ID: 945802567

View in Genome Browser
Species Human (GRCh38)
Location 2:214451294-214451316
Sequence TAAGTGGGTCGGTGTGGGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 571
Summary {0: 1, 1: 0, 2: 4, 3: 39, 4: 527}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945802556_945802567 -7 Left 945802556 2:214451278-214451300 CCTTCCTAAGGAAGGATAAGTGG 0: 1
1: 0
2: 2
3: 8
4: 114
Right 945802567 2:214451294-214451316 TAAGTGGGTCGGTGTGGGGGGGG 0: 1
1: 0
2: 4
3: 39
4: 527

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945802567 Original CRISPR TAAGTGGGTCGGTGTGGGGG GGG Intronic
900425883 1:2578423-2578445 CATGTGGGCGGGTGTGGGGGAGG - Intergenic
900747719 1:4372694-4372716 TAGATGGGTGGATGTGGGGGTGG - Intergenic
900848187 1:5120640-5120662 TAGGTAGGTGGGTGTGGAGGTGG - Intergenic
901426809 1:9186945-9186967 TGGGTGGGTGTGTGTGGGGGGGG + Intergenic
901488075 1:9579315-9579337 TAAGTGGGTGGGCGGGGGGTGGG - Intronic
901700267 1:11041573-11041595 TAAGTGGGTGGGTGGGTGGATGG + Intronic
901810069 1:11762384-11762406 TAAGTGGACAGGGGTGGGGGTGG + Intronic
902579361 1:17398656-17398678 TGGGTGGGTGGGTGGGGGGGGGG - Intronic
902590348 1:17469519-17469541 GAAGGGGGTGGGGGTGGGGGTGG + Intergenic
902708880 1:18225399-18225421 TAAGTGTGGCGGTGGCGGGGAGG - Intronic
903557437 1:24203870-24203892 TGAGTGGGTGGGGGTCGGGGCGG - Intergenic
903709042 1:25308343-25308365 TAACTGGGTAGGTCTGGGGTGGG - Intronic
903718073 1:25384076-25384098 TAACTGGGTAGGTCTGGGGTGGG + Intronic
903771521 1:25767330-25767352 TGTGTGGGTCTGTGTGTGGGGGG - Intronic
903771576 1:25767647-25767669 TGTGTGGGTCTGTGTGTGGGGGG - Intronic
903771653 1:25768077-25768099 TGTGTGGGTCTGTGTGTGGGGGG - Intronic
903771736 1:25768568-25768590 TGTGTGGGTCTGTGTGTGGGGGG - Intronic
904005930 1:27363260-27363282 TGCCTGGGTCGGGGTGGGGGAGG - Intronic
904594248 1:31633077-31633099 TAGGTGGGTAGGTGGGTGGGTGG - Intronic
904935843 1:34129005-34129027 TATGTGTGTGTGTGTGGGGGGGG - Intronic
905376761 1:37526795-37526817 AAAGTGGCTGGGTGTGGTGGTGG + Intergenic
905451966 1:38062741-38062763 TCAGTGGGTGGGTGGGTGGGTGG - Intergenic
905647038 1:39632272-39632294 TCAGTGTGCCGGGGTGGGGGAGG - Intronic
905846931 1:41241711-41241733 TTGGAGGGTCGGCGTGGGGGCGG - Intronic
906809451 1:48811173-48811195 GTAGTGGGTGGGGGTGGGGGTGG + Intronic
908090401 1:60679465-60679487 TAACTGTGTGTGTGTGGGGGGGG + Intergenic
908141278 1:61187851-61187873 GAAGTGGGTCTGTGTGAGAGCGG + Intronic
908669803 1:66533791-66533813 TAAGTGGCTCGCTGCGGAGGGGG - Intronic
908682897 1:66682288-66682310 TAGGTGGGTGGTGGTGGGGGAGG - Exonic
908714512 1:67054896-67054918 TGAGTGTGTTGGTGGGGGGGGGG - Intergenic
909392618 1:75134525-75134547 TTAGTGGATCGGGGCGGGGGAGG + Intronic
909474199 1:76063494-76063516 TTGGTCGGTCGGTGGGGGGGGGG + Intergenic
909576327 1:77180703-77180725 GAAGTGGGTGGGGGTGGGGGGGG + Intronic
909809781 1:79918191-79918213 CAGGTGGGTGTGTGTGGGGGTGG + Intergenic
909939376 1:81592763-81592785 TATGTGTGTAGGTGTGGGGAAGG + Intronic
910083127 1:83365633-83365655 TAGGTGGGTGGGGGTGAGGGTGG + Intergenic
911171803 1:94777496-94777518 TAAGTGGGTGGGTGTGTGGATGG + Intergenic
911178929 1:94843864-94843886 GAGGTGGGGCGGGGTGGGGGGGG + Intronic
912397251 1:109355647-109355669 TGAGTGGGTTTGTGGGGGGGGGG - Intronic
912411526 1:109483784-109483806 TGAGTGGGTGGGGGGGGGGGGGG + Intronic
912574244 1:110650392-110650414 TAAGTGGGGTGATGGGGGGGTGG + Intergenic
913438007 1:118867292-118867314 TAAGTGTGAAGTTGTGGGGGTGG - Intergenic
915247609 1:154567783-154567805 CAATTGGGACGGTGAGGGGGAGG - Exonic
915708390 1:157869294-157869316 TTAGTTGGTAGGGGTGGGGGAGG + Intronic
916498363 1:165365459-165365481 TGTGTGTGTCGGGGTGGGGGGGG - Intergenic
917268081 1:173242992-173243014 GAAGTTGGTGGGTGGGGGGGGGG + Intergenic
918126131 1:181585665-181585687 GAAGTGGGTGGGTGAGGGAGTGG + Intronic
918173350 1:182020098-182020120 TAAGAAGGACGGTGTGGAGGAGG - Intergenic
918216773 1:182398563-182398585 TACTTGGTGCGGTGTGGGGGTGG + Exonic
918445680 1:184614576-184614598 TGGGTGGGGCGGGGTGGGGGTGG + Intronic
918967402 1:191369458-191369480 TAAGTGGGTCGGGTGTGGGGTGG - Intergenic
919091424 1:192982511-192982533 AAGGTGGGTGGGGGTGGGGGGGG - Intergenic
920345113 1:205301422-205301444 AGAGTGGGTCGGGGTGGGGGAGG + Intergenic
921113384 1:212061849-212061871 AAAGTGAGTGGGTGTGAGGGGGG + Intronic
921160465 1:212468703-212468725 TAAGGCGGTGGGGGTGGGGGGGG - Intergenic
921847237 1:219897228-219897250 TATGTTGGTGGGGGTGGGGGTGG - Intronic
922177714 1:223209610-223209632 TAAGTGGGGTGGTGGGGGGAAGG - Intergenic
922964358 1:229675619-229675641 TGAGTGAGTGGGTGTGTGGGTGG - Intergenic
923209325 1:231788886-231788908 TAAGTGGGGTGGGGTGGGGTGGG - Intronic
1063154957 10:3370616-3370638 GCAGTGGGGCGGGGTGGGGGCGG - Intergenic
1063566841 10:7178560-7178582 TGTGTGGGTGGGTGTGGGGAGGG - Intronic
1064767263 10:18687352-18687374 TAAGGGAGGCTGTGTGGGGGTGG - Intergenic
1065400835 10:25299223-25299245 TAAGTGGGTGTGTGTGTGTGTGG + Intronic
1065858770 10:29852705-29852727 TGTGTGGGTGGGTGTGGGTGTGG - Intergenic
1066343092 10:34555751-34555773 TAGGTAGGTAGGTGTGTGGGCGG - Intronic
1067659188 10:48221815-48221837 TAGGTGGATGGGTGTGTGGGTGG + Intronic
1068954484 10:62809915-62809937 TGTGTGTGTCGGTGGGGGGGGGG - Intergenic
1069752719 10:70754470-70754492 GTAGTGGGTCGATGTGGTGGAGG + Intronic
1069789944 10:71013123-71013145 CAAGTGGGTGGGGGTGGGGGAGG - Intergenic
1069996201 10:72343546-72343568 TACATGGGTCTGTGTGAGGGGGG + Intronic
1071066906 10:81646610-81646632 TAAGTAGGTAGATGTGGGGATGG - Intergenic
1071274173 10:84037777-84037799 CAAGGGAGTAGGTGTGGGGGAGG + Intergenic
1072743601 10:97924835-97924857 TGAGTGGGTGTGTGTGAGGGTGG + Intronic
1074422198 10:113319161-113319183 TATGTGTGTGTGTGTGGGGGGGG + Intergenic
1074784368 10:116826099-116826121 TTATTGGGTGTGTGTGGGGGTGG - Intergenic
1075098476 10:119489593-119489615 AGAGTGGGGCGGGGTGGGGGCGG + Intergenic
1075599436 10:123756572-123756594 TATGGGGGTCGGGGTGGGGTGGG - Intronic
1075735535 10:124662442-124662464 TGGGTGGGTGGGTGTGTGGGTGG - Intronic
1076116338 10:127904410-127904432 TAAATGGTTGGGTGTAGGGGAGG + Intergenic
1076158106 10:128219332-128219354 TGAGTGGGTTGGTGGGTGGGTGG - Intergenic
1076330852 10:129665184-129665206 TGAGTGGGTAGGTGGGGGGGTGG - Intronic
1076860840 10:133138282-133138304 TCTCTGGGTCCGTGTGGGGGTGG + Intergenic
1077172102 11:1171553-1171575 TAAGTGAGTGGGTGAGTGGGTGG - Intronic
1077311998 11:1892984-1893006 TAAGTGGGTGGGTGGGTGGATGG + Intergenic
1077312037 11:1893163-1893185 TAAGTGGGTGGGTGGGTGGATGG + Intergenic
1077319042 11:1932780-1932802 TGAGTGGATGGGTGTGTGGGTGG - Intronic
1077357715 11:2126445-2126467 TAAGTGGGTGAGTGGGTGGGTGG + Intergenic
1077359065 11:2132643-2132665 TAAGAGGGTTGTTGTGGGGGGGG + Exonic
1077543931 11:3160686-3160708 TACGGCGCTCGGTGTGGGGGCGG - Intronic
1078222547 11:9363985-9364007 TAAGTGGGTGGGGGTAGGAGTGG + Intergenic
1078537253 11:12185102-12185124 TAGGTGGGTGGGTGGGTGGGTGG + Intronic
1078610038 11:12811841-12811863 TATCTGGGTGGGGGTGGGGGTGG + Intronic
1079140749 11:17807866-17807888 TAAGTGGGCAGGACTGGGGGAGG - Intronic
1079920196 11:26424247-26424269 TATGTGTGTGTGTGTGGGGGGGG - Intronic
1080226352 11:29965525-29965547 GAAGTGGGTGGGTGTGGGGGTGG - Intergenic
1081114506 11:39183279-39183301 TATGTGTGTCTGTGTGTGGGGGG - Intergenic
1081749130 11:45495235-45495257 CAAGTGGGTCTGTGTGGCTGTGG - Intergenic
1083617541 11:64034069-64034091 TCTGTGGCTTGGTGTGGGGGTGG + Intronic
1083742579 11:64718642-64718664 AGAGAGGCTCGGTGTGGGGGAGG + Intronic
1083828420 11:65216290-65216312 TAAGTGAGTGGGTGGGTGGGTGG + Intergenic
1083828474 11:65216570-65216592 TAGGTGGGTGGGTGAGTGGGTGG + Intergenic
1083828531 11:65216814-65216836 TGAGTGGGTGGGTGAGTGGGTGG + Intergenic
1085645845 11:78222081-78222103 TAAGTGCGTATGTGTGGGGGTGG - Intronic
1086150263 11:83601384-83601406 TAAGTTGGTAAGTGTGGGGATGG + Intronic
1086882297 11:92162898-92162920 TAAGTGGGTAGGGGTGGGGGTGG + Intergenic
1087200063 11:95336122-95336144 TGAGGGGGTTGGTGGGGGGGTGG - Intergenic
1088000764 11:104877359-104877381 TCAGTGTGTGTGTGTGGGGGGGG + Intergenic
1088647676 11:111929708-111929730 TAAGTTGGTAGGTTTTGGGGAGG + Intronic
1089125724 11:116175185-116175207 TAGGAGGGTCGATGTGGTGGTGG - Intergenic
1091187364 11:133658480-133658502 TAAGTGGGTGGATGGGTGGGTGG + Intergenic
1091196874 11:133738934-133738956 TATGTGGGTGTGTGTGGGTGGGG + Intergenic
1091196908 11:133739087-133739109 TATGTGGGTGGGTGTGGGTGTGG + Intergenic
1091285544 11:134406533-134406555 TGATTGGGTGGGTGGGGGGGCGG + Intronic
1091432336 12:446947-446969 AAAGTGTGTGTGTGTGGGGGGGG + Intergenic
1091670084 12:2446453-2446475 TGAGTGGGTGGGTGGGTGGGTGG + Intronic
1091691640 12:2601386-2601408 TGAGTGGGTGGGTTGGGGGGCGG - Intronic
1092204328 12:6606505-6606527 AGAGCGGGTGGGTGTGGGGGAGG - Intronic
1092383789 12:8019669-8019691 AAGGTGGGGCGGGGTGGGGGGGG + Intergenic
1093076874 12:14768250-14768272 TGAGGGGGGCGGGGTGGGGGTGG - Intronic
1097173418 12:57129426-57129448 AAAGGGGGTGGGGGTGGGGGGGG + Intronic
1097984402 12:65768347-65768369 GAAGTGGGTGGTGGTGGGGGTGG + Intergenic
1098339553 12:69437733-69437755 TAATTGGGGCGGTGGTGGGGGGG + Intergenic
1098854467 12:75636759-75636781 GAAGTGTGTGGGTGTGGCGGGGG - Intergenic
1100280064 12:93110082-93110104 GAAGGGGGTGTGTGTGGGGGTGG - Intergenic
1100309052 12:93377805-93377827 TGGGTGGGTAGGTGTGGCGGGGG - Intergenic
1100524274 12:95405292-95405314 TAAGGGGGTGGGTATGGGTGGGG - Intergenic
1101662358 12:106776961-106776983 TGGGAGGGTCGGTGGGGGGGAGG - Intronic
1101757941 12:107635854-107635876 TGTGTGGGTGGGTGGGGGGGGGG - Intronic
1101851999 12:108410865-108410887 TAAGTGGGATGGTGTGGGGGTGG - Intergenic
1102504247 12:113373862-113373884 TGAGTGGGTGGGTGGGTGGGTGG - Intronic
1102587488 12:113933341-113933363 AAAGAGGGTGGGGGTGGGGGAGG + Intronic
1102795702 12:115687325-115687347 AAAGGGGGTGGGTGAGGGGGAGG + Intergenic
1103740586 12:123088523-123088545 GAAGTGGAGGGGTGTGGGGGTGG + Intronic
1103841203 12:123866528-123866550 TAAGTGTGTCGGTGTGTCGGTGG - Intronic
1104360563 12:128129154-128129176 TGAGTGTGTGTGTGTGGGGGGGG - Intergenic
1104528112 12:129543283-129543305 TAAGTGGGTGGGTGGGTGGGTGG + Intronic
1104730134 12:131100669-131100691 TAAGTGGGTAGGTGTGGGTCTGG + Intronic
1104888171 12:132124329-132124351 TGAGTGGATGGGTGTGTGGGTGG - Intronic
1104961350 12:132489936-132489958 TGAGCGGGTCGGGGAGGGGGCGG + Exonic
1105474562 13:20719196-20719218 TGAGTGGGCAGGTGTGGGTGTGG - Intronic
1105532069 13:21229308-21229330 TGTGTGGGTGAGTGTGGGGGGGG - Intergenic
1105874022 13:24537994-24538016 TAGGTGAGGCGGTGTGGGGAAGG - Intergenic
1106226454 13:27790473-27790495 TATGGGGGTGGGGGTGGGGGTGG - Intergenic
1106227938 13:27799052-27799074 TATGTGTGTGTGTGTGGGGGGGG - Intergenic
1106281668 13:28279415-28279437 AAAGGGGGTAGGTGTGGGGTGGG - Intronic
1107013175 13:35687660-35687682 GGAGTGGGTGGGTGCGGGGGAGG - Intergenic
1109274326 13:60286897-60286919 TAAGTGGGGATATGTGGGGGTGG - Intergenic
1109952433 13:69516103-69516125 TAAGGGGGTGGTTGTGGGGAGGG + Intergenic
1111640090 13:90957610-90957632 TATGTGTGTGTGTGTGGGGGTGG - Intergenic
1112312531 13:98331983-98332005 AAACTGGGTGGGTGTGGGGAGGG - Intronic
1112904276 13:104397989-104398011 GTAGTGGGACGGTGAGGGGGAGG - Intergenic
1113225652 13:108156931-108156953 TATGTGTGTGTGTGTGGGGGGGG - Intergenic
1113450035 13:110402589-110402611 TAGGTGGGGAGGTGTGGGAGTGG - Intronic
1113742666 13:112722259-112722281 TAAGTGGGCCGGCGGGGGGTAGG + Intronic
1113901351 13:113800081-113800103 TATGTGTGTGTGTGTGGGGGGGG + Intronic
1113912696 13:113851498-113851520 TAGGTGGGTGGGTGAGTGGGTGG + Intronic
1114683735 14:24508005-24508027 GCAGTGGGTGGGGGTGGGGGTGG + Intronic
1114809570 14:25881800-25881822 TAAATGGATAGGTGTGTGGGAGG - Intergenic
1116469906 14:45275072-45275094 AAAGGGGGTGGGGGTGGGGGCGG - Intergenic
1117904638 14:60571857-60571879 AAATTGGCTCGGTGTGGTGGCGG - Intergenic
1117940667 14:60960738-60960760 TGAGTGGGTGGATATGGGGGTGG - Intronic
1118011171 14:61612043-61612065 TAAGTGTGTGTGTGTGGAGGGGG - Intronic
1118277155 14:64395424-64395446 TGAGTGGGTGGGGGTGGGGGAGG + Intronic
1119191824 14:72688195-72688217 TGGGTGGGTGGGTGTGTGGGTGG + Intronic
1119191849 14:72688268-72688290 TGAGTGGGTGGGTGGGTGGGTGG + Intronic
1120082564 14:80232385-80232407 TAACTGGGTCGGGGATGGGGTGG - Intronic
1121131034 14:91447586-91447608 TAAGGGGGTCGGGGTGGGGAGGG + Intergenic
1121277576 14:92678469-92678491 TATGTGGGTGGGTGGGTGGGTGG - Intronic
1121819193 14:96952620-96952642 TAAGAGTGTCGGTGTGGAGGAGG + Intergenic
1122424219 14:101596300-101596322 GAAGTGGGTCTGAGTGGTGGAGG + Intergenic
1122657405 14:103271417-103271439 GAAGTGTGTGTGTGTGGGGGGGG - Intergenic
1124422085 15:29531393-29531415 AAAGTGGACTGGTGTGGGGGAGG + Intronic
1125870070 15:43092188-43092210 TAAATAAGTTGGTGTGGGGGTGG - Intronic
1126504964 15:49394315-49394337 TAATTGGGTAGATGTGGTGGTGG + Intronic
1127252601 15:57256552-57256574 AAGGTGGGGCGGGGTGGGGGTGG - Intronic
1127329265 15:57922825-57922847 AAAGTGGGCGGGTGTGGAGGGGG + Intergenic
1127893964 15:63278185-63278207 TCAATGGATCGGGGTGGGGGTGG - Intronic
1129166490 15:73781136-73781158 GAATTGGGGTGGTGTGGGGGCGG + Intergenic
1129521319 15:76188081-76188103 CCAGTGGGGCGGGGTGGGGGGGG - Intronic
1129933519 15:79431500-79431522 TATGTGTGTGTGTGTGGGGGGGG + Intergenic
1129934403 15:79437555-79437577 TTAGTGAGTGGGTGTGGGTGTGG + Intronic
1129934886 15:79439285-79439307 TGAGTGGGTGGGCGTGGGTGGGG + Intronic
1130302848 15:82693195-82693217 TAAGTGGGGCGGGGGCGGGGGGG - Intronic
1130770087 15:86915638-86915660 GCAGTGGGGCGGTGGGGGGGAGG - Intronic
1130821954 15:87505167-87505189 TGGGTGGGTGGGTGGGGGGGTGG + Intergenic
1131882050 15:96872048-96872070 TCAGTGGGCAGGAGTGGGGGCGG + Intergenic
1132668539 16:1093384-1093406 TGTGTGGGTGGGTGTGGGTGTGG - Intronic
1132696163 16:1202869-1202891 TGAGTGGGGGAGTGTGGGGGAGG + Intronic
1132998251 16:2835301-2835323 TAAGTGGGTGGGTGGGTGAGGGG + Intronic
1133020230 16:2963942-2963964 CAAGTGGGAAGGTGTGGAGGGGG - Exonic
1133111562 16:3551009-3551031 TAAGTGGGTAGGTGAGTAGGTGG - Intronic
1133381598 16:5335664-5335686 GGAGTGGCACGGTGTGGGGGTGG + Intergenic
1133399391 16:5473696-5473718 TGAGTGGGTGGGTGGGTGGGTGG + Intergenic
1133441863 16:5827937-5827959 TAGGTGGGTGGGTGGGTGGGTGG - Intergenic
1133454432 16:5930471-5930493 TATGTGGGTGGGTGGGAGGGTGG + Intergenic
1133454577 16:5930939-5930961 TAGGTGGGTGGGTGGGAGGGTGG + Intergenic
1133894449 16:9912503-9912525 TAAGTGGGTGGGGTGGGGGGAGG + Intronic
1133966492 16:10535748-10535770 TAATGGGGTCGGTGAGGGTGGGG + Intronic
1134101569 16:11456286-11456308 TAGGAGGCTGGGTGTGGGGGCGG - Intronic
1134224664 16:12381183-12381205 TAGGTGGGTCGGTGGGTGGATGG - Intronic
1134767037 16:16768876-16768898 TAACTTGGTAGGTTTGGGGGAGG - Intergenic
1135468897 16:22711968-22711990 TAAGTGGGTGGGGATGGGGAGGG + Intergenic
1135772714 16:25229325-25229347 TAGGTGGGGAGGTGGGGGGGTGG + Intergenic
1136777434 16:32879395-32879417 GAGGTGGGGCGGGGTGGGGGGGG - Intergenic
1136893190 16:33982119-33982141 GAGGTGGGGCGGGGTGGGGGGGG + Intergenic
1137974520 16:53020027-53020049 TAAGTGGGTTGTTTTGGAGGTGG - Intergenic
1138547541 16:57728803-57728825 TAGGTGGGTGGGTGGGTGGGTGG + Intronic
1139620610 16:68138183-68138205 TAACTGGGTGGGTGTGTTGGTGG - Intronic
1140222535 16:73054358-73054380 TAGGGGGGCGGGTGTGGGGGAGG - Intronic
1140245237 16:73242350-73242372 TAATGGGGTGGGTGTGGGGGTGG - Intergenic
1140249889 16:73286816-73286838 TGTGTGGGTCGGTGTGTGGCTGG + Intergenic
1140848361 16:78911168-78911190 AAAGTGGGCTGGTGTGGTGGAGG - Intronic
1141173329 16:81704441-81704463 TAAGTGGGTAGGGGAGGGGGAGG - Intronic
1141297239 16:82781564-82781586 TAAGTGGGTAGGTGGGTGGATGG - Intronic
1141823848 16:86465605-86465627 TGAGTGGGTGGGTGTGTGGATGG + Intergenic
1141898296 16:86972631-86972653 TAAGTGGGTGGGTGGGTGGATGG + Intergenic
1141928937 16:87187853-87187875 TATGTGGGTACGTGTGGGTGTGG + Intronic
1142009407 16:87706263-87706285 TGAGGGGGTCGGTGGCGGGGAGG + Intronic
1203079847 16_KI270728v1_random:1141504-1141526 GAGGTGGGGCGGGGTGGGGGGGG - Intergenic
1142848800 17:2694609-2694631 TGGGTGGGGCGGTGTTGGGGGGG - Intronic
1143434679 17:6914740-6914762 TAGGTGGGTGTGTGGGGGGGGGG - Intronic
1143746961 17:9002162-9002184 GTAGTGGGTGTGTGTGGGGGTGG - Intergenic
1145271627 17:21407854-21407876 TGAGTGGTTGGGTGTGAGGGTGG - Intronic
1145309839 17:21695302-21695324 TGAGTGGTTGGGTGTGAGGGTGG - Intronic
1146112437 17:30102164-30102186 TGAGTGGGTAGGTGTGCTGGTGG + Intronic
1146127592 17:30241075-30241097 TAGGTGGGTCGGAGGGGAGGAGG + Intergenic
1146504753 17:33395148-33395170 TAAATGGGTGGGTGAGTGGGTGG - Intronic
1146551107 17:33781088-33781110 TCACTGGGTTGGTGTGGAGGGGG + Intronic
1146790413 17:35747714-35747736 TAGGTGGGGAGGTGTGGGGGAGG - Intronic
1147160140 17:38564740-38564762 TCAGAGGGTGGGGGTGGGGGTGG + Intronic
1147363284 17:39944532-39944554 TGTGTGGGTCGGGGTGGGGTGGG + Exonic
1147584887 17:41648411-41648433 TGAGCGGGTGGGCGTGGGGGAGG - Intergenic
1147973486 17:44233845-44233867 TAATTGGCTGGGTGTGGTGGTGG + Intergenic
1149684168 17:58526037-58526059 TATGTGGGGTGGGGTGGGGGTGG - Intronic
1149808792 17:59646168-59646190 TAAGTGGGGTGGTCTTGGGGAGG - Intronic
1150587533 17:66532298-66532320 TCAGTGGGTGGGGGTGGGGGGGG - Intronic
1150984373 17:70178643-70178665 AAAGGGGGTGGGTATGGGGGGGG + Exonic
1151447334 17:74175869-74175891 TAAGTGTGTCTGGGTGGAGGTGG - Intergenic
1151922123 17:77164701-77164723 TAATTGGGTGGGTGCGGGTGAGG + Intronic
1151943271 17:77305893-77305915 TGAGTGGGTGGGTGGGGGGGTGG + Intronic
1152024742 17:77801587-77801609 TATGTGGGTGGGGCTGGGGGTGG - Intergenic
1152196805 17:78923382-78923404 TGTGTGGGGCGGGGTGGGGGGGG + Intronic
1152312520 17:79559680-79559702 TGAGTGGGTCGGTGGGTGGATGG + Intergenic
1152541848 17:80980558-80980580 TGAGTGGGTGGGTGAGTGGGTGG + Intergenic
1153768999 18:8400605-8400627 TAAGTGGGACGGAGGGGGAGGGG - Intronic
1153942249 18:9988381-9988403 TATCTAGGTCTGTGTGGGGGAGG - Intergenic
1153944593 18:10008115-10008137 TAGGTGGGTCGGTATGTGGATGG - Intergenic
1153946360 18:10021571-10021593 TAAGTGGGTGGGTAGGTGGGAGG - Intergenic
1154307922 18:13243975-13243997 TGAGTGGGTGGGTGGGTGGGTGG - Intronic
1155083751 18:22435112-22435134 TAAGTGGGTGGGGGTGAGGCGGG + Intergenic
1155170084 18:23260603-23260625 TAAGTGGGTGGGGTGGGGGGAGG + Intronic
1156371768 18:36477527-36477549 TAGGTGGGTGGGTGGGTGGGTGG - Intronic
1156398279 18:36718362-36718384 AAGGTGGGTGGGGGTGGGGGAGG - Exonic
1157312056 18:46560059-46560081 TAAGTGGGTCGTGGGGGGTGGGG - Intronic
1157335334 18:46733619-46733641 TAAGGGGCTTGGGGTGGGGGAGG + Intronic
1157452654 18:47799995-47800017 TAAGTGGGGTGGGGTGGGGTGGG - Intergenic
1157701008 18:49761624-49761646 TATGTGGGTGCGTGTGTGGGGGG - Intergenic
1158013580 18:52757483-52757505 TGGGTGGGTAGGTGTGGGGAAGG - Intronic
1158524240 18:58197922-58197944 CCAGTGGGTGGGGGTGGGGGTGG + Intronic
1158654872 18:59321544-59321566 AAAGTTGGTGGGGGTGGGGGTGG - Intergenic
1159760756 18:72422738-72422760 TATGTGTGTCTGTGTGGGGAAGG - Intergenic
1160229204 18:77033806-77033828 TATGTGGGTGGGTGTGTGGATGG - Intronic
1160433916 18:78831825-78831847 TAGGTGTGTGTGTGTGGGGGGGG - Intergenic
1160523302 18:79521206-79521228 TATGTGTGTCTGTGTGTGGGGGG + Intronic
1161090308 19:2356885-2356907 TAAATGGGTGGGTGGGTGGGTGG - Intergenic
1161266513 19:3366963-3366985 GGAGTGCGTCGGTGTGTGGGGGG - Intronic
1161565489 19:4999821-4999843 TGGGTGGGTCGGTGGGTGGGTGG - Intronic
1161565582 19:5000174-5000196 TAGGTGGGTGGGTGGGTGGGTGG - Intronic
1161974358 19:7600227-7600249 TGAGTGGGTGGGTGGGTGGGTGG - Intronic
1161974477 19:7600566-7600588 TGAGTGGGTGGGTGTGTGGGTGG - Intronic
1161974539 19:7600762-7600784 TAAGTGGATGGGTGGGTGGGTGG - Intronic
1163106694 19:15127265-15127287 AAAGGGGGTGGGTGTGGGGCAGG + Intergenic
1163583208 19:18150488-18150510 CAAATGGGTAGGTGTGGGGAGGG - Exonic
1163758723 19:19121500-19121522 TAAGTGGGTCGCTTGGTGGGTGG - Intronic
1164597128 19:29537695-29537717 AGAGTAGGTGGGTGTGGGGGCGG - Intronic
1164604164 19:29584248-29584270 TAAGTGGGGCGGGGTCGGTGGGG + Intergenic
1164920447 19:32085082-32085104 TAGGTGGGTAGGTGGGTGGGTGG + Intergenic
1165349441 19:35268270-35268292 AAAGTAGGTCGGTGGGGGGCTGG - Intergenic
1165936807 19:39394264-39394286 TTGGTGGGGGGGTGTGGGGGAGG + Intronic
1166686043 19:44796899-44796921 GAAGCGGGGCGGTGGGGGGGAGG + Intronic
1167101339 19:47406035-47406057 TAAATGGGTAGATGTGTGGGTGG + Intronic
1168185870 19:54698895-54698917 GAAGTGGGGCGGGGTGGGGGGGG - Intronic
1168413463 19:56154587-56154609 TAGGTGGTTGGGGGTGGGGGTGG - Intronic
1168717913 19:58539868-58539890 AAAGAGGGTCTGTGTGGGGAGGG - Intergenic
1168718403 19:58541879-58541901 AAAGAGGGTCTGTGTGGGGAGGG - Intergenic
1168718495 19:58542267-58542289 AAAGAGGGTCTGTGTGGGGAGGG - Intergenic
1168718545 19:58542462-58542484 AAAGAGGGTCTGTGTGGGGAGGG - Intergenic
925451849 2:3975851-3975873 TATGTGGGTGGGTGTGGGTGTGG - Intergenic
925925521 2:8667435-8667457 ACAGTGGGGTGGTGTGGGGGTGG - Intergenic
926196706 2:10768429-10768451 TGAGAGGGTAGGTGTGGGCGTGG + Intronic
927011765 2:18911578-18911600 TGTGTGTGTTGGTGTGGGGGTGG + Intergenic
928170386 2:28999486-28999508 GAAGTGGGTGGGTGAGGGGTGGG - Intronic
929322767 2:40565339-40565361 TAAGAGGGTTGGTATTGGGGAGG + Intronic
929986791 2:46742342-46742364 TAAGAAGGTGGGGGTGGGGGTGG - Intronic
929992745 2:46803377-46803399 TGAGAGGGTGGGGGTGGGGGTGG + Intergenic
932214567 2:69958558-69958580 TAAGTGGGTGGGTGGGGAGCTGG - Intergenic
932342784 2:70977089-70977111 GAGGTGGGTGGGGGTGGGGGCGG + Intronic
932905732 2:75748554-75748576 TAAGTGGGTTGAGGTGGGGATGG - Intergenic
934475170 2:94588665-94588687 TGAGTGGGTGGGTGGGGAGGAGG - Intronic
934768590 2:96894351-96894373 TGAGTGGGTGGGTGAGTGGGTGG - Intronic
934768750 2:96894860-96894882 TGACTGGGTGGGTGTGGGTGGGG - Intronic
934856224 2:97732048-97732070 TAAGTTGGTCTGTGTTGAGGGGG + Intronic
935162366 2:100540336-100540358 TAAGTGGGTAGGGGGAGGGGAGG + Intergenic
935345915 2:102108227-102108249 TATGTGTGTGTGTGTGGGGGGGG + Intronic
935519955 2:104092421-104092443 AAAGTGGGTGGGGGTGGGCGGGG + Intergenic
936096743 2:109536038-109536060 GCAGTGGGTGGGGGTGGGGGGGG + Intergenic
937109250 2:119350074-119350096 TACGCGGGACGGTGGGGGGGCGG - Intronic
937303538 2:120857505-120857527 TGGGTGGGTCGGTGGGTGGGCGG - Intronic
938680747 2:133687462-133687484 TAAGTGGGTTGGTATGGGAAAGG - Intergenic
940328842 2:152453206-152453228 TCAGGGGGTGGGGGTGGGGGTGG + Intronic
941334056 2:164218649-164218671 TATGTGTGTCTGTGTGGTGGAGG + Intergenic
942459316 2:176158818-176158840 GGAGTGGGTTGGAGTGGGGGGGG - Intronic
943736780 2:191365084-191365106 TAAGTGGGTGGGTGTTTGGATGG + Intronic
943745436 2:191457015-191457037 TTGGTGGGTGGGGGTGGGGGAGG - Intergenic
943961803 2:194274075-194274097 TGTGTGGGTGGGTGTGGGTGTGG - Intergenic
944845095 2:203660119-203660141 TAAATGGGTGGGGGTGGGGTGGG + Intergenic
945398947 2:209355943-209355965 TAAGTGGATAGGATTGGGGGAGG - Intergenic
945453201 2:210017409-210017431 TATGTTGGTGGGGGTGGGGGTGG - Intronic
945802567 2:214451294-214451316 TAAGTGGGTCGGTGTGGGGGGGG + Intronic
946249290 2:218402981-218403003 CCAGTGGGGCAGTGTGGGGGTGG - Intronic
946748892 2:222872779-222872801 GTAGTGGGGCGGTGTGGTGGTGG + Intronic
946908602 2:224439256-224439278 TAGGTGGGAGGGTGTGGTGGTGG - Intergenic
947118339 2:226795116-226795138 TGAGGGGGTGGGGGTGGGGGAGG + Exonic
947257744 2:228183722-228183744 GAAGTGGGGCGGGGCGGGGGGGG - Intergenic
948629828 2:239294895-239294917 TAAGGGGGTGGGTGTGTGGGAGG + Intronic
948813716 2:240499276-240499298 TAAGTGGGTCTGTGTGTGCGAGG + Intronic
948919005 2:241052678-241052700 TGAGAGGGTCGGCGGGGGGGGGG + Intronic
949001979 2:241620119-241620141 TAAGTGAGTCGGTGAGTGAGGGG + Intronic
949071996 2:242030971-242030993 GAAGTGGGGGGGTGTGGGTGTGG - Intergenic
1169497636 20:6130275-6130297 GTAGTGGGTGGGTGTAGGGGTGG + Intergenic
1169867676 20:10218426-10218448 AAAGGGGGTGGGGGTGGGGGTGG + Intergenic
1170870074 20:20197628-20197650 TGAGTGTGTGCGTGTGGGGGAGG - Intronic
1170884226 20:20325137-20325159 TAAGTGGCTGGGGGTGGAGGAGG - Intronic
1172939470 20:38644618-38644640 TAGGTGGGTGGGTGAGTGGGTGG - Intronic
1173181037 20:40806529-40806551 GTTGTGGGGCGGTGTGGGGGTGG + Intergenic
1174159520 20:48541069-48541091 TATGTGGGTGGGTGTTGCGGGGG + Intergenic
1175375306 20:58519943-58519965 TGAGTGGGTGGGTGAGTGGGTGG + Intergenic
1175526691 20:59639141-59639163 TGAGTGGGTAGGTGGGTGGGTGG + Intronic
1175732141 20:61361291-61361313 TATGTGGGTGGGAGTGGGGGAGG + Intronic
1175780252 20:61677642-61677664 TAAGTGGGTAGGTAGGTGGGTGG + Intronic
1175780258 20:61677654-61677676 TAGGTGGGTGGGTGGGTGGGTGG + Intronic
1176973251 21:15290008-15290030 TGGGTGGGTCGGGGTGGAGGCGG + Intergenic
1178626253 21:34221355-34221377 CAAGTGGGCTGGGGTGGGGGCGG - Intergenic
1178717927 21:34983834-34983856 CTAGTGGTTTGGTGTGGGGGTGG + Intronic
1179119761 21:38532302-38532324 TATGTGGGTGGGTGGGGGTGGGG - Intronic
1179417061 21:41207613-41207635 TCAGTGGGGCGGGGTTGGGGAGG - Intronic
1179496791 21:41776804-41776826 TGGGTGGGTGGGTGGGGGGGGGG + Intergenic
1179562114 21:42222084-42222106 TATGTGGCCCGGTGCGGGGGTGG + Intronic
1180025169 21:45156663-45156685 GAAGTGGGTGCGTGGGGGGGTGG - Intronic
1180208644 21:46279790-46279812 GAGGTGGGTCTGTGTGGGGCTGG - Intronic
1180977169 22:19854804-19854826 CAAGAGGGTCAGTGTGGAGGCGG - Exonic
1181586783 22:23857059-23857081 AAAGTGTGTGTGTGTGGGGGGGG + Intronic
1182966473 22:34526282-34526304 TAAATGGGTGGGTGGGTGGGAGG - Intergenic
1183077885 22:35438255-35438277 TATGTGGGTGGGTGGGTGGGTGG - Intergenic
1183078116 22:35439395-35439417 TATGTGGGTGGGTGGGTGGGTGG - Intergenic
1183203900 22:36405227-36405249 TTATTGGGGCGGTGGGGGGGCGG + Intergenic
1183589807 22:38773479-38773501 TGGGTGGGTGGGTGTGTGGGTGG - Intronic
1184434251 22:44460492-44460514 TGAGTGGGTGGGTGAGTGGGTGG - Intergenic
1184787943 22:46680854-46680876 TAGGTGGGTGGGTGGGTGGGTGG - Intergenic
1185417230 22:50716836-50716858 CAAGTGGGCAGGTGTGTGGGTGG - Intergenic
949519165 3:4834039-4834061 TAATTAGCTCGGTGTGGTGGTGG - Intronic
949787149 3:7754378-7754400 TCAGTGGGTCAGTGTGGGGATGG + Intergenic
950532216 3:13558793-13558815 TAGGTGGGTGGGTGGGTGGGTGG - Intronic
952267023 3:31796610-31796632 TAACTTGGTGGTTGTGGGGGTGG + Intronic
952540049 3:34358040-34358062 TAAGTGGGACAGGGTGGGTGGGG + Intergenic
952772410 3:37014189-37014211 TGAGTGGGTGGGTGGGTGGGTGG + Intronic
953013112 3:39047050-39047072 AAAGGGGGTGGGGGTGGGGGTGG - Intergenic
953444668 3:42952829-42952851 TAATTGTGTGTGTGTGGGGGGGG - Intronic
953720193 3:45348301-45348323 TAAGTGGCTCTGTGTGGTGAGGG + Intergenic
954425454 3:50440701-50440723 TAAGGAGGTGGGGGTGGGGGAGG - Intronic
954582350 3:51709803-51709825 TGTGTGTGTGGGTGTGGGGGTGG - Intronic
955007874 3:54986727-54986749 TGAGTGGGTGGGTGGGTGGGTGG - Intronic
955385368 3:58474995-58475017 TAGGTGGGTTGGTGGGTGGGTGG - Intergenic
955667697 3:61368004-61368026 TAAGTGTGGCGGTATGGGGAGGG - Intergenic
956084955 3:65598366-65598388 TGAGTGGGTGGGTGAGGGCGAGG + Intronic
956451024 3:69375028-69375050 TAAGTGGGTGGGTGGGTGGATGG - Intronic
957723139 3:84031063-84031085 AAAGTGGGTCAGGATGGGGGAGG + Intergenic
958042945 3:88247587-88247609 AAAGGGGGGCGGTGGGGGGGGGG + Intergenic
958570686 3:95877886-95877908 TAAGTGGGTGGGGGTAGGGGAGG + Intergenic
959941707 3:112087172-112087194 TTAGGGGGTCGGCGCGGGGGAGG + Intronic
961384655 3:126516687-126516709 CAGGTTGGTGGGTGTGGGGGTGG - Intronic
961391841 3:126556846-126556868 TATGTGAGTCTGTGTGTGGGGGG - Intronic
962571663 3:136719640-136719662 TAGGTGGGTAGGTGGGTGGGTGG + Intronic
962571674 3:136719664-136719686 TAGGTGGGTGGGTGGGTGGGTGG + Intronic
962719368 3:138158600-138158622 TAAGTGGGCCGGGCTGGGCGTGG + Intergenic
962930379 3:140030438-140030460 AGAGTGGGTAGGGGTGGGGGTGG + Intronic
962969182 3:140382940-140382962 GAATTGGGTGGGGGTGGGGGTGG + Intronic
963104971 3:141639142-141639164 TGAGTGGGGGGGTGGGGGGGGGG + Intergenic
963149330 3:142028398-142028420 TATGGGGGTTGGGGTGGGGGGGG - Intronic
963910299 3:150811614-150811636 TAAGTGGGTGGAGGTGAGGGAGG + Intergenic
963941006 3:151096374-151096396 AAAGGGGGTGGGTGTGGGGCGGG - Intronic
965524164 3:169699169-169699191 GATGTGGGTAGGAGTGGGGGTGG - Intergenic
966431119 3:179832500-179832522 TAGGTGGGTAGGTGAGGGGGTGG - Intronic
968523038 4:1042910-1042932 TGTGTGTGTCAGTGTGGGGGTGG - Intergenic
968731388 4:2270921-2270943 TGGGTGGGTAGGTGTGTGGGAGG - Intronic
969326293 4:6446271-6446293 TGGGTGTGTCGGTGTGGGGGAGG - Intronic
969421740 4:7101693-7101715 TGGGTGGGTGGGTGGGGGGGGGG + Intergenic
969424842 4:7118154-7118176 TAGGTGGGTTGGTGGGTGGGTGG + Intergenic
969501601 4:7556780-7556802 TAAGTGGATGGATGTGTGGGTGG - Intronic
969921088 4:10540437-10540459 CAAGAGTGTGGGTGTGGGGGAGG - Intronic
969940834 4:10729552-10729574 TGAGTGGGTATGTGTGGGTGTGG - Intergenic
970240871 4:14007510-14007532 TATGTGAGTATGTGTGGGGGTGG - Intergenic
971449471 4:26786726-26786748 TAGGTGGGTGGGTGGGTGGGTGG + Intergenic
972442399 4:39107395-39107417 TTAGTAGGTCGGTGGGTGGGTGG - Intronic
973236000 4:47905744-47905766 TGAGTGAGTGGGGGTGGGGGTGG + Intronic
973882774 4:55290712-55290734 TAAGGGGGTTGGTGAGGGGAAGG - Intergenic
974914032 4:68157318-68157340 TAAGTGGGCATATGTGGGGGCGG + Intergenic
975248128 4:72144001-72144023 TAAGTGGTTTGATTTGGGGGTGG - Intronic
977761229 4:100739301-100739323 TTAGTGGGGTGGGGTGGGGGTGG - Intronic
978618284 4:110616390-110616412 TAGGAGGGTCGTTGTGGAGGTGG - Intergenic
978865640 4:113506893-113506915 TAGGTGTGTGTGTGTGGGGGGGG - Intronic
978930584 4:114306606-114306628 TAAGTGGGTAAAGGTGGGGGAGG - Intergenic
979632856 4:122922781-122922803 TAAGTGAGTGGCGGTGGGGGAGG - Intronic
981724673 4:147834724-147834746 CAGGTGGGTGGGTGTGCGGGTGG - Intronic
984609545 4:181822151-181822173 GAAGTGGGGGGGTGTGAGGGAGG - Intergenic
984784413 4:183554355-183554377 TGAGTGGGTGTGTGTGTGGGTGG + Intergenic
984784430 4:183554434-183554456 TGAGTGGGTGTGTGTGTGGGGGG + Intergenic
985121197 4:186643790-186643812 CAAGTGGGTGGGGGTGGGGGGGG - Intronic
985508107 5:296306-296328 GAAGTGGGGAGGTGTGGGTGTGG - Intronic
985560611 5:584191-584213 TAAGTGGGTGGGTGGATGGGTGG + Intergenic
985560819 5:584942-584964 TAAGTGGGTGGCTGGGTGGGTGG + Intergenic
985662868 5:1166059-1166081 TGAGTGGGTGGGTGAGTGGGTGG - Intergenic
985739929 5:1609363-1609385 GAAGTGGGGAGGTGTGGGTGTGG + Intergenic
987051025 5:14146173-14146195 TGGATGGGTGGGTGTGGGGGTGG + Intronic
987089423 5:14498024-14498046 CATGTGGGTGGGTGTGGAGGAGG + Intronic
987264956 5:16243682-16243704 TGTGTGGGTGTGTGTGGGGGTGG - Intergenic
988449027 5:31321154-31321176 TGAGTGGGTGGGTGGGGTGGGGG - Intronic
990365513 5:55066500-55066522 TAGGTGGGTGGATGTGGTGGAGG - Intergenic
992079997 5:73227606-73227628 CAAGAGGGGTGGTGTGGGGGTGG - Intergenic
993506755 5:88718071-88718093 TATGTGTGTCTGTGTGGGAGGGG - Intergenic
993734191 5:91456713-91456735 GGAGGGGGGCGGTGTGGGGGCGG + Intergenic
996111283 5:119569687-119569709 TAAGTTTGTCTGTGTGGGGATGG + Intronic
997250837 5:132387301-132387323 TAACAGGGCCCGTGTGGGGGTGG - Intronic
999574319 5:152957845-152957867 TGAGTGGGGTGGGGTGGGGGAGG + Intergenic
1000340882 5:160276282-160276304 TACTTGGGGCGGTGTGGGTGGGG + Exonic
1001051187 5:168415784-168415806 CAAGTGTGTGTGTGTGGGGGGGG + Intronic
1001329891 5:170754564-170754586 TAAGTGGATGGGTGAGTGGGTGG + Intergenic
1001329961 5:170754852-170754874 TGAGTGGGTGGGTGGGTGGGTGG + Intergenic
1001834501 5:174820184-174820206 TAAAGGGGTCGGGGTGAGGGGGG + Intergenic
1001876663 5:175207446-175207468 TGAGTGGATGGGTGTGGAGGAGG + Intergenic
1002346083 5:178548035-178548057 TGTGTGTGTGGGTGTGGGGGTGG - Intronic
1003176133 6:3752837-3752859 AAAGTTGGTCGTGGTGGGGGCGG - Intergenic
1003224240 6:4190112-4190134 CAAGTGTGTATGTGTGGGGGAGG - Intergenic
1003570945 6:7256207-7256229 TTAGTGGGTAGGTGAGTGGGTGG - Intergenic
1003612109 6:7622947-7622969 TGAGTGGGTTGGGGTGGGGTGGG + Intergenic
1004088064 6:12471323-12471345 TAAGTGGGTGGGTTTAGGGAAGG - Intergenic
1004193641 6:13486251-13486273 CAAGTGTGTGTGTGTGGGGGGGG - Intronic
1004413753 6:15405659-15405681 TGTGTTGGTCGGGGTGGGGGAGG + Intronic
1006739962 6:36301112-36301134 ATAGTGGGTGGGTGGGGGGGCGG - Intronic
1007204611 6:40138610-40138632 TATGTGACTAGGTGTGGGGGTGG - Intergenic
1007362842 6:41371262-41371284 TATGTGTGTGTGTGTGGGGGGGG - Intergenic
1008224232 6:48892895-48892917 TAAGTGTGTGTGTGGGGGGGGGG + Intergenic
1008595315 6:53035951-53035973 CAAGCGCGTGGGTGTGGGGGTGG + Intronic
1008861188 6:56151784-56151806 GGAGTGGGTAGGTGTGGGTGGGG - Intronic
1010088783 6:71953444-71953466 GAAGTGGGACGGTGGGGTGGAGG + Intronic
1010196014 6:73241078-73241100 TTTGTGGGTGGGGGTGGGGGTGG - Intronic
1010357910 6:74956721-74956743 TGTGTGGGTAGGGGTGGGGGAGG - Intergenic
1010971938 6:82272105-82272127 TATGTGGGTAGGGGTGGGGTTGG + Intergenic
1011770402 6:90669551-90669573 CCAGTGGGTGGGTGTGAGGGTGG + Intergenic
1012152549 6:95772944-95772966 CATTTGGGTGGGTGTGGGGGGGG - Intergenic
1013007233 6:106085189-106085211 TATGTGGGTGTGTGTGTGGGTGG + Intergenic
1013019395 6:106197514-106197536 TATTTGGGTTGGGGTGGGGGGGG + Intronic
1015790086 6:136957694-136957716 TGGGTGGGTGGGTGGGGGGGTGG - Intergenic
1016982428 6:149864766-149864788 AAAGTGGGGCGGGGTTGGGGTGG + Intergenic
1017821697 6:158053773-158053795 TAAGTGGGTGAGTGGGTGGGTGG - Intronic
1018149875 6:160927427-160927449 AAAGTGTGTGTGTGTGGGGGGGG - Intergenic
1018297093 6:162360088-162360110 TGTGTGGGTGGGTGTGGGTGTGG + Intronic
1018962905 6:168460901-168460923 AAACTGGGTCAGTGTGAGGGAGG + Intronic
1019327107 7:443881-443903 TGAGTGGGTGGGTGGGTGGGTGG + Intergenic
1019659829 7:2218117-2218139 TATGTGGGTCTGTGCTGGGGCGG - Intronic
1019768543 7:2869243-2869265 TGTGTGGGTGGGTGTGTGGGTGG - Intergenic
1020077335 7:5266910-5266932 AAAGTGGGTGGCTGTGTGGGTGG + Intergenic
1020114630 7:5469539-5469561 TGTGTGGGTGTGTGTGGGGGGGG + Intronic
1020528845 7:9302419-9302441 AAAGTGGGTAGGTGTGAGTGTGG - Intergenic
1022250162 7:28599482-28599504 AAAGTGGGACTGTATGGGGGTGG + Intronic
1023177338 7:37447639-37447661 TGAGTGTGTGTGTGTGGGGGGGG - Intronic
1023945098 7:44796830-44796852 AAAGTGGGCCGGGGTCGGGGTGG + Intronic
1024381540 7:48702606-48702628 ACAGTGGGTGGGGGTGGGGGTGG + Intergenic
1025201785 7:56966764-56966786 AAAGTGGGTGGCTGTGTGGGTGG - Intergenic
1025670161 7:63610164-63610186 AAAGTGGGTGGCTGTGTGGGTGG + Intergenic
1025850110 7:65238047-65238069 AAAGTGGGTGGGGGAGGGGGTGG + Intergenic
1025854895 7:65268096-65268118 TAAGAGGGACTGTGTGGAGGTGG + Intergenic
1026320528 7:69263963-69263985 TAGGTGGGTTGGTGGGTGGGTGG + Intergenic
1026997031 7:74624078-74624100 TAGCTGGGTGGGTGTGGTGGTGG + Intergenic
1027299959 7:76821831-76821853 TAGGTGGGTGGGGGTGAGGGTGG + Intergenic
1027906170 7:84185379-84185401 TAAGGGGCTGGGTGTGGGTGTGG + Intronic
1027977269 7:85174727-85174749 TAAGTGGGTGTTTGTGGGGTAGG + Intronic
1027987912 7:85318552-85318574 TCAGTGGGTAGGGCTGGGGGAGG - Intergenic
1028569410 7:92269950-92269972 TCAGGGGGTCGGTGGGGGGTGGG - Intronic
1028845158 7:95472064-95472086 TCAGTGGGTGTGTGTGGTGGTGG + Intergenic
1030881448 7:114885501-114885523 TAAGTGTGTGTGTTTGGGGGAGG + Intergenic
1031290742 7:119930357-119930379 TAAGGGGGTCTATTTGGGGGTGG + Intergenic
1031407651 7:121405660-121405682 TATGTGGGGCGGTGGGTGGGGGG + Intergenic
1032076477 7:128838471-128838493 CATGTGGGGCTGTGTGGGGGTGG + Intronic
1032804739 7:135342503-135342525 AAAGTGGCTGGATGTGGGGGAGG + Intergenic
1033152361 7:138926432-138926454 AAAGTGGTTTGGTGTGGTGGTGG - Intronic
1033193355 7:139304309-139304331 TAACTGGGTCGGGGTGGGGAAGG + Exonic
1034275164 7:149820820-149820842 TGAGTGGGAAGGTGTGGGTGGGG + Intergenic
1034937278 7:155208386-155208408 TGAGTGTGTCTGTGTGTGGGGGG + Intergenic
1035318591 7:158013840-158013862 TGAGTGGGTGGGTGGGTGGGTGG - Intronic
1036076256 8:5504491-5504513 AAAGTAGCTCGGTGTGGTGGCGG - Intergenic
1036397408 8:8380984-8381006 GAAGGGGGTCAGTGTGAGGGAGG + Intronic
1036584061 8:10106829-10106851 TAGGTGGGTGGGTGTGTGAGTGG - Intronic
1036771049 8:11578643-11578665 TAAGTGGGGCGGGGCTGGGGTGG + Intergenic
1040028460 8:42803072-42803094 TAAGTTGGTTGGGGTAGGGGGGG + Intergenic
1040552843 8:48451668-48451690 GAGGTGGGGCGGGGTGGGGGGGG + Intergenic
1040975878 8:53194256-53194278 CCAGTGGGTCTGTGTGGGTGAGG + Intergenic
1042224794 8:66506909-66506931 TAGGTGGGTGGGTGGGTGGGTGG + Intronic
1042483905 8:69331270-69331292 GAAGTGGGGAGGTGTGGGTGTGG - Intergenic
1043335391 8:79170082-79170104 TCTGTGGGGCGGGGTGGGGGCGG - Intergenic
1045594537 8:103636794-103636816 TATGTGTGTGTGTGTGGGGGGGG - Intronic
1046062091 8:109151783-109151805 TCAGTGAGTTGGGGTGGGGGGGG + Intergenic
1047969718 8:130074344-130074366 TAAGTATGTGGGTGTGGTGGAGG + Intronic
1048616384 8:136080007-136080029 AGAGTGGGTCAGAGTGGGGGTGG - Intergenic
1048979711 8:139696806-139696828 TAAGTGGGTTGGTGGGTGGATGG + Intronic
1049582297 8:143418253-143418275 TGAGTGGGTGGGTGGGGGGTAGG - Intergenic
1049582555 8:143419390-143419412 CAAGAGGGACAGTGTGGGGGCGG - Intronic
1049691859 8:143965037-143965059 CAAGTGGGACGGTGAGGGTGGGG - Intronic
1049694197 8:143975694-143975716 TCAGTGTGTGGGAGTGGGGGTGG - Intronic
1050530856 9:6588116-6588138 AAAGGGGGTGGGGGTGGGGGAGG + Intronic
1050570267 9:6931123-6931145 AAAGTGTGTTTGTGTGGGGGGGG - Intronic
1051495131 9:17712843-17712865 TGAGTGGGTGGGTGGGTGGGTGG - Intronic
1051585357 9:18721480-18721502 AAAGTGGGTGTGTGTGTGGGGGG - Intronic
1052947341 9:34179016-34179038 TGAGTGGGGCGGTGAGGGGAAGG + Exonic
1053054180 9:34984213-34984235 TAGCTGGGTCGGGGTGGGGTGGG + Intergenic
1053269267 9:36739203-36739225 TTCGTGTGTCGGGGTGGGGGTGG + Intergenic
1053510839 9:38686705-38686727 TATGGGGGTGGGGGTGGGGGTGG + Intergenic
1054296002 9:63332926-63332948 TGAGTGGGTGGGTGGGGAGGAGG + Intergenic
1054465029 9:65488273-65488295 TAGGTGGGTGGGTGGGTGGGTGG - Intergenic
1055191375 9:73529039-73529061 TAGGTGGGTGGGTGTGGGAGGGG - Intergenic
1056220421 9:84446137-84446159 TATGTGTGTCAGGGTGGGGGAGG + Intergenic
1056884950 9:90432953-90432975 TGAGTGGGTTGATATGGGGGTGG + Intergenic
1058622608 9:106899225-106899247 TATGTGTGTGTGTGTGGGGGGGG + Intronic
1058789617 9:108429721-108429743 TATGTGTGTGGGGGTGGGGGTGG - Intergenic
1058881045 9:109286146-109286168 TAGGTGGGTGGGTGGGTGGGTGG + Intronic
1058893549 9:109381361-109381383 TAGGTGGGTCGGTGCGGGGGAGG + Intronic
1058979967 9:110160065-110160087 TAAGTGGGTAGGGGTGGGGATGG - Intronic
1059442691 9:114318446-114318468 TGTGTGGGTGGGTGTGTGGGTGG + Intergenic
1060114002 9:120926826-120926848 TGAGTGGGGTGGTGTGGGGAGGG - Exonic
1060199941 9:121646490-121646512 ACAGAGGGTCGGGGTGGGGGGGG - Intronic
1060796620 9:126516379-126516401 GAAGGGGGGCGGTGGGGGGGGGG - Intergenic
1061846934 9:133393257-133393279 TAAGTGGATGGGTGGGCGGGTGG + Intronic
1061932074 9:133838452-133838474 TAAGTAGGTGGGTGGGTGGGTGG + Intronic
1061932076 9:133838456-133838478 TAGGTGGGTGGGTGGGTGGGTGG + Intronic
1061938282 9:133870794-133870816 TAAGTGGGTGGGTGGGTGGATGG + Intronic
1061938298 9:133870859-133870881 TAAGTGGGTAGGTGGGTGGGTGG + Intronic
1061939113 9:133874644-133874666 AGAGTGGGGTGGTGTGGGGGAGG - Intronic
1062127593 9:134871934-134871956 TAAGTGGGGCCGGGTGGGGGTGG - Intergenic
1062210546 9:135361461-135361483 TAAGTGGGTGGGTGGGTGGGTGG + Intergenic
1062210600 9:135361732-135361754 TGAGTGGGTGGGTGGGTGGGTGG + Intergenic
1062560622 9:137140024-137140046 GGAGTGTGTCAGTGTGGGGGTGG + Intronic
1185625024 X:1475104-1475126 TAAGTGGGTGGGTGGGTGGGTGG + Intronic
1185697666 X:2207388-2207410 AAAGGGGGTTGGAGTGGGGGAGG - Intergenic
1185736280 X:2499337-2499359 TCAGAGGGTCAGTGTGGTGGGGG - Intronic
1185750495 X:2607127-2607149 TAAGTGGGTGGATGGGTGGGTGG - Intergenic
1186200577 X:7151813-7151835 TGAGTTGGTCAGTCTGGGGGTGG - Intergenic
1186388299 X:9132406-9132428 TAAATGGGTGTGTGTGGGGGGGG + Intronic
1186481875 X:9902220-9902242 TAAGTGGGTGGGTGGGAGGATGG + Intronic
1186931878 X:14402250-14402272 CCATTGGGTTGGTGTGGGGGAGG - Intergenic
1187444258 X:19346466-19346488 TAATTGGCTGGGTGTGGTGGTGG - Intronic
1187484416 X:19688625-19688647 TATGTGGGTGTGTGTGTGGGTGG - Intronic
1188001951 X:24991197-24991219 TTTTTGGGTGGGTGTGGGGGGGG - Intronic
1191110555 X:56800435-56800457 TGTGTGGGATGGTGTGGGGGTGG + Intergenic
1198001544 X:132443992-132444014 TAAGTAGGTGGGGGGGGGGGGGG - Intronic
1198806575 X:140500820-140500842 TGAGTGGGGAGGAGTGGGGGAGG + Intergenic
1199544675 X:148995470-148995492 AAAGGGGGTGGGGGTGGGGGCGG + Exonic
1200036549 X:153334857-153334879 TGAGTGGGTGGGAGTGGGGGGGG + Intronic
1200137093 X:153880462-153880484 TCAGTGGGCCAGAGTGGGGGTGG + Intronic
1200256495 X:154585587-154585609 TAAGTGGTTGGGTGGGGGTGGGG + Intronic
1200261274 X:154618816-154618838 TAAGTGGTTGGGTGGGGGTGGGG - Intronic
1200948103 Y:8865927-8865949 AAAGTGAGGCGGTGTGGAGGGGG + Intergenic