGAGAGGG - Intronic
1073426564 10:103458780-103458802 TCTTGGAGGCAGCAGTGAGTTGG - Exonic
1073840018 10:107487825-107487847 TATTTTAAGCAGATGTGAGCTGG - Intergenic
1074628255 10:115218922-115218944 TCTTATACACAGAAGTGAGGTGG - Intronic
1075107151 10:119547798-119547820 TTTTATAGGCAGACTTGAGAAGG + Intergenic
1075660769 10:124194022-124194044 TCTTTTGAGCAGAAGGAAGAAGG + Intergenic
1076074994 10:127526469-127526491 ACTTTCAGGCAGAAGGGAGGGGG + Intergenic
1076113394 10:127878536-127878558 TCTTTTAAGCACTAGGGAGAAGG + Intronic
1076127788 10:127989470-127989492 TCTTTAAGGGAGAGGTGACAAGG - Intronic
1077959547 11:7060182-7060204 TGTCTCAGGCAGAAGAGAGAGGG - Intronic
1079000511 11:16751065-16751087 TCTTATACACAGAAGAGAGACGG + Intronic
1079570064 11:21932039-21932061 TCGTATACGCAGAAGTGAGATGG + Intergenic
1080323524 11:31043392-31043414 TCCTGAAGGCAGAACTGAGATGG + Intronic
1081792830 11:45801095-45801117 TTTTCTAGGCAAAATTGAGAAGG - Intergenic
1082048553 11:47751276-47751298 TCTTCTAGTCGGAATTGAGATGG - Exonic
1082641704 11:55669096-55669118 TATTTTAGGCAGCAGTGAAAAGG - Intergenic
1082644469 11:55704483-55704505 TCTTATAGGCAGAAGATAGATGG - Intergenic
1082987175 11:59179065-59179087 TCTTTTAGGCAAATCTGTGAGGG + Intronic
1083858397 11:65405249-65405271 TCTGTGACGCAGCAGTGAGAAGG - Intronic
1084469311 11:69346810-69346832 TATTTTTGGCAGAAGTGCCATGG - Intronic
1085707163 11:78796718-78796740 TATTTGTGGCAGTAGTGAGAGGG - Intronic
1086266768 11:85008463-85008485 TCTTTTAGGGAGAAGTGAAGGGG + Intronic
1086486741 11:87311985-87312007 TCTTTTAGGCTGCAGAGAGTTGG + Intronic
1087418434 11:97888668-97888690 GCTTTTAGGTAGAAGGGGGAAGG - Intergenic
1087647280 11:100822910-100822932 TTTGTTAGCCAAAAGTGAGAAGG + Intronic
1088667596 11:112108952-112108974 TCTTATACACAGAAGTGAGATGG - Intronic
1088808430 11:113372416-113372438 TCTTGTAGACAGTTGTGAGAAGG - Intronic
1090045762 11:123331604-123331626 TGTTATAGACAGAAGGGAGAAGG - Intergenic
1091310224 11:134569109-134569131 TCTGTTGGGCAGAAGGGCGATGG + Intergenic
1093723044 12:22467710-22467732 CATTTTAGGGAGAATTGAGAGGG - Intronic
1094558078 12:31522836-31522858 TTTTTTAGGCAGGAGGGAGTGGG + Intronic
1095208272 12:39463023-39463045 TCTTTTAGAAAGAGGTCAGAGGG + Intergenic
1096197849 12:49660193-49660215 TGTTTTAGGAAGGATTGAGAGGG - Intronic
1097281951 12:57850451-57850473 TATTTTAGGCAGAAGTTAGAAGG - Intergenic
1097633987 12:62099833-62099855 TCTCTTAGGCTGAAGTGATGTGG - Intronic
1098455957 12:70672973-70672995 TCTTCTAGGTAGAAGGGAGAAGG + Intronic
1098812884 12:75118605-75118627 GTTTTTAGGAAGAAGTCAGAAGG + Intronic
1098825299 12:75288940-75288962 TCCTTTAGACAGAAGTGTCAGGG + Intronic
1099119865 12:78675387-78675409 ACCTTCAGGCACAAGTGAGATGG + Intergenic
1099329569 12:81266253-81266275 TCTTTCTGGAAGAAGTGGGAAGG - Intronic
1099627506 12:85093493-85093515 TCTTATACAGAGAAGTGAGATGG + Intronic
1103726618 12:123000375-123000397 TCGTCTAGGCAGAAGTGATGTGG - Intronic
1104141135 12:125986567-125986589 TCTTTCAGGCAAAAGTAGGAGGG - Intergenic
1104180557 12:126376201-126376223 CCTTTTAAGCAGAAGCCAGAGGG + Intergenic
1104371713 12:128229241-128229263 TGCTTTAGGCAGAAGTGTCAAGG + Intergenic
1105891572 13:24685979-24686001 TCTTAGAGGCAGAAGGGACATGG + Intronic
1106169763 13:27279206-27279228 TCTTTTTCCCAGAAGTGAAATGG - Intergenic
1106476460 13:30102466-30102488 TCTTTTAGGCAGAATCTGGAAGG - Intergenic
1106584156 13:31042923-31042945 CCTTTCAGGGAGAAGTGAGGGGG + Intergenic
1108433784 13:50381267-50381289 TATTTTAGGAAGAAGGGAAATGG + Intronic
1108510331 13:51149833-51149855 GTTTTTAGGCAGAGTTGAGATGG + Intergenic
1108687310 13:52831922-52831944 GCTTTTAGGTAGATTTGAGACGG - Intergenic
1108716177 13:53080368-53080390 TCTTTTGGGAAGCAGTGAGTTGG + Intergenic
1109489374 13:63075990-63076012 TCATTTAGTCAGAAGAGATATGG - Intergenic
1109878684 13:68441120-68441142 CCTCATAAGCAGAAGTGAGAAGG + Intergenic
1112214170 13:97413002-97413024 TCTTCTAGGCAGAAGGAACATGG - Intergenic
1113401368 13:109997006-109997028 TCTGATACACAGAAGTGAGATGG + Intergenic
1113428785 13:110231276-110231298 TCTTGTACGTGGAAGTGAGAAGG + Intronic
1114349971 14:21839039-21839061 TCTTTCAGGCAGAAAAGAAATGG + Intergenic
1115751828 14:36501564-36501586 TCATTTAAGCAGGAGTGAGAGGG - Intronic
1116142628 14:41018414-41018436 ACTTTTATCCAGAAGTTAGAAGG - Intergenic
1116478318 14:45367030-45367052 TCTTCAAGGGAGAAGGGAGAAGG - Intergenic
1117078750 14:52129805-52129827 TCTCTTAGGCAGGAGTGAAGAGG - Intergenic
1120141169 14:80931491-80931513 TCTTATACACAGAAGTGAGATGG + Intronic
1121557915 14:94852179-94852201 TCTTGTAGGCAGAAGTCTCAGGG - Intergenic
1122150452 14:99722912-99722934 ACATTTACCCAGAAGTGAGAGGG + Intronic
1123437640 15:20267024-20267046 TCTTTTAGGCTAAAATGACATGG + Intergenic
1125000157 15:34761229-34761251 TATTTTATGCAGAAGTGGGATGG + Intergenic
1125025427 15:35024659-35024681 GCTTTTAGACAGAAAAGAGAAGG - Intergenic
1125270411 15:37932801-37932823 TCTTTCAGGAAGAAGGGAGATGG + Intronic
1125357826 15:38834741-38834763 TGTGTTAGGGAGAAGTGATAGGG + Intergenic
1126433393 15:48610588-48610610 TATTTTGGGCAGAACAGAGAAGG + Intronic
1126457149 15:48875986-48876008 TCTTACACACAGAAGTGAGATGG + Intronic
1127243598 15:57146927-57146949 TCTGTTAGGCAGAAATGAGTTGG + Intronic
1127907138 15:63384251-63384273 TCTTTAAAGGAGAAGGGAGAGGG - Intergenic
1128656410 15:69465531-69465553 TCTTTTAGAATTAAGTGAGATGG + Intergenic
1130858352 15:87862323-87862345 TCTTTTAGGAATAAATGAGGTGG - Intronic
1131296250 15:91151805-91151827 TCTTCCAGGCAAGAGTGAGATGG + Intronic
1132002969 15:98198417-98198439 TCTGTTAAGTAGAAGAGAGAGGG - Intergenic
1134654209 16:15935042-15935064 TCTTTTCTGCAGAAGTGGAAAGG + Intergenic
1135239448 16:20791023-20791045 TCTTTTCGGGAAGAGTGAGAGGG + Intronic
1135540708 16:23328079-23328101 TCTTTAAGTCACAAGTGGGAAGG + Intronic
1136846937 16:33583831-33583853 TCTTTTAGGCTAAAATGACATGG - Intergenic
1137468101 16:48729591-48729613 TCTTTTAGGAAGAAGAAGGAGGG + Intergenic
1137717418 16:50606846-50606868 TCTTTCATGCAGAAGAGAGACGG - Intronic
1138840147 16:60491757-60491779 TCTCTGATGCAGAAGGGAGAAGG + Intergenic
1140009382 16:71115509-71115531 TGTTATAGGAAGAAGTGAGAGGG + Intronic
1140415893 16:74774018-74774040 TCTTTGAAGCAGAAGTGAGGTGG + Intronic
1141713071 16:85711274-85711296 TCATTTAGGCTGAAGTGCAATGG - Intronic
1142438213 16:90076660-90076682 TCTTTTAGGCTGAAGAGATCTGG + Intronic
1203108645 16_KI270728v1_random:1432486-1432508 TCTTTTAGGCTAAAATGACATGG - Intergenic
1146426656 17:32746382-32746404 TCTTATAGGAAGAAGTGGGAAGG - Intronic
1146767124 17:35533627-35533649 TTTTCTAGACAGAAGTAAGAAGG + Intronic
1148072207 17:44915017-44915039 ACTGTGAGGCAGAAGTGAGGAGG - Exonic
1149133034 17:53330604-53330626 TCTTCTACCCAGAAGTGATAGGG - Intergenic
1149139986 17:53420672-53420694 TCTTATACACAGAAGTAAGATGG + Intergenic
1150175261 17:63048156-63048178 TGCTTTAGGAAGAAGTGTGAGGG + Intronic
1150649897 17:67003064-67003086 TCTTATTGTCAGAAGTGAGCAGG - Intronic
1150915304 17:69430453-69430475 TCTTTCAGGCAGAACTAATATGG - Intronic
1153489415 18:5631401-5631423 TCTTTGGGGCAGAAGTGGAAGGG - Intergenic
1153704477 18:7731700-7731722 TCTTTTAGGATTAAGGGAGAGGG + Intronic
1154344941 18:13534082-13534104 TTTTTGTGGCAGAAGTGAGAAGG - Intronic
1155112187 18:22726852-22726874 TCTTATACACAGAAGTGAGATGG + Intergenic
1155907332 18:31467866-31467888 TCTTTATGTCAGAAGTGTGAGGG - Intronic
1156362504 18:36396147-36396169 TCTTTTAGGCAAAAATAACAAGG - Intronic
1157457075 18:47841940-47841962 TCTTTTAAACAGAAGGCAGACGG - Exonic
1158448757 18:57544306-57544328 CCTTTTAGGCAGCAGTGTGCTGG + Intergenic
1159315107 18:66762810-66762832 TATTTTAGGCATACATGAGAAGG + Intergenic
1159792478 18:72799737-72799759 TCTTACACACAGAAGTGAGATGG + Intronic
1160332503 18:78007587-78007609 TCTCTTATGTAGAAGAGAGAAGG + Intergenic
1162085303 19:8245288-8245310 TCATTTAGGCTGAAGTGTGGTGG + Intronic
1162124478 19:8491891-8491913 TCTAGGAGGCAGAAGTGAAATGG - Intronic
1163949038 19:20567293-20567315 TCTGTGAGGCAAATGTGAGAGGG - Intronic
1164090474 19:21947401-21947423 ATTTTTAGGCAAAAGTTAGAAGG - Intronic
1164533389 19:29065041-29065063 TCTTTTATCCAGCAGTGAGATGG - Intergenic
1164704005 19:30305737-30305759 TCTTCTAGGCAGAATTGGGTGGG + Intronic
1165033622 19:33016910-33016932 TCTTTTAGGCTAAAATGACATGG + Intronic
1165999265 19:39868336-39868358 TCTTTCAGGCAGGAGTGCGGTGG - Intronic
1166643546 19:44514286-44514308 AGGTTCAGGCAGAAGTGAGATGG - Intronic
924960145 2:27381-27403 TCTGTTAGGCAGAAGAAAGGTGG - Intergenic
925072795 2:984229-984251 TCTTTTGGGTAAAAGTGGGAAGG - Intronic
925900611 2:8506675-8506697 TCTCTGAGGCAGCAGGGAGAGGG + Intergenic
926824644 2:16892239-16892261 TCTTATATACAGAAGTGAAATGG + Intergenic
927470674 2:23373703-23373725 TGTTTTAGGCAGCTGCGAGATGG + Intergenic
931027861 2:58134240-58134262 TCTTAAAGGGAGAAGGGAGAGGG - Intronic
931098897 2:58973356-58973378 TGCTTTAGGCAGAATTAAGATGG - Intergenic
931243007 2:60469034-60469056 TCTTTTTGACAAAAGTGAAAGGG + Intronic
932991546 2:76794247-76794269 TCTTATACTCAGAAGAGAGAAGG + Intronic
933480587 2:82852118-82852140 TCTTATACACAGAAGTGAGTTGG - Intergenic
934577643 2:95413069-95413091 TCTTCTCGGTAGAAGGGAGAAGG + Exonic
934639934 2:96021772-96021794 TCTTCTCGGTAGAAGGGAGAAGG + Intergenic
934793712 2:97083623-97083645 TCTTCTCGGTAGAAGGGAGAAGG - Exonic
934960727 2:98670179-98670201 CCTTTTAGGCAGGAGTAAGATGG + Intronic
935125035 2:100215411-100215433 TCTCTAAGGAAGAAGTGAAATGG + Intergenic
937876884 2:126832710-126832732 CTTATTAGGCAGATGTGAGAGGG - Intergenic
938653247 2:133405761-133405783 CCTCTGAGGCAGAAGTGAGCTGG - Intronic
938942135 2:136178630-136178652 TCTTCAAGGGAGAAGGGAGAGGG + Intergenic
939656907 2:144837238-144837260 TCTTTTAGGCAGATTTTTGAAGG - Intergenic
942595198 2:177585730-177585752 TCCATTTGGCAGAAATGAGAAGG - Intergenic
945754797 2:213832556-213832578 TCTTCAAGGAAGAAGGGAGAAGG - Intronic
945801830 2:214442297-214442319 TCTTTTAGGCAGAAGTGAGAAGG + Intronic
945911512 2:215655224-215655246 TCTTTAAGGGGGAAGGGAGAAGG + Intergenic
945968312 2:216211516-216211538 TCAAGTGGGCAGAAGTGAGATGG + Intergenic
946464944 2:219903502-219903524 GCTTCTAGACAGAAGAGAGAGGG - Intergenic
946473417 2:219984185-219984207 TCTTCTAGGCACAAATTAGAAGG - Intergenic
946648291 2:221863934-221863956 TCTTTTAGGCTGAAATGATAAGG - Intergenic
946975477 2:225144235-225144257 TCTTTTAGGCAGAATATAGTTGG - Intergenic
947386330 2:229594275-229594297 TCTTTTTCTCAGAAGTGATATGG - Intronic
947800524 2:232926739-232926761 TCTTTCTGGCAGAAGTGATAAGG + Intronic
947968285 2:234300754-234300776 TCTCTCCGGCAGAAGTGAGGAGG - Intergenic
948339477 2:237237957-237237979 TCCTTCAGGCAGAAGCTAGAAGG + Intergenic
1169076564 20:2763467-2763489 TCTTTTTGGAAGAAGTTAAAAGG - Intergenic
1169377017 20:5074229-5074251 GCTTTTAGGCAGAAATGGGAGGG - Intronic
1173340690 20:42150158-42150180 TATTTTAGGCATAACTCAGAAGG - Intronic
1174675776 20:52353106-52353128 TCTTGTAGGCAGAATTAAGATGG + Intergenic
1174803390 20:53584316-53584338 TCTTTAAGGAAGTAGAGAGAGGG - Intronic
1175418855 20:58818700-58818722 TCTTGTATGCAGCAGTAAGAAGG + Intergenic
1177356939 21:20020363-20020385 TATTTTAAGCAGAGCTGAGAAGG - Intergenic
1178522286 21:33296401-33296423 TCACTGAGGCAGATGTGAGATGG - Exonic
1180118825 21:45731793-45731815 TGTAATAGCCAGAAGTGAGAGGG - Intronic
1183534377 22:38388689-38388711 TCTTTAAGGAAGTAGAGAGAGGG - Intronic
1184019540 22:41811330-41811352 TGTCTCAGGCAGAAATGAGATGG + Intronic
950101080 3:10357398-10357420 CATTTTAGGCAGCAGGGAGAGGG - Intronic
950544071 3:13628676-13628698 TCTGTTGGGCAGATGTGAGAGGG + Intronic
950758489 3:15198637-15198659 TCTTATACACAGAAGTGAGGTGG - Intergenic
950758786 3:15202133-15202155 AATTTTAGGAAGAAGTGAGTTGG - Intergenic
951477910 3:23127976-23127998 ACTTGAAGGAAGAAGTGAGAAGG + Intergenic
952804104 3:37330503-37330525 CCTTTTAGGTAGAAGGGTGAGGG + Intronic
952804273 3:37332306-37332328 TTTTTTAGCCAAAAGAGAGATGG - Intronic
952809770 3:37391414-37391436 TCTTTTAAGAAGAAAGGAGAAGG + Intronic
952813294 3:37424345-37424367 TCCTTTATGCAGAAGGCAGATGG - Intronic
953670383 3:44957414-44957436 TCTTTCTGGCAGTAGTGAGGAGG - Intronic
954212072 3:49103558-49103580 TCTTCTGGGCACGAGTGAGAAGG - Intronic
954553759 3:51502828-51502850 TCTTTTTCCCAGAAGTGGGAAGG - Intergenic
955667151 3:61362675-61362697 GCTTTTAGGCAGTAAGGAGAGGG - Intergenic
956039178 3:65128334-65128356 TCTTTTAGGCAGAAGTTATAAGG + Intergenic
956152931 3:66262142-66262164 TCTTATATGAAGAGGTGAGATGG + Exonic
956440945 3:69279811-69279833 CCTTTTCTGCAGAAGTGGGAAGG - Intronic
957219496 3:77363745-77363767 TCTTCAAGGAAGAAGGGAGAAGG + Intronic
957284205 3:78196454-78196476 TCTTTTAGGAAGGAATGAGTAGG - Intergenic
958103200 3:89039957-89039979 TCTTGTATGCAGAAATCAGAAGG + Intergenic
959017266 3:101149074-101149096 TCTTTTAGGGAAAAGTGAAGAGG + Intergenic
959241025 3:103794158-103794180 TTTTTTAGGAAGGAGTGAGGGGG - Intergenic
959598733 3:108155358-108155380 TGGTTTAGGCAGATGTGACATGG - Intergenic
959822368 3:110751723-110751745 TCTTGTAGGGAGAATTCAGACGG - Intergenic
959829353 3:110841961-110841983 CCATTTAAGCAGAAGTCAGATGG + Intergenic
960245157 3:115392356-115392378 CCTTCCAGGCAGAAGTGTGATGG - Intergenic
961960686 3:130851716-130851738 TCATTTAGGAAGAAGTGTGGCGG + Intronic
962485234 3:135835996-135836018 TCTTATAGGAAAAAGTGAGATGG + Intergenic
963260504 3:143187066-143187088 GTTTTTAGGAAGAAGGGAGATGG + Intergenic
963537539 3:146546413-146546435 TCTTATACACAGAAATGAGATGG - Intergenic
963758043 3:149256614-149256636 TCTTTTAGGAAGAAATTAAAGGG + Intergenic
963922844 3:150922669-150922691 TCTCCTGGGCAGAAATGAGAAGG - Intronic
965890433 3:173507037-173507059 TGTTTCAGCCTGAAGTGAGAAGG - Intronic
966951404 3:184821784-184821806 TCTTTTCTGCAGAAGCGAGCTGG + Intronic
967187480 3:186957434-186957456 TCTTTTAGGCGGGAGGGACAGGG - Intronic
967319351 3:188179941-188179963 ACTTTTAGGATGAAGTCAGAAGG + Intronic
970603805 4:17660935-17660957 TCTGCTTGGCAGAGGTGAGAAGG + Intronic
973063394 4:45758235-45758257 CCTTTTCACCAGAAGTGAGATGG - Intergenic
974425038 4:61731628-61731650 TCTCCAAGGCAGAAGTGGGAAGG - Intronic
975157088 4:71084112-71084134 CCTTTGAAGCAGGAGTGAGATGG - Intergenic
975237132 4:72012306-72012328 TCTTTTATGGTGGAGTGAGAGGG + Intergenic
975417393 4:74120751-74120773 TCTTATATACATAAGTGAGATGG + Intronic
975625292 4:76339923-76339945 TCTTATACACAGAAGTGAGATGG + Intronic
975883740 4:78940536-78940558 TATTCTGGGCTGAAGTGAGAGGG + Intergenic
976180295 4:82392468-82392490 TCTTATACACAGAGGTGAGATGG + Intergenic
977229804 4:94438285-94438307 GCTATTAGGCAGAAGAGTGAGGG + Intergenic
977258464 4:94767067-94767089 TCTTCTAGCCAGAAGCCAGATGG + Intronic
977791606 4:101111397-101111419 TCTGTTAGGCAGCAAGGAGAGGG - Intronic
977830160 4:101581028-101581050 TCTTTTAGGCAGAATACAGCTGG + Intronic
977853923 4:101864918-101864940 TCTTTAAGGCAGAAGAGAGAAGG + Intronic
978084031 4:104627808-104627830 TCTTTTAGGATGAACTCAGAGGG - Intergenic
978286774 4:107087534-107087556 TCATTTAGGCTGAGGTGAAAGGG - Intronic
978349785 4:107809510-107809532 TCTTTTTGGCACTAGTGACATGG - Intergenic
979623313 4:122819724-122819746 TCTTATACACAGAAGTGAGATGG - Intergenic
979829176 4:125279497-125279519 TCTTATACACAGAAGGGAGATGG + Intergenic
980964418 4:139507007-139507029 TCTGCGAGGCAGAAGTCAGAAGG + Exonic
981038444 4:140196149-140196171 ACTTGTAGGAAGAAGTAAGAGGG - Intergenic
982709331 4:158744467-158744489 TCTTCTAGGGAGAAGAGAGAAGG + Intergenic
983693145 4:170497155-170497177 TATTTTAGGCTGAAGTGTGCGGG + Intergenic
984174126 4:176395434-176395456 TTTTTCAGGCTGAAGGGAGATGG - Intergenic
985175178 4:187192890-187192912 TCCTTTTGGAAGCAGTGAGATGG - Intergenic
986230527 5:5860643-5860665 TGTTGTAGGCAGAACTGAGGGGG - Intergenic
986247165 5:6019837-6019859 TCTTTTAATCAGAACTAAGAGGG - Intergenic
987316435 5:16728941-16728963 TCTTTTAAGCAGCAGCAAGAAGG + Intronic
988499144 5:31769536-31769558 TCTTTTAGGCAAAATTCAGCTGG - Intronic
988507834 5:31839515-31839537 GGTTTTAGGTAGAAGGGAGATGG + Intronic
989705252 5:44322071-44322093 CCTTATACACAGAAGTGAGATGG + Intronic
991391797 5:66151794-66151816 GCCCTTAGGCAGAAGTGAGTTGG + Intronic
992986327 5:82234209-82234231 ACTTTTAGGCAGATGGGGGAGGG + Intronic
993308186 5:86295826-86295848 TCTTCTAGGGAGGAGTGGGAGGG - Intergenic
993801363 5:92342672-92342694 TCTTTTAGACAGAATAGAGTTGG + Intergenic
995250390 5:109986196-109986218 TCTTTTAGGCAGGGTTGAGGTGG + Intergenic
995334310 5:110982412-110982434 ATTTTTAGGAAGAATTGAGAAGG - Intergenic
995463972 5:112431748-112431770 TCTCATACACAGAAGTGAGATGG - Intergenic
995659357 5:114463844-114463866 ATTTTTACGCTGAAGTGAGAAGG + Intronic
995861492 5:116645456-116645478 TCTTATACACAGAAGTGAGATGG - Intergenic
996004008 5:118399531-118399553 TCTTCCAGCCAGAAATGAGAAGG + Intergenic
996708423 5:126520377-126520399 GCTTTTAGGCAGATGGGGGAGGG - Intergenic
997862576 5:137431442-137431464 GCTGTTAGGAATAAGTGAGATGG + Intronic
999876231 5:155809306-155809328 TCTTTTAGTTAGCAGTGAGATGG - Intergenic
1000006706 5:157192143-157192165 TCTTTTATACATAGGTGAGATGG + Intronic
1001752026 5:174138676-174138698 TCCTTGAGGCAGAAATGAGCAGG - Intronic
1001859792 5:175044074-175044096 CCTGTTAGGGAGAAGAGAGATGG - Intergenic
1004477784 6:15989827-15989849 GCTTTTAGGCAGAAAGGGGAAGG - Intergenic
1004727623 6:18326383-18326405 TATTTTAGGCAGTATGGAGAAGG - Intergenic
1004797322 6:19101910-19101932 TCTTTTTTTCAGAAGTGAGTAGG - Intergenic
1005192675 6:23243645-23243667 TCCTTGAGGCAAAAGTTAGAAGG - Intergenic
1006711733 6:36079332-36079354 TCTTTCAGGCTGAAGGAAGAGGG - Intronic
1007055201 6:38876299-38876321 TCTTTTAAGGAGCAGTGAGCTGG - Intronic
1007906633 6:45467796-45467818 AGTTTTAGGCATAAGGGAGATGG - Intronic
1008318520 6:50077676-50077698 TCTTTAAGGCAGGAGAGAGGAGG - Intergenic
1008336643 6:50313666-50313688 CCTTTTAGGAAGCACTGAGAAGG + Intergenic
1008604819 6:53130166-53130188 TCTTTTTGGGAGAACAGAGATGG - Intronic
1008672275 6:53782010-53782032 TCTTTTAGGCAGAATATAGTTGG - Intergenic
1009333398 6:62454853-62454875 TCTTGTAGGCAGCATTTAGATGG + Intergenic
1009439057 6:63654701-63654723 TCCCTTAGGCAGCAGTTAGAGGG + Intronic
1009674209 6:66795893-66795915 TCTTATACTCAGAAGTGAGATGG - Intergenic
1011057175 6:83217913-83217935 ACATTTAGGCAGAGGTAAGATGG + Intronic
1012001331 6:93658805-93658827 TCTCTTAGGCAGAAATGGGCAGG - Intergenic
1012614486 6:101260038-101260060 TCTTATACTCAGAAGTGAGATGG + Intergenic
1013036124 6:106385202-106385224 TCTTATACACAGAAGTGAGATGG - Intergenic
1013170267 6:107631193-107631215 TTTTTTAGCCATAAGGGAGAAGG - Intronic
1013609769 6:111783712-111783734 TCTTTTGGGAAGAAGAAAGAGGG - Intronic
1013849292 6:114494592-114494614 TCTTTAATGCAGAGTTGAGAAGG + Intergenic
1014184213 6:118416868-118416890 TCTTTTATGCATCAGTTAGAAGG - Intergenic
1014445174 6:121518388-121518410 TCTTGCAGGCTGAAGTGGGAGGG + Intergenic
1014647653 6:123994372-123994394 TCTCCAAGGCAGAATTGAGAGGG - Intronic
1016442543 6:144098661-144098683 TCTTATACACAGAGGTGAGATGG - Intergenic
1017307288 6:152933739-152933761 TCATTTAGGCAAACATGAGATGG + Intergenic
1017363094 6:153599385-153599407 CCTTATAGCCAGAACTGAGAGGG - Intergenic
1018572698 6:165227370-165227392 TCTCTTAGAGAGAAGCGAGAAGG + Intergenic
1018647069 6:165958864-165958886 TCTTTTGGGCAGAAGCAAGAGGG - Intronic
1022586488 7:31618248-31618270 TTGTTTAGGGAGAAGTGAGGGGG - Intronic
1023903896 7:44507531-44507553 GGTTTTAGGCAGAAGTGAAGTGG + Intergenic
1026837073 7:73646586-73646608 GCAATTAGGGAGAAGTGAGATGG + Intergenic
1027403353 7:77831956-77831978 TCTTATATGCAGAAGTAAGATGG + Intronic
1027577157 7:79945417-79945439 TCTTTAAGCCAGAAGAGAGTGGG - Intergenic
1028019209 7:85749784-85749806 GAGTTCAGGCAGAAGTGAGATGG - Intergenic
1028881134 7:95881125-95881147 TAACTTAGGCAGAAGGGAGAGGG + Intronic
1029705389 7:102273208-102273230 TCTTCTAGGCAGTGGTGAGTTGG + Intronic
1030222931 7:107116647-107116669 TCTTTTAGGCAAATGTGATTTGG + Intronic
1031071431 7:117166558-117166580 CCTTTTAAGCAGGAGTGTGATGG + Intronic
1031614352 7:123863867-123863889 TCTTTGGGGAAGGAGTGAGAAGG + Intronic
1031843178 7:126772028-126772050 AATTTTAGGCAGAAGTGGAAAGG - Intronic
1032306824 7:130741871-130741893 TCTTATAAGCAGAAATAAGAAGG - Intergenic
1032619293 7:133511528-133511550 ACTTTTAGGCAGATGGGGGAGGG + Intronic
1033426295 7:141247573-141247595 TCTTTTTGGCAGTAGGGAAAGGG + Intronic
1033447676 7:141436781-141436803 TATTTTTAGCAGAAGGGAGAGGG - Intronic
1036451308 8:8870424-8870446 TCATTTAGGCTGGAGTGAGGTGG - Intronic
1037023180 8:13999235-13999257 TCTTATACACAGAAGTGAGATGG - Intergenic
1038584589 8:28777547-28777569 TTTTTTTGGCAGGGGTGAGAGGG + Intronic
1039019344 8:33187849-33187871 GCTTTTAGGCAGATGGGGGAGGG - Intergenic
1041060902 8:54033459-54033481 TATTTATGGCAGAAGGGAGAAGG + Intergenic
1042231519 8:66559822-66559844 TCCTTTGGCCAAAAGTGAGATGG - Intergenic
1042452183 8:68960524-68960546 TCTTTTAGGGAGAAAGGAGAGGG - Intergenic
1044514121 8:93118845-93118867 TCTTTTTGGCAGAAGCAAGTAGG + Intergenic
1044924288 8:97196893-97196915 TCTTTCAGGCTGAAATGATAGGG - Intergenic
1044960605 8:97527357-97527379 TCTATAAGCCAGAAGTGAGTGGG - Intergenic
1047262652 8:123275571-123275593 TCGCTTAGGCTGAAGTGAAATGG + Intergenic
1047266247 8:123312162-123312184 GATTTTATGCAGAAGGGAGAAGG - Intergenic
1047900181 8:129412295-129412317 TCTTCTAGGCTGTAGTGATAGGG - Intergenic
1047934436 8:129763027-129763049 TATTTTAGGAAGATGGGAGAAGG - Intronic
1048146148 8:131845770-131845792 GCATTTAGTCAAAAGTGAGATGG - Intergenic
1048382130 8:133874533-133874555 TCTCTAAGGCAGATGTGACATGG - Intergenic
1049282415 8:141756887-141756909 TCATTTAGGCAGAACCAAGATGG - Intergenic
1049570278 8:143367090-143367112 TGATTCAGGCAGAAGTGAGAAGG + Intergenic
1051077032 9:13251493-13251515 TCTGTGAGGCAAAAGAGAGATGG - Intronic
1051467052 9:17391280-17391302 TCTTCAAGGCAGAACTGAGAAGG + Intronic
1052340847 9:27362850-27362872 TCTGTAAGGCAGAAGGGAAAAGG - Intronic
1052343244 9:27383347-27383369 TCATAAAGGCAGAAATGAGAGGG - Intronic
1054750858 9:68904866-68904888 TCTTTTAGGAAGAAAGGAAAAGG - Intronic
1054844971 9:69785132-69785154 CATTTTAGCTAGAAGTGAGAGGG + Intergenic
1055984042 9:82037392-82037414 CCATTTATGCAGAAGTGGGAAGG - Intergenic
1056396021 9:86181910-86181932 TCTTTTAGGCGGAAAGGAGGAGG + Intergenic
1057587964 9:96346518-96346540 GTTTTTAGGCAGAAAGGAGAAGG + Intronic
1058229226 9:102405643-102405665 TCTTGTACACAGAAGTGAGGTGG + Intergenic
1058255179 9:102752949-102752971 ATTTTCAGGCAGGAGTGAGATGG - Intergenic
1058460645 9:105179260-105179282 TCCTTCAGGCTGAAGTGAGGTGG + Intergenic
1058528551 9:105884158-105884180 TCCTAGAGGCACAAGTGAGATGG - Intergenic
1058709426 9:107666672-107666694 TTTTTTAGCCAGGAGGGAGATGG + Intergenic
1058809764 9:108628072-108628094 AATTGTAGGGAGAAGTGAGAGGG - Intergenic
1059571903 9:115446604-115446626 TGTTTTGGGGAGAAGTGGGAAGG + Intergenic
1059801561 9:117754319-117754341 TCTTTTCTGCTGAAGTGAAAAGG - Intergenic
1061421967 9:130477545-130477567 TCTTGTTGACAGCAGTGAGAAGG - Intronic
1061602194 9:131678595-131678617 TATTTTTGGCAGAAGTGAGACGG + Intronic
1062103767 9:134741641-134741663 GCTTTTAGGCAGAAGAGGGGAGG + Intronic
1188065746 X:25657325-25657347 TCTTGTACACAGAAGTGAAATGG - Intergenic
1188330449 X:28864794-28864816 TCTCTGAGGCAGACATGAGATGG + Intronic
1188777041 X:34232583-34232605 TCTTTTAGGCAAAAGATAAATGG - Intergenic
1189209076 X:39267507-39267529 TCTTATAGGCAAGAGAGAGAAGG - Intergenic
1189268943 X:39736850-39736872 ACTTTGAGGCAGCAGTGAGCCGG - Intergenic
1192144952 X:68675813-68675835 GCTTATTGGCAGACGTGAGAAGG - Intronic
1193129677 X:77906289-77906311 TTTTCTAGGCAGGAGTGAAAAGG - Exonic
1193970469 X:88044834-88044856 TGGTTTAGGCAGAAATGTGATGG + Intergenic
1194602244 X:95936400-95936422 CCTTTGTTGCAGAAGTGAGATGG + Intergenic
1196051156 X:111306164-111306186 TCTTTTAGACAGCATTGAGTTGG - Intronic
1196340788 X:114594372-114594394 ACTTTTGGGGAGAAGAGAGATGG + Intronic
1198657390 X:138929670-138929692 TATTTTAGGCACAAGGGACAGGG - Intronic
1201789213 Y:17819708-17819730 TCTTTTTGGCAGTAATGAAAAGG + Intergenic
1201812340 Y:18086279-18086301 TCTTTTTGGCAGTAATGAAAAGG - Intergenic
1201977116 Y:19863479-19863501 TCTTTTAGGCAGCAGAGATTTGG + Intergenic