ID: 945804524

View in Genome Browser
Species Human (GRCh38)
Location 2:214474264-214474286
Sequence CTGAAAGCAAAGAGGCAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1363
Summary {0: 1, 1: 0, 2: 6, 3: 184, 4: 1172}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945804524 Original CRISPR CTGAAAGCAAAGAGGCAGCA TGG Intronic
900628700 1:3622349-3622371 CGGAAGGCAAAGGGGAAGCAAGG - Intergenic
900822122 1:4897821-4897843 TGGAAAGCAAAGAGGAAGCAAGG - Intergenic
901028369 1:6291453-6291475 CTGAAATCAAGGCGTCAGCAGGG - Intronic
901037664 1:6346056-6346078 CTGGAAGCAGAGAGGGAGCCAGG + Intronic
901052796 1:6433904-6433926 CTCAAAGAAAAAGGGCAGCAGGG - Intronic
901261479 1:7874925-7874947 CGGAAGGCAAAGGGGAAGCAAGG - Intergenic
902132631 1:14276486-14276508 CTGAAATCAAGGTGTCAGCAGGG + Intergenic
902137520 1:14322953-14322975 CAGAAGGCAAAGAGGAAGCAAGG + Intergenic
904173903 1:28611707-28611729 CTGAAATCTAAGTGTCAGCAGGG - Intronic
904848039 1:33435534-33435556 CTGAAATCAAAGTGTCATCAGGG + Intergenic
904991060 1:34593063-34593085 TAGAAAGCAAAGAGCCAGGAAGG + Intergenic
905274984 1:36811702-36811724 CAGAAACCAAAGAGGCAGGCTGG - Intronic
905357492 1:37394944-37394966 GAGAAAGCACAGAAGCAGCAAGG + Intergenic
905902929 1:41593829-41593851 CTAAAAGCAAGGTGTCAGCAGGG + Intronic
905938062 1:41840494-41840516 CTGAAATCAAGGTGTCAGCAGGG - Intronic
906068869 1:43002878-43002900 CTGAAAGCAGGGTGTCAGCAAGG + Intergenic
906519253 1:46457653-46457675 CTGAAACCAGGGAGGCAGAAAGG - Intergenic
906846249 1:49196020-49196042 TGGAAGGCAAAGAGGAAGCAAGG - Intronic
907172235 1:52479212-52479234 AAGAAAGCAAAGAGCCAGGAAGG + Intronic
907283919 1:53368406-53368428 TTAAAAGCAAAGAGACAGCTGGG - Intergenic
907552275 1:55314521-55314543 CGGAAGGCAAAGGGGAAGCAAGG + Intergenic
908171280 1:61507288-61507310 CTGAAGCCAAAGATGCAGAATGG - Intergenic
908308477 1:62850521-62850543 ATGAGTTCAAAGAGGCAGCAGGG - Intronic
908326918 1:63031988-63032010 CTGAAAGCCAAGGGGAGGCATGG + Intergenic
908948411 1:69527698-69527720 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
909076812 1:71058853-71058875 TTGAAAGGGAAGAGGCATCAGGG + Intergenic
909573285 1:77142620-77142642 CAGAAGGCAAAGGGGAAGCAAGG + Intronic
909911837 1:81268892-81268914 CAGAAAGCAAACTGGCTGCAAGG + Intergenic
910705679 1:90127084-90127106 CAGAAGGCAAAGGGGAAGCACGG - Intergenic
910746532 1:90580792-90580814 GTGAAAGCAAAGAGGGAGCAAGG - Intergenic
910880160 1:91915955-91915977 CTGAAAGCACGGTGTCAGCAGGG + Intergenic
911315722 1:96354511-96354533 CTGAATGAGATGAGGCAGCATGG - Intergenic
911343645 1:96671076-96671098 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
911478262 1:98401158-98401180 CTAAAATCAAAGTGTCAGCAGGG - Intergenic
911638427 1:100261614-100261636 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
911709836 1:101057827-101057849 CAGAATGCAAAGAGGCAGCAAGG - Intergenic
911760441 1:101608419-101608441 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
911773133 1:101773130-101773152 CAGAAATCAAAGAGGAAGCAAGG + Intergenic
911838543 1:102652150-102652172 CTAAAATCAAAGTGTCAGCAGGG + Intergenic
912328541 1:108794399-108794421 CAGAAAGCAAAGGGGAAGCCAGG + Intronic
912365458 1:109129927-109129949 CTAAAACCAAAGTGCCAGCAGGG + Intronic
912600289 1:110924453-110924475 CAGAGGGCAAAGAGGCAGCAAGG + Intergenic
912951395 1:114123039-114123061 CTGGAAGCAAAAAGGCAGGAAGG - Intronic
913398423 1:118398693-118398715 CGGAAGGCAAAGAGGAAGCAAGG - Intergenic
913566131 1:120074334-120074356 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
913631999 1:120719219-120719241 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
913696526 1:121331513-121331535 CTGAAACCAGTGAGTCAGCAGGG - Intronic
914141035 1:144948548-144948570 CTGAAACCAGTGAGTCAGCAGGG + Intronic
914286719 1:146233693-146233715 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
914547750 1:148684434-148684456 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
915016027 1:152734643-152734665 TTGAAAGAAAAGAGGGAACAGGG - Intergenic
915058551 1:153159722-153159744 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
915079185 1:153339929-153339951 CTAGAAGCAGAGAAGCAGCACGG + Intronic
916304201 1:163310870-163310892 CGGAATGCAAAGGGGAAGCAAGG + Intronic
916766072 1:167861955-167861977 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
917726538 1:177833196-177833218 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
918014230 1:180617531-180617553 CTGAAATCAAGGTGTCAGCAGGG + Intergenic
918076861 1:181177132-181177154 CTGAAATCCAGGAGTCAGCAGGG - Intergenic
918197995 1:182240667-182240689 ATGAAAGCAAATAGGAAGAATGG - Intergenic
918210965 1:182350310-182350332 CTGAATGCAGAGAGGTTGCATGG + Intergenic
918445032 1:184609022-184609044 CTGAAAGCAAAGAGAAAGGAAGG + Intronic
919159450 1:193809094-193809116 CTGAAGGCAAAGGGGAAGCAAGG + Intergenic
919232520 1:194792346-194792368 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
919273865 1:195386096-195386118 CAGAAAGCAAAGGGGAAGTAAGG - Intergenic
920163511 1:204018324-204018346 CTGAAATCAAGGTGGCAGCTGGG + Intergenic
920355160 1:205366587-205366609 CTGAAAGGAAAAAGGGAGGATGG - Intergenic
920483853 1:206349866-206349888 CTGAAACCAGTGAGTCAGCAGGG - Intronic
920562660 1:206949912-206949934 CTGAAATCAAGGTGCCAGCAGGG + Intergenic
920836823 1:209518853-209518875 CTGAAAGTATAGAAGCAGCTTGG + Intergenic
920957522 1:210633014-210633036 CTGAAATCAAGGAGCCAGCAGGG - Intronic
920979598 1:210820915-210820937 CTAAAATCAAAGTGTCAGCAGGG - Intronic
921318848 1:213917848-213917870 CTGAAGACAAAGTGGAAGCAAGG - Intergenic
921780374 1:219155760-219155782 CTGAAAGCAAAATGTCAGCAGGG - Intergenic
921953492 1:220958081-220958103 CTGAAATCAAGGTGCCAGCATGG + Intergenic
922064740 1:222125843-222125865 CTGAAATCAAGGTGTCAGCAGGG + Intergenic
922211017 1:223486937-223486959 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
922569840 1:226627946-226627968 CAGAAGGCAAAGAGGAAGCAAGG + Intergenic
922844056 1:228668972-228668994 CTGAATGAAAAGGGGCAGGATGG + Intergenic
923096374 1:230778339-230778361 GTGGAAGCAGAGAGGCAGCTAGG - Intronic
923236892 1:232042735-232042757 CGGAAGGCAAAGGGGAAGCAAGG - Intergenic
923290364 1:232539485-232539507 TTGAAGGCAAAGATGCAGAAGGG - Intronic
923397300 1:233579675-233579697 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
923448082 1:234091290-234091312 CTGAGAGTAAACAGACAGCAGGG - Intronic
923870802 1:237992113-237992135 CTGCAATCAAAGTGTCAGCAAGG - Intergenic
923952915 1:238980237-238980259 CTGACAGCAAGGTGTCAGCAGGG - Intergenic
924005156 1:239600812-239600834 GTGAAAGTAAAGAGGAAGGAAGG - Intronic
924757117 1:246951495-246951517 CTGAAATCAAGGTGTCAGCAGGG - Intronic
924836381 1:247651864-247651886 CAGAAATCAAAGAGGGAGCGAGG - Intergenic
924937021 1:248780531-248780553 CTGAAATCCAAGTGTCAGCAGGG - Intergenic
924937864 1:248787526-248787548 CTGACATCAATGAGGCAGGAGGG - Intergenic
1063042040 10:2351817-2351839 GTGAAAGCAAAGCCGCACCACGG - Intergenic
1063156152 10:3381082-3381104 CAAAAAGCAAAGAAGCAGCCAGG + Intergenic
1064181561 10:13120905-13120927 CGGAAAGCGAAGGGGAAGCAAGG + Intronic
1064462039 10:15544415-15544437 CTGAAACCAACGTGTCAGCAGGG - Intronic
1065822129 10:29535572-29535594 ATGAAAGCAAGGAGGCTGGAAGG + Intronic
1065837624 10:29673534-29673556 CGGAAGGCAAAGGGGAAGCAAGG + Intronic
1065964094 10:30756697-30756719 CAGAAAGCGAAGGGGAAGCAAGG + Intergenic
1067127716 10:43534084-43534106 CTGAAAGTGAAGGGGAAGCAAGG - Intergenic
1068096164 10:52494109-52494131 CTGAAATCAAGGTGTCAGCAGGG + Intergenic
1068122492 10:52797317-52797339 CAGAAGGCAAAGTGGAAGCAAGG - Intergenic
1068399200 10:56507189-56507211 CTGCAATCAAAGTGCCAGCAGGG + Intergenic
1068420304 10:56782667-56782689 CTGAAACTAAAGTGTCAGCAGGG + Intergenic
1069080642 10:64084860-64084882 GTCAAGGCAAAGATGCAGCAGGG - Intergenic
1069219161 10:65861712-65861734 TTGAAAGCTAGGAGGCAGGAGGG - Intergenic
1069267077 10:66473398-66473420 CAGAAGGCAAAGGGGCAGCAAGG - Intronic
1069639882 10:69947874-69947896 CAGAAACCAAAGGGACAGCAAGG - Intronic
1069778605 10:70941108-70941130 AAGGAAGCACAGAGGCAGCAGGG + Intergenic
1069789570 10:71011049-71011071 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1069802719 10:71092098-71092120 CTGAAAACAAGGTGTCAGCAGGG - Intergenic
1070246740 10:74739314-74739336 CTGAAATCAAGGTGGCAGCAGGG - Intergenic
1070253049 10:74789973-74789995 CAGAAATCATAGAGGCAGCCAGG + Intergenic
1070266051 10:74904302-74904324 CTGAAATCAAAATGTCAGCAGGG + Intronic
1070362054 10:75700031-75700053 CTGAAATCAAGGTGACAGCAGGG - Intronic
1070563752 10:77588251-77588273 CTGAGAGCAGAAAGGCAGAAAGG + Intronic
1070942675 10:80360261-80360283 CTAAAACCAAAGTGTCAGCAGGG + Intronic
1071197738 10:83180545-83180567 TGGAAAGCAAAGGGGAAGCAAGG - Intergenic
1071463172 10:85917725-85917747 TGGAAAGAAAAGAGGCTGCAAGG + Intronic
1071600596 10:86957002-86957024 CTGAAAGCTGAGACCCAGCAAGG - Intronic
1071702532 10:87955554-87955576 CTGAAGGCAAAAGGGGAGCATGG + Intronic
1071822568 10:89293226-89293248 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
1071969692 10:90891160-90891182 CTGAAATCAAGGTGTCAGCATGG + Intronic
1072232294 10:93424075-93424097 CTGAAATCAAGGTGTCAGCAGGG - Intronic
1072235696 10:93451548-93451570 GTGAAAGGAAAGAGGCAGTAAGG + Intronic
1072445881 10:95498114-95498136 CTGAATGCTAACAGGCAGAAAGG + Intronic
1072919436 10:99563556-99563578 CAGAAGGCAAAGAGGAAGCAAGG + Intergenic
1073141237 10:101249312-101249334 GTGAAAGCTGAGAGGCAGGAGGG + Intergenic
1073474193 10:103742201-103742223 CTGAAATCAAGGTGCCAGCAGGG + Intronic
1073939119 10:108673506-108673528 CTGAAGGCATAAAGCCAGCAAGG - Intergenic
1073976880 10:109112234-109112256 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1074208049 10:111301614-111301636 CAGAAGGCAAAGGGGAAGCACGG - Intergenic
1074256819 10:111811314-111811336 CTGAGATCAAAGGGCCAGCAGGG - Intergenic
1074376020 10:112941299-112941321 CGGAAGGCAAAGGGGGAGCAGGG + Intergenic
1074386501 10:113020564-113020586 CTGGTTGCAAAGAGGCAGCTGGG + Intronic
1074404648 10:113170360-113170382 CTGAAATCAAAGTGGTGGCAGGG + Intergenic
1074503573 10:114046118-114046140 ATGAAAGCAAAGAGAAAGGATGG + Exonic
1074702667 10:116106176-116106198 CTGAAATCAAGGTGTCAGCAGGG - Intronic
1074970169 10:118529657-118529679 CTGCAAGCCAAGAAGCACCAAGG + Intergenic
1075158935 10:120005841-120005863 CTGAAAGCGAGAAAGCAGCAAGG - Intergenic
1075286357 10:121190078-121190100 CCGAAAGCAAAGAGGCCACCTGG + Intergenic
1075514508 10:123098291-123098313 CTGAAATCAGAGTGTCAGCAGGG - Intergenic
1075568112 10:123519317-123519339 TTCATAGCAAAGATGCAGCAGGG + Intergenic
1075803858 10:125171075-125171097 CTGAAATCAAGGTGTCAGCAGGG + Intergenic
1075864052 10:125702655-125702677 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1075911031 10:126126002-126126024 CTGAAATCAAGGGGTCAGCAGGG - Intronic
1076026655 10:127121046-127121068 TACAAAGCAAAGAGCCAGCAGGG + Intronic
1076182397 10:128420480-128420502 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1076207245 10:128613069-128613091 GTGAAATCAAGGTGGCAGCAGGG + Intergenic
1076210361 10:128636717-128636739 CAGAAGACAAAGAGGAAGCAAGG - Intergenic
1077555298 11:3223061-3223083 CTGAGATCAAGGTGGCAGCAGGG - Intergenic
1077791254 11:5442477-5442499 CTGAAGGAAAAGAGGCAGAAAGG - Intronic
1078108842 11:8375782-8375804 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1078132669 11:8625404-8625426 CTGAAACCAAGGAGGCTGCTAGG + Intronic
1078457700 11:11488220-11488242 CTAAAATCAAAGGGTCAGCAGGG + Intronic
1078466697 11:11555257-11555279 CTGACAGCCAACAGGCTGCAGGG + Intronic
1078508895 11:11970826-11970848 CTAAAAGCAAAGAGTGGGCAGGG - Intronic
1078518653 11:12046443-12046465 CGGAAGGCGAAGAGGAAGCAAGG - Intergenic
1078674195 11:13394403-13394425 CAGAAGGCAAAGAGGAAGCAAGG - Intronic
1078710638 11:13787541-13787563 CGGAAGGCAAAGGGGAAGCAAGG - Intergenic
1079105988 11:17572763-17572785 GAGAAAGCTAAGAAGCAGCATGG - Intronic
1079188592 11:18258814-18258836 ATGAAAGAAAAGAGAAAGCAAGG - Intergenic
1079281484 11:19090776-19090798 CTGGAAGCATAGAGGCAGATTGG - Intergenic
1079490506 11:20983921-20983943 ATGGAGACAAAGAGGCAGCATGG - Intronic
1079541458 11:21580869-21580891 CTGAAATCAAGGTGTCAGCAGGG + Intergenic
1079769862 11:24445381-24445403 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1079881728 11:25936344-25936366 CTGAAGGCAAAGGGGAAGCAAGG - Intergenic
1079927922 11:26519555-26519577 CTGAGATCAAAGTGGCAGCATGG + Intronic
1080285488 11:30606534-30606556 ATGAACGCAAAGAGGAGGCAGGG - Intergenic
1080424013 11:32139649-32139671 CGGAAGGCAAAGGGGAAGCAAGG + Intergenic
1080598089 11:33793641-33793663 CTGGCAGCAAAGAGGCACAAAGG - Intergenic
1080621277 11:33989154-33989176 CAGAAAGCCAAGGGGAAGCAAGG + Intergenic
1080881829 11:36328494-36328516 TGGAAAACAAAGAGGGAGCAAGG - Intronic
1080905956 11:36544883-36544905 CAGAAGGCAAAGGGGAAGCATGG - Intronic
1080962272 11:37174398-37174420 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1081087785 11:38822833-38822855 CGGAAGGCAAAGGGGAAGCAAGG + Intergenic
1081302951 11:41475944-41475966 CCGAAGGCAAAGGGGAAGCAAGG + Intergenic
1081622185 11:44625107-44625129 CAGCAGGCAAAGAGGGAGCAGGG + Intergenic
1082864325 11:57884741-57884763 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1082893470 11:58164646-58164668 CTGAAAGCACCTGGGCAGCAAGG - Intronic
1083039267 11:59669881-59669903 CTGAAAGGAAAGGGGCAAGAAGG - Intergenic
1083107100 11:60368746-60368768 CGGAAGGCAAAGGGGAAGCAAGG - Intronic
1083314281 11:61804727-61804749 CTGGAAGTAGAGAGGCAGCAAGG + Exonic
1083873368 11:65506162-65506184 GTCAAAGCAAAGACGCCGCAGGG - Intergenic
1084081124 11:66825602-66825624 CTGAAATTAAAGTGCCAGCATGG - Intronic
1084277792 11:68063853-68063875 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
1084300250 11:68245179-68245201 CGGAAGGCAAAGGGGAAGCAAGG - Intergenic
1084467522 11:69334798-69334820 CTAAAATCAAGGAGTCAGCAGGG + Intronic
1084729540 11:71064581-71064603 CTGGAAGGAAAGAGGCTGGATGG + Intronic
1084780591 11:71405658-71405680 CTGAAAGCAAGGTGTCAGCAAGG - Intergenic
1084886281 11:72209354-72209376 CTGAAGGCTAAGGGGAAGCAAGG - Intergenic
1085000481 11:73028876-73028898 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
1085228331 11:74942871-74942893 CTGAGAGGAAGGAGACAGCAAGG + Intronic
1085333602 11:75672696-75672718 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1085674057 11:78498608-78498630 CTGAAATCAAAGTGGAAGCTGGG - Intronic
1085676095 11:78520200-78520222 CTGAAATCAAAGTGCCAGCAAGG + Intronic
1085713202 11:78848818-78848840 TGGAAAGCAAAGAGGAAGGAAGG + Intronic
1085721116 11:78913218-78913240 ATGAAAGCAGAGAAGCAGGAAGG - Intronic
1085823488 11:79818066-79818088 CTGAAATCAAGGTGTCAGCAGGG + Intergenic
1086313698 11:85566512-85566534 CTGAAATCAGAGTGCCAGCATGG + Intronic
1086595910 11:88570098-88570120 CTTAAAGCAAAACAGCAGCAGGG - Intronic
1086676184 11:89609830-89609852 CTGAAATCAAAGTGTCATCATGG + Intergenic
1086862342 11:91939663-91939685 CAGAAAGTGAAGAGGAAGCAAGG - Intergenic
1086996897 11:93368494-93368516 CAGAAGGCAAAGGGGAAGCAAGG + Intronic
1087130277 11:94663518-94663540 CTGGAAGCTAAGAGAAAGCACGG + Intergenic
1087335817 11:96843004-96843026 CTGAAGTCAATGAGGGAGCATGG - Intergenic
1087725605 11:101712767-101712789 CAGAAGGCAAAGGGGAAGCAAGG + Intronic
1087817909 11:102679334-102679356 CAGAAGGCAAAGGGGGAGCAGGG + Intergenic
1087980644 11:104609471-104609493 TTGAAAGCTGTGAGGCAGCATGG + Intergenic
1088072665 11:105809669-105809691 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
1088161089 11:106871479-106871501 CTGAAAGCATAGGGACAGCAAGG - Intronic
1088392945 11:109335254-109335276 CTGAAATCAAAGTGAAAGCAGGG - Intergenic
1088415223 11:109581234-109581256 CAGAAGGCAAAGAGGAAGCAAGG + Intergenic
1088424319 11:109685508-109685530 CTGAGATCAAAGAGTCAGCAGGG - Intergenic
1088426706 11:109712737-109712759 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1088933204 11:114372881-114372903 CTAAAATCAAAAAGGCAGCAGGG - Intergenic
1089126544 11:116180505-116180527 CTGAAATCAAGGTGTCAGCAGGG - Intergenic
1089839758 11:121405622-121405644 CTGAAATCAAGGTGTCAGCAGGG - Intergenic
1090026367 11:123170824-123170846 CTGTGACCAAGGAGGCAGCAGGG - Intronic
1090087107 11:123660105-123660127 CAGAAGGCAAAGAGGAAGCAAGG + Intergenic
1090306959 11:125699487-125699509 CAGAAGGCAAAGGGGGAGCAGGG - Intergenic
1090704954 11:129327861-129327883 CGGAAGGCAAAGGGGAAGCAAGG + Intergenic
1090797380 11:130146614-130146636 CTGAAAGCAGACAGGCAGGTAGG - Intergenic
1090932707 11:131312671-131312693 AAGAAAGCAGAGAGGCAACAAGG + Intergenic
1091309084 11:134560240-134560262 CTGCATGCAAAGTGGCAGCCAGG - Intergenic
1091967506 12:4757094-4757116 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
1092347259 12:7725967-7725989 CTGAAGTCAGGGAGGCAGCAGGG - Intergenic
1092863986 12:12743951-12743973 CTAAAAGCAAGGTGCCAGCAAGG - Intronic
1092958176 12:13569571-13569593 CTGAAATCACAGTGCCAGCAGGG - Intronic
1093006741 12:14059388-14059410 CGGAAGGCAAAGGGGGAGCAAGG + Intergenic
1093665779 12:21811216-21811238 CGGAAGGCAAAGGGGAAGCAAGG - Intronic
1094031771 12:26020298-26020320 CTGAAATCAAAGTGCCAGCTGGG - Intronic
1094090680 12:26645592-26645614 TTGAATGCCCAGAGGCAGCATGG + Intronic
1094558618 12:31528172-31528194 CTGAAATCAAGGTGTCAGCAAGG + Intronic
1095042450 12:37457261-37457283 CTGAAATCAGGGAGTCAGCATGG + Intergenic
1095110697 12:38292124-38292146 CTGAAAGGCCAGAGTCAGCAAGG + Intergenic
1095154012 12:38830894-38830916 CTAGAAGCAGAGAGGCAGCATGG - Intronic
1095226586 12:39685358-39685380 CAGAAGGCAAAGGGGGAGCAAGG + Intronic
1095887880 12:47207600-47207622 ATAAAAGCAAAGAGGAAGGAAGG - Intronic
1095919271 12:47513251-47513273 CAGAAAGCAAAGAAGAAGCAAGG - Intergenic
1095990792 12:48033176-48033198 CTGATAGCATAGAGGCTGGAAGG + Intergenic
1096344423 12:50833123-50833145 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1096405221 12:51339168-51339190 CTGATAGGTAAGAGGGAGCAGGG + Intronic
1096943116 12:55371559-55371581 CTGAAATCAAGGTGACAGCAGGG + Intergenic
1096998573 12:55856409-55856431 CTGAAATCAAGGTGTCAGCAGGG + Intergenic
1097326330 12:58281472-58281494 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1097553506 12:61106660-61106682 CAGAAAGCTAAGGGGAAGCAAGG + Intergenic
1097589548 12:61557397-61557419 CTGAAATCAATGTGTCAGCAAGG - Intergenic
1098936104 12:76481152-76481174 CTAAAAGCAAAGTGTTAGCAGGG - Intronic
1098940658 12:76531119-76531141 CAGAAGGCAAAGGGGAAGCAGGG + Intronic
1099164186 12:79281900-79281922 CTGAAATCAAGGCGTCAGCAGGG + Intronic
1099243145 12:80162530-80162552 TTGAAAGCAACGTGTCAGCAGGG + Intergenic
1099246408 12:80198022-80198044 CAGAAAACAAAGAGGAAGAAAGG - Intergenic
1099314067 12:81063101-81063123 CAGAAGGCAAAGAGGAAGCAAGG + Intronic
1099383192 12:81980763-81980785 CAGAAAGCAAAGGGGAAGCAAGG - Intergenic
1099411081 12:82328992-82329014 CGGAGAGGAGAGAGGCAGCAGGG + Intronic
1099432561 12:82605214-82605236 TTGAAAGGAAAGAGGCAGTAAGG - Intergenic
1099790010 12:87321951-87321973 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1100290019 12:93204784-93204806 CGGAAGGCAAAGGGGAAGCAAGG - Intergenic
1100352798 12:93800623-93800645 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
1100383501 12:94084345-94084367 CTGAAATCAAGGGGTCAGCAAGG + Intergenic
1100715584 12:97302004-97302026 CTGAAAGCCCAGAGGAGGCAGGG - Intergenic
1100892796 12:99144882-99144904 CTGAGACCAAAGTGCCAGCAGGG - Intronic
1100966654 12:100020746-100020768 CTGAAATCAAGGTGTCAGCAGGG - Intergenic
1101364713 12:104061105-104061127 CTGAAATCAAAGTGTCAGTAGGG - Intronic
1101496189 12:105256584-105256606 TGGAAAGCAAAGAGGAAGCAAGG + Intronic
1101525437 12:105524209-105524231 CTTCAAGCAGAGAAGCAGCATGG + Intergenic
1101819547 12:108173300-108173322 CTCACAGCCAAGAGCCAGCAGGG - Intronic
1102011068 12:109618618-109618640 TGGAAAGCAGAGAGGGAGCAGGG + Intergenic
1102393299 12:112567117-112567139 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1102570839 12:113826033-113826055 CTGGAAGCCAGGAGCCAGCAAGG - Intronic
1102588308 12:113938875-113938897 CTGAAATCAAGGTGTCAGCAGGG - Intronic
1103041354 12:117698130-117698152 CTGAAATCAAGGTGGGAGCAGGG - Intronic
1103516771 12:121513403-121513425 CTGAAAGCAAAGACGCAGGCAGG + Intronic
1103578069 12:121893536-121893558 CTGAAATCAAGGTGTCAGCAGGG + Intronic
1103699079 12:122838938-122838960 CTAAAAGCAAAGTGTCAGAAAGG - Intronic
1103969786 12:124663350-124663372 CTGAGATCAAAGGGCCAGCAGGG + Intergenic
1104025307 12:125021661-125021683 CGGAAGGCAAAGGGGAAGCAAGG + Intronic
1104132703 12:125909765-125909787 CTAAAATCAAGGAGTCAGCAGGG - Intergenic
1104620380 12:130307573-130307595 CTGAAATCTAGGAGGCAGCAGGG + Intergenic
1105529081 13:21201940-21201962 CAGAAGGCAAAGAGGAAGCAGGG + Intergenic
1105572818 13:21620177-21620199 CTGAAGTCAAAGTGTCAGCAGGG + Intergenic
1106212465 13:27662892-27662914 TTAACAGCTAAGAGGCAGCAGGG + Intronic
1106532564 13:30607466-30607488 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
1106607439 13:31242173-31242195 CTGCAAGTCAGGAGGCAGCAAGG - Intronic
1106662758 13:31818733-31818755 CTGAAATCAAAGTGTCAGCAAGG + Intergenic
1106773953 13:32990626-32990648 CTGAAATCAAGGTGTCAGCAGGG + Intergenic
1106910341 13:34456422-34456444 CAGAAGGCAAAGAGGAAGCAAGG - Intergenic
1107324777 13:39230132-39230154 CTGAGAGGCAAGAGCCAGCAGGG - Intergenic
1107758142 13:43648024-43648046 CTCAAATCAAAGTGTCAGCATGG - Intronic
1107808874 13:44180310-44180332 CTGAAATCAAGGTGTCAGCAGGG + Intergenic
1109718493 13:66247071-66247093 CAGAAGGCAAAGAGGAAGGAAGG - Intergenic
1110134397 13:72047671-72047693 CAGAAATCAAAGCGTCAGCAAGG + Intergenic
1110169654 13:72485387-72485409 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1110186866 13:72685225-72685247 CAGAAAGCAAAGAGGAAGCGAGG - Intergenic
1110332515 13:74288838-74288860 CTGACAGAACAGAGGCAGGAAGG - Intergenic
1110452946 13:75657221-75657243 CTGAAATCAAGGTGTCAGCATGG - Intronic
1110994617 13:82090962-82090984 CTGAAATCAAAATGTCAGCAGGG + Intergenic
1111054327 13:82928038-82928060 CTCACAGCAAAGCAGCAGCATGG + Intergenic
1111107655 13:83668282-83668304 GTGAAAGCAAGGTGGCAGGAAGG - Intergenic
1111189443 13:84789346-84789368 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1111234463 13:85390541-85390563 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1111553547 13:89849384-89849406 CAGAAAGGAAAGGGGAAGCAAGG + Intergenic
1111676071 13:91390512-91390534 CTGAAATCAAAATGTCAGCAGGG + Intergenic
1111808689 13:93070197-93070219 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1112106638 13:96247511-96247533 TGGAAGGCAAAGAGGAAGCAAGG - Intronic
1112227349 13:97552877-97552899 CAGAAAGCCAAGAGACAGGACGG + Intergenic
1112259640 13:97866753-97866775 CTGAGACCACAGAGGCAGCTAGG + Intergenic
1112638690 13:101246981-101247003 AGGAAACCAAAGAGGCAGGAAGG + Intronic
1113001606 13:105644895-105644917 CTGAAAGAAAAAAGGAAGGAAGG - Intergenic
1113084282 13:106551659-106551681 CTGAAAGCAAGGTGTCAGAAGGG + Intronic
1113119032 13:106906607-106906629 CCGAAAGCAGCGCGGCAGCAGGG + Intergenic
1113240060 13:108327566-108327588 CTGAACGCAAGGAGTCACCAGGG + Intergenic
1113302212 13:109034473-109034495 CGGAAGGCAAACAGGAAGCAAGG - Intronic
1113763885 13:112868869-112868891 CGGAAGGCAAAGGGGAAGCAAGG + Intronic
1114139226 14:19892699-19892721 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1114356964 14:21921219-21921241 CTGAAATCAAGGAGTCAGTAAGG + Intergenic
1114489515 14:23090028-23090050 CTGAAAGTCAGGAGGCAGCAGGG + Exonic
1114521320 14:23338992-23339014 CAGAAGGCAAAGAGGAAGCAAGG + Intergenic
1114587140 14:23825541-23825563 TTGATATCAAACAGGCAGCAGGG - Intergenic
1114688921 14:24562268-24562290 CAGAAGGCAAACAGGGAGCAAGG - Intergenic
1114689202 14:24564389-24564411 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1114764017 14:25350095-25350117 TTTAAAGCCAAGAGGCAGCAGGG - Intergenic
1114775892 14:25480906-25480928 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1115003055 14:28444190-28444212 TGGAAAGCAAAGGGGAAGCAAGG - Intergenic
1115324656 14:32126281-32126303 CTGAAAGCAAGGTGTCAGCAGGG + Intronic
1115475299 14:33807698-33807720 CTGAAATCAAGGTGCCAGCAAGG + Intergenic
1115716223 14:36106818-36106840 CAGAAAGCAAGGAGGCAGGGAGG + Intergenic
1115833344 14:37367521-37367543 CTGAAGAAAAAGAGGAAGCATGG - Intronic
1116256513 14:42563104-42563126 CTACAAGCAAAGCAGCAGCAGGG - Intergenic
1116428202 14:44815967-44815989 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1116621803 14:47213891-47213913 CGGAAGGCAAAGAGAAAGCAAGG + Intronic
1116753445 14:48916268-48916290 CGGAAGGCAAAGGGGAAGCAAGG + Intergenic
1116982370 14:51185200-51185222 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1117036508 14:51735253-51735275 AATAAAGCAAAGAGGCAGCCAGG + Intergenic
1117304221 14:54458327-54458349 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1117459845 14:55934387-55934409 CGGAAGGCAAAGGGGAAGCAAGG - Intergenic
1117481888 14:56154518-56154540 CTGAAGGCAAAAGGGAAGCAAGG - Intronic
1117581821 14:57158841-57158863 CTGAAATCAAGGGGGCAGCAGGG - Intergenic
1117632869 14:57711253-57711275 CGGAAGGCAAAGGGGAAGCAAGG - Intronic
1118046691 14:61977897-61977919 CTGAAATCAAGGTGTCAGCAGGG + Intergenic
1118175320 14:63433883-63433905 CTGAACCCAAAGCAGCAGCAAGG - Intronic
1118467272 14:66042351-66042373 CTGAAAACAAGGTGTCAGCAGGG + Intergenic
1118518586 14:66554471-66554493 CGGAAGGCAAAGGGGTAGCAAGG + Intronic
1118831751 14:69440037-69440059 CGGAAAGCAAAGGGGAAGCAAGG + Intronic
1119020834 14:71112059-71112081 CAGAAAGGGAAGAAGCAGCAGGG - Exonic
1119746034 14:77044798-77044820 CTGTAAACAGAGAAGCAGCAAGG - Intergenic
1119758665 14:77136287-77136309 CAGAAACCAAAGACTCAGCAAGG - Intronic
1119767971 14:77202462-77202484 CTGAAATCAAGGTGTCAGCAGGG + Intronic
1119811484 14:77524271-77524293 CTGATAGCAAAGGGGCAGAAGGG + Intronic
1119938928 14:78619699-78619721 TGGAAGGCAAAGAGGAAGCAAGG - Intronic
1120089493 14:80314449-80314471 CTGCAAGCAAGGTGCCAGCATGG + Intronic
1120453962 14:84707919-84707941 CAGAAGGCAAAGTGGAAGCAAGG + Intergenic
1120642299 14:87029817-87029839 TGGAAGGCAAAGAGGAAGCAAGG - Intergenic
1120696507 14:87650754-87650776 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1120906677 14:89626750-89626772 CAGAAGGCAAAGAGGAAGCAAGG - Intergenic
1120983996 14:90316677-90316699 AAGAAAACAAAGAGGAAGCATGG - Exonic
1121345759 14:93134752-93134774 CAGAGAGGAAAGAGGCAGCGAGG + Intergenic
1121500415 14:94431453-94431475 CAGAAGGCAAAGGGGGAGCAAGG - Intergenic
1121693073 14:95891793-95891815 CTGAAATCCAAGTGTCAGCAGGG + Intergenic
1121929859 14:97962743-97962765 CTGAAATCAAAGCGGCAGCAGGG + Intronic
1122113657 14:99517404-99517426 CTGATAGCACAGAGGCAAGAGGG + Intronic
1123139642 14:106062456-106062478 CTGCAAACAAAGAGACACCAAGG + Intergenic
1123141953 14:106088429-106088451 CTGCAAACAAAGAGACACCAAGG + Intergenic
1123187959 14:106538117-106538139 CTGCAAACAAAGAGACACCAAGG + Intergenic
1202940980 14_KI270725v1_random:144991-145013 CTGAAATCAGGGAGTCAGCATGG + Intergenic
1124026560 15:25972260-25972282 CTGAAAGAAAAATGGGAGCATGG + Intergenic
1124381428 15:29170748-29170770 CTGAGATCAAAGTGCCAGCATGG - Intronic
1124436525 15:29653624-29653646 CGGAAGGCAAAGGGGAAGCAAGG - Intergenic
1124653981 15:31493970-31493992 CTCAAAGCAGAGAGGGAGGAGGG + Intronic
1124926398 15:34074463-34074485 CTGAAATCAAGGTGTCAGCAGGG + Intergenic
1125065941 15:35486442-35486464 CAGAAGGCAAAGGGGAAGCAAGG + Intronic
1125225495 15:37390693-37390715 CTGAAGGCAAAGGGGCAGCTAGG + Intergenic
1125270044 15:37928895-37928917 CAGAAGGCAAAGGGGAAGCAAGG + Intronic
1126002216 15:44221556-44221578 CTGAACACAAAGGGGCAGGAAGG + Intergenic
1126570406 15:50144450-50144472 CAGAAGGCAAAGAGGAAGCAAGG + Intronic
1126891202 15:53206270-53206292 CTGAAATCAAATTGTCAGCAAGG + Intergenic
1126939599 15:53752579-53752601 CTGAAATCACAGTGTCAGCAGGG - Intronic
1127048788 15:55057634-55057656 CTGAAATCAAAGTGTCAGCAGGG - Intergenic
1127217206 15:56835927-56835949 CTGAAAGGAAATGGCCAGCATGG + Intronic
1127315388 15:57789739-57789761 CTCAAAGTAAAGAGACGGCAGGG - Intergenic
1127328941 15:57920325-57920347 CTGAAAGCAAAGAGAAGACATGG + Intergenic
1128513413 15:68327287-68327309 CTGAAGGGGAGGAGGCAGCAGGG - Intronic
1128879302 15:71228386-71228408 CTGAAATCAAGGTGGCAGCAGGG - Intronic
1129426577 15:75467791-75467813 GTGAAAGCAAAGAGAGAGTATGG + Exonic
1129560304 15:76559433-76559455 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
1129947572 15:79553603-79553625 CTAAAAGCAAAAAGAAAGCAAGG + Intergenic
1129958835 15:79664788-79664810 CTGAAAACAAGGTGTCAGCACGG + Intergenic
1130192154 15:81747664-81747686 CAGAATGCCAAGAGGAAGCAGGG - Intergenic
1130448634 15:84028950-84028972 TGGAAGGCAAAGAGGAAGCAAGG - Intronic
1130568427 15:85019053-85019075 ATGGAAGCAGGGAGGCAGCAAGG - Intronic
1130633663 15:85595978-85596000 ATGAAATGAAAGAGGCAGGAAGG - Intronic
1131165396 15:90138620-90138642 CTGAGTGCCAAGAGGCAGCCTGG - Intergenic
1131298522 15:91173576-91173598 TTGAAGGCAAAGAGGCAGGCTGG - Intronic
1131532338 15:93204654-93204676 TGGAAAGCAAAGGGGAAGCAAGG - Intergenic
1131773332 15:95765211-95765233 CAGAAGGCAAAGAAGAAGCAAGG + Intergenic
1131990030 15:98084177-98084199 CTAAAAAGAAAGAGGCAGAATGG + Intergenic
1132138297 15:99366528-99366550 CTGAAATCAAGGGGTCAGCATGG + Intronic
1132313659 15:100875757-100875779 ATAAAAGCAAAGAGACATCATGG - Intergenic
1132385720 15:101398577-101398599 CTGAAAGCACAGAGGAGGCTCGG + Intronic
1132556971 16:576812-576834 CTGAAGGCCCAGAGGCAGCATGG - Intronic
1132781129 16:1626234-1626256 CTAACAGCAAAGAGGAAGCACGG - Intronic
1133406674 16:5530025-5530047 CTGAAAGCAAGGTGTCTGCATGG - Intergenic
1133518648 16:6534718-6534740 CAGAATGCAAAGAGGGAGAAGGG + Intronic
1133569831 16:7030419-7030441 CTGAAATCAAAATGTCAGCAAGG + Intronic
1133650780 16:7812485-7812507 TGGAAGGCAAAGAGGAAGCAAGG - Intergenic
1133678694 16:8099864-8099886 CTGAAGGCAAAGGGGTAGCAGGG - Intergenic
1133810513 16:9157860-9157882 CACAGAGCCAAGAGGCAGCAGGG - Intergenic
1134332456 16:13263502-13263524 CAGAAGGCAAAGAGGTAGCAGGG - Intergenic
1134552925 16:15146337-15146359 CTAACAGCAAGGATGCAGCAGGG + Intergenic
1135147541 16:19975771-19975793 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1135396343 16:22134568-22134590 CTGAAATCAAGGTGTCAGCAGGG + Intronic
1135841169 16:25877652-25877674 CTGAAATCAAAGTGTCAGCAGGG - Intronic
1135959479 16:26983793-26983815 CCCAAAGCACAGAGGCAGGAAGG - Intergenic
1136027244 16:27476545-27476567 CTGAAAGAGAGGGGGCAGCAGGG + Intronic
1137061318 16:35793729-35793751 GTGAAAGCAAAGAGAAATCAAGG + Intergenic
1137292722 16:47062848-47062870 GGGAAAGCAAAGGGGAAGCAGGG + Intergenic
1137384860 16:48031896-48031918 CTGACACCAGAGAGGCACCAGGG - Intergenic
1137452187 16:48586807-48586829 GTCAAATCAAAGAGGAAGCATGG + Intronic
1137840056 16:51632474-51632496 CAGAAGGCAAAGAGGAAGCAAGG + Intergenic
1137882252 16:52062249-52062271 CTGAAATCAAGGTGTCAGCAGGG + Intronic
1137889932 16:52148607-52148629 CTGGTAGCAAACAGGAAGCAAGG - Intergenic
1138236705 16:55389795-55389817 CTGAAAGTCAAGAGGCCCCATGG + Intronic
1138261465 16:55626354-55626376 CTGAAATCAAGGTGTCAGCAGGG - Intergenic
1138304854 16:55965244-55965266 CTGAAATCAAAGTGACAGCTGGG + Intergenic
1138579259 16:57929394-57929416 AGGAAAGCAAAGGGGAAGCAAGG + Intronic
1138718362 16:59049662-59049684 CAGAAAGCAAGGGGTCAGCAGGG + Intergenic
1138770993 16:59663654-59663676 GTGAAAGCAGAGAGGCAGTAAGG - Intergenic
1138889005 16:61117931-61117953 CTGAAATCAAGGTGTCAGCAGGG - Intergenic
1139128640 16:64113474-64113496 CAGAAAGCAAAGGGGAAGCGAGG + Intergenic
1140131549 16:72166348-72166370 CGGAAGGCAAAGGGGAAGCAAGG - Intronic
1140825772 16:78704757-78704779 CTGAAAGAAAGGAGTCAACAGGG - Intronic
1140859673 16:79008053-79008075 CTGAAATCAAAGCGTCAGCCAGG + Intronic
1140957966 16:79884806-79884828 CTGAAATCAACGTGTCAGCAGGG - Intergenic
1141121627 16:81362911-81362933 AGGAAAGCTAAGAGGCAGGAGGG - Intronic
1141416209 16:83877378-83877400 CTGAAATCGAAGGGTCAGCAGGG + Intergenic
1141563858 16:84888112-84888134 CTAAAATCAAGGTGGCAGCAGGG + Intronic
1141877418 16:86835453-86835475 CCCAAAGGAAGGAGGCAGCAGGG + Intergenic
1141882891 16:86871658-86871680 CAGAAGGCAAAGAAGAAGCAAGG - Intergenic
1142510677 17:390708-390730 CTGAAATCAAGGTGTCAGCAGGG - Intergenic
1143185598 17:5008189-5008211 CTGAAAGGAAGGAAGGAGCAGGG + Intronic
1143253040 17:5536941-5536963 CTGAAAGCACAAAGGGAGCCGGG + Intronic
1143352450 17:6298691-6298713 CTGAAATCAAGGTGTCAGCAGGG + Intergenic
1143502317 17:7346743-7346765 TGGGAAGCAAAGTGGCAGCATGG - Intronic
1143590207 17:7881336-7881358 CAGACAGCAAAAAGGCAGGAAGG + Intronic
1143701016 17:8660164-8660186 CTGAAACCAAGATGGCAGCAAGG - Intergenic
1143935920 17:10483915-10483937 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1144160579 17:12553728-12553750 CTGCAAGCCAAGGGGCATCAAGG - Intergenic
1144203810 17:12964983-12965005 AAGAAAGAAAAGAGGCAGTAGGG - Intronic
1144875319 17:18394354-18394376 GTGAGACCAGAGAGGCAGCAGGG + Intergenic
1145156905 17:20550067-20550089 GTGAGACCAGAGAGGCAGCAGGG - Intergenic
1145751799 17:27360651-27360673 CTGAAACCCAAGTGTCAGCAGGG - Intergenic
1145982842 17:29024224-29024246 CTGGAAGCAAAGAGGAGACATGG - Intronic
1146406097 17:32539483-32539505 CTGAAATCAAAGTGTGAGCAGGG + Intronic
1146673281 17:34756595-34756617 CTGAAAGCCAGGAGGCCTCATGG - Intergenic
1146681131 17:34809154-34809176 CAGAAGGCAAAGAGGAAGCAAGG - Intergenic
1147273483 17:39294560-39294582 TTTAAATCAAAGAAGCAGCAGGG - Intronic
1147925108 17:43941215-43941237 CTGGGAGGGAAGAGGCAGCAGGG + Intronic
1148293212 17:46475253-46475275 CTGCAAGCAGAGAGGGAGCATGG + Intergenic
1148315397 17:46692956-46692978 CTGCAAGCAGAGAGGGAGCATGG + Exonic
1148322068 17:46763206-46763228 CAGAAAGAAGAGATGCAGCAGGG - Exonic
1149143449 17:53461205-53461227 CTGACAGATAAGAGGAAGCATGG + Intergenic
1149243223 17:54675460-54675482 CTGAAAGGGAAGGGGAAGCAAGG + Intergenic
1149342995 17:55705921-55705943 CTGAAGGCAAAGGGGAAGCAAGG - Intergenic
1149657350 17:58317268-58317290 CTGGAAGCAAGGAGGCAGAAAGG + Intronic
1150011476 17:61508594-61508616 CAGAAGGCAAAGAGGAAGCAAGG + Intergenic
1150221273 17:63497109-63497131 CGGGAAGCAAGGAGACAGCATGG - Intronic
1150843919 17:68635402-68635424 CAGAAGGCAAAGAGGAAGCAAGG - Intergenic
1151192016 17:72405697-72405719 CGGAAGGCAAAGAGGAGGCAAGG + Intergenic
1151271819 17:73002780-73002802 CTGAAATCAATGTGTCAGCAGGG + Intronic
1151771675 17:76166918-76166940 CTGACAGCAAAGGGGCTGCTCGG - Intronic
1151953737 17:77370218-77370240 CTGAAATCAAGGTGCCAGCAGGG + Intronic
1152046292 17:77938170-77938192 CTGAAAGGAGGGAAGCAGCAAGG + Intergenic
1152270064 17:79319339-79319361 GAGAAAGGAAAGAGGCAGAACGG + Intronic
1152372906 17:79901588-79901610 CTGAAATCAAGGTGTCAGCAGGG + Intergenic
1152831420 17:82499368-82499390 CAGAAAGCAAAGATGCAGAAGGG - Intergenic
1153138779 18:1948003-1948025 CAGAATGCAAAGGGGAAGCAAGG + Intergenic
1153610609 18:6880525-6880547 CTGTAGGCAATGAGGCAGCCTGG - Intronic
1154296079 18:13149979-13150001 GGGAAAGCAAAGGGGAAGCAAGG + Intergenic
1155252396 18:23964953-23964975 GTAAAACCAAAGAGGCAGCCTGG + Intergenic
1155529794 18:26755248-26755270 CTGAGATCAAGGTGGCAGCAGGG - Intergenic
1156403226 18:36759509-36759531 CTGAAATCAAAGAGGAAGTGGGG + Intronic
1156524963 18:37758275-37758297 CTGAAGGCAAAGGGGGAGCAGGG + Intergenic
1156620373 18:38844596-38844618 CTGAGATCAAGGTGGCAGCAAGG - Intergenic
1156791480 18:40980012-40980034 CTGAGATCAAAGTGTCAGCAGGG - Intergenic
1156819456 18:41355082-41355104 CTGATAGAAATGAGACAGCATGG - Intergenic
1157303482 18:46498232-46498254 CTGAGAGCCTAGAGTCAGCAGGG - Intronic
1157330348 18:46699677-46699699 GTGAAAGAAAAGAGGGAGAAAGG - Intronic
1157905089 18:51562654-51562676 CTGAAATCAAGGTGTCAGCAGGG - Intergenic
1157946329 18:51984723-51984745 CTGAAGGCAAAGGGGAAGCAGGG + Intergenic
1158077970 18:53553250-53553272 ATGAAATCAAAGTGTCAGCAGGG - Intergenic
1158933665 18:62345234-62345256 CTGGAAGCAGAGAGCCAGAAAGG + Intronic
1158943121 18:62424688-62424710 CTGAAATCAAGGTGTCAGCAGGG - Intergenic
1159014898 18:63093311-63093333 CAGAAAGCAAGGTGCCAGCAGGG + Intergenic
1159265630 18:66074762-66074784 CAGAAGGCAAAGAGGAAGCAAGG + Intergenic
1159492179 18:69150910-69150932 CGGAAAGCAAAGGGGAAGCAAGG - Intergenic
1159766555 18:72497681-72497703 CTAAAAGCTATGAAGCAGCAAGG + Intergenic
1160006783 18:75074111-75074133 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1160309795 18:77778677-77778699 CTAAAATCAGAGAGTCAGCAGGG + Intergenic
1160576962 18:79861728-79861750 CTGAAAGGAAAGAGGGAACAGGG - Intergenic
1161061477 19:2217314-2217336 CTGAGAACTAAGAGGCATCAGGG - Intronic
1162175920 19:8830181-8830203 CAGAAAGCAAAGGGAAAGCAAGG - Intronic
1163528579 19:17836169-17836191 CTGTATGAACAGAGGCAGCAGGG - Intronic
1164411402 19:28008828-28008850 CAGTATGCAAAGAGCCAGCAGGG + Intergenic
1164469673 19:28519510-28519532 GTGAAAGCAAAGTGTTAGCAAGG - Intergenic
1164631900 19:29767548-29767570 CCTAAAGCAAGGAGGCAGCAGGG + Intergenic
1165283078 19:34814648-34814670 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1165883493 19:39060334-39060356 CTGGAAGCAGAGAGGCAGTGTGG + Intergenic
1166146473 19:40840255-40840277 CAGAAAGCAAAGAGGGAGTAAGG - Intronic
1166150519 19:40870868-40870890 CAGAAAGCAAAGAGGGAGTAAGG - Intronic
1166189553 19:41166920-41166942 CTGCAACCACAGAGGGAGCAGGG - Intergenic
1166395032 19:42433407-42433429 CTGAAAGCAGAGAGGCAAAATGG - Intronic
1166426239 19:42680898-42680920 AGGAAGGCAAAGAGGGAGCAAGG - Intronic
1166968687 19:46547420-46547442 CTGAAGGCAAAGGGGAAGCAAGG - Intronic
1167009601 19:46798352-46798374 CTGAAACCAAAGCGTTAGCAGGG + Intergenic
1167150282 19:47704905-47704927 CTGAAAACAAGGTGGCATCAGGG + Intergenic
1167172753 19:47844112-47844134 CTGAAAGGCAAGAGGAAGAATGG - Intergenic
1167705937 19:51081312-51081334 CTGAAAGCAGATGGGCAGCTTGG - Intronic
1167800724 19:51739614-51739636 CTGAAATTAAAGTGGCGGCAGGG - Intergenic
1167945680 19:52986701-52986723 TTGAATGCAAAGATGGAGCAAGG - Intergenic
1168655205 19:58122540-58122562 CTTAAAGCCGAGAAGCAGCAGGG + Intergenic
925178272 2:1799950-1799972 CAGAAGGTAAAGAGGAAGCAAGG - Intronic
925465959 2:4107700-4107722 CAGTAAGAAAAGAGGCAGCCCGG + Intergenic
925660242 2:6194592-6194614 CAGAATGCAAAGGGGAAGCAAGG - Intergenic
925812377 2:7713047-7713069 CAGCAAGCAAAGAGGCCGTACGG - Intergenic
925845706 2:8031510-8031532 CCAAAAGCAAAGTGTCAGCAGGG + Intergenic
926460014 2:13117517-13117539 ATGAAAGGAAAGAGGCAGTGAGG - Intergenic
926653421 2:15371205-15371227 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
927102975 2:19802161-19802183 CTGAGAGGAAAGAAGCTGCATGG - Intergenic
927301083 2:21515976-21515998 CTAAAATCAAAGTGTCAGCAGGG + Intergenic
928226851 2:29457079-29457101 CTGAAAGCAGAAAGGCACCGTGG + Intronic
928239148 2:29571483-29571505 CAGAAAGCAAAGGGGAAACAAGG - Intronic
928274665 2:29889582-29889604 GTGACAGCAGAGAGACAGCAGGG + Intronic
928469191 2:31556688-31556710 CTGAAATCAAGGTGTCAGCAGGG - Intronic
928856508 2:35808916-35808938 CTGTGTGCAAAGAGGAAGCAGGG - Intergenic
929612642 2:43283146-43283168 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
930561718 2:52967547-52967569 CGAAAAGGAAAGAGGCAGCATGG + Intergenic
930568372 2:53052252-53052274 CTGAAATCAAAGTGTCAGCAAGG - Intergenic
930912317 2:56643969-56643991 CTGAAAGCAAAGCATCAGCAGGG - Intergenic
930936823 2:56963336-56963358 CCGAAATCAAGGAGTCAGCAGGG + Intergenic
931898731 2:66763923-66763945 CTGAAACCAAGGTGGCAGCAAGG - Intergenic
932092310 2:68817426-68817448 ATGAGAGCAAGGAGGCACCATGG + Intronic
932176115 2:69604401-69604423 ATGAAAGCAATGAGGCCACATGG - Intronic
932267841 2:70383550-70383572 CGGAAGGCAAAAAGGAAGCAAGG - Intergenic
933933724 2:87182003-87182025 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
934148753 2:89123541-89123563 CTGCAAGAAAAGAGGCACCTAGG + Intergenic
934167015 2:89303020-89303042 CTAAAATCAAAGAGTGAGCAGGG - Intergenic
934200263 2:89879434-89879456 CTAAAATCAAAGAGTGAGCAGGG + Intergenic
934218545 2:90058502-90058524 CTGCAAGAAAAGAGGCACCTAGG - Intergenic
934575099 2:95395191-95395213 CTGAGAGCCAGGAGGCAGCTGGG + Intergenic
935143121 2:100373016-100373038 CTGAAATCAAGGTGGTAGCAAGG + Intergenic
935322721 2:101904756-101904778 TTGGATGCAAAGAGGCAGGAGGG - Intergenic
935341674 2:102064677-102064699 CTGAGAGCAAGGAGGCAGCTAGG - Intronic
935464980 2:103385475-103385497 CTGAGAGCAAAGAAACAGAAAGG - Intergenic
935933011 2:108150086-108150108 CAGAGAGAAAAGAGGCAGCCAGG + Intergenic
936014636 2:108948574-108948596 CAGAAGGCAAAGGGGAAGCAAGG + Intronic
936265305 2:111000570-111000592 CTGAAATCATGGTGGCAGCAGGG + Intronic
936359386 2:111783441-111783463 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
936886577 2:117318184-117318206 CTGAAATCAAAGGGTCAGCAGGG + Intergenic
937334281 2:121051903-121051925 CTGAAATCAAGGTGGCTGCAGGG - Intergenic
937470935 2:122173333-122173355 GGGAAAGCCACGAGGCAGCAGGG + Intergenic
937581244 2:123491368-123491390 CTGAGATCAAAATGGCAGCATGG + Intergenic
937811851 2:126208119-126208141 CAGAAGGTAAAGAGGAAGCAAGG - Intergenic
937862924 2:126725462-126725484 CAGAAGGCAAAGAGACAGAAAGG + Intergenic
937898866 2:127000759-127000781 CTGAAATCAAGGTGACAGCAGGG + Intergenic
937935114 2:127237776-127237798 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
938406552 2:131036068-131036090 CTGCAGGCAGAGAGGCAGCCTGG + Intronic
938542352 2:132294787-132294809 CTGAAATCAAGGTGTCAGCAGGG + Intergenic
938768052 2:134476321-134476343 ATGACAGCAAAGGGGCAGGAGGG + Intronic
938992714 2:136645685-136645707 GTGAAAGGAAGGAGGCAGGAGGG + Intergenic
939038790 2:137163631-137163653 CTGAAATCAAGGTGTCAGCAGGG - Intronic
939141826 2:138363084-138363106 TTGAAAGCAATTAGGAAGCAGGG - Intergenic
939163947 2:138620333-138620355 CTGAATGAAAAGAGGCAAGAGGG + Intergenic
939214853 2:139222914-139222936 CTGAAATCAAGGTGTCAGCAGGG + Intergenic
939254505 2:139724804-139724826 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
939264425 2:139853011-139853033 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
939678320 2:145099395-145099417 TTGAAAGATAAGGGGCAGCATGG + Intergenic
939698116 2:145353984-145354006 CTGGAAGCAGAGAGGTATCAGGG - Intergenic
939803798 2:146748038-146748060 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
939887946 2:147701684-147701706 CAGAAAGCAAAGAAGAAGCAAGG + Intergenic
940019477 2:149141799-149141821 CTGAAATCAAGGTGTCAGCAAGG + Intronic
940105063 2:150090130-150090152 GTGAGAGCACAGAAGCAGCAAGG - Intergenic
940111115 2:150155028-150155050 CAGAAATCAAAGTGACAGCAGGG - Intergenic
940113227 2:150178614-150178636 GAGCAAGCAAAGAGGCAGAAAGG + Intergenic
940207182 2:151216090-151216112 CTGATTGAAAAGAGGCAGTAGGG + Intergenic
940610280 2:155981302-155981324 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
940649539 2:156427800-156427822 CTGAAATCAAGGGGTCAGCAGGG + Intergenic
940779132 2:157914742-157914764 CTGAAATCAAAGTGTCAGCAGGG + Intronic
940939533 2:159542693-159542715 CTGAAAGCATAAAGGCAAGAAGG + Intronic
941226015 2:162849117-162849139 CAGAAGGTGAAGAGGCAGCAAGG + Intergenic
941755741 2:169183925-169183947 CTGAAAACACAAAGGCAGAATGG - Intronic
942471768 2:176268232-176268254 CTGAAATCAAGGTGTCAGCAGGG - Intergenic
942484627 2:176426154-176426176 CTAAAATCAAAGTGGCACCAAGG + Intergenic
942956796 2:181782864-181782886 CTGAAACCAAGGTGTCAGCAGGG - Intergenic
943082452 2:183271496-183271518 CAGAAGGCAAAGAGGAAGCAAGG - Intergenic
943340173 2:186671300-186671322 ATGCAAGCAGAGAGGCAGGAAGG - Intronic
943686227 2:190821218-190821240 CTGAAATGAAAGAGGAAGGAAGG - Intergenic
943848592 2:192686704-192686726 CTGAAATCAAGGTGTCAGCAGGG + Intergenic
944223955 2:197330983-197331005 CAGAAGGCAAAGAGAAAGCAAGG + Intergenic
944464135 2:199983265-199983287 CTGAAATCAAAGTATCAGCACGG - Intronic
944546227 2:200801664-200801686 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
945358015 2:208861350-208861372 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
945471704 2:210234511-210234533 CTGAAATCAAAGTGTCAGCAGGG - Intergenic
945804524 2:214474264-214474286 CTGAAAGCAAAGAGGCAGCATGG + Intronic
946730578 2:222705521-222705543 CTGAGAGCCAAGAGGGTGCATGG + Intronic
946917937 2:224545506-224545528 CTTAAAGCAAAGAGTAAGAATGG - Intronic
946985626 2:225269578-225269600 CAGAAGGCGAAGAGGAAGCAAGG + Intergenic
947208116 2:227681052-227681074 TGGAAAGCAAAGGGGAAGCAAGG + Intergenic
947236685 2:227948789-227948811 CAGAAGGCAAAGAAGAAGCAAGG - Intergenic
947241500 2:227999343-227999365 GTGCAGCCAAAGAGGCAGCATGG + Intronic
947338022 2:229107197-229107219 CTGAAATCAAGGTGACAGCAGGG - Intronic
948229467 2:236339043-236339065 CAGACAGCAAAGAGGAAGCCGGG + Intronic
948267295 2:236644346-236644368 CTGAAATCAAAGTGTCTGCAGGG - Intergenic
948295718 2:236858871-236858893 CTGCCAGCAAACAGCCAGCAAGG - Intergenic
948903650 2:240967933-240967955 ATTAAAGGAAAGAGGCAGGAGGG + Intronic
1169017953 20:2307009-2307031 CAGAAAGGACAGAGGGAGCAGGG - Intronic
1169052107 20:2588369-2588391 CTGAAATCAAAGAGTCAGCAGGG - Intronic
1169334841 20:4747643-4747665 CTGAAATCAAGGGGTCAGCAGGG - Intergenic
1169770069 20:9190418-9190440 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
1169844441 20:9974451-9974473 CTAAAATCAAGGAGGCAGCAGGG + Intergenic
1169852777 20:10070644-10070666 CAGAAGGCAAAGGGGCAGCGAGG + Intergenic
1170167642 20:13378896-13378918 CTGAAAGCAAAAATAAAGCAGGG - Intergenic
1170182032 20:13542308-13542330 CTGAAAGCTTAGAGTCACCAAGG + Intronic
1170445763 20:16425935-16425957 CAGAAGGCAAAGAGGAAGCAAGG + Intronic
1170575367 20:17658762-17658784 GTGAAGGCAAAAAGGCAGAAGGG - Intronic
1170956127 20:20981062-20981084 CAGAAAGTAAAGGGGAAGCAAGG + Intergenic
1171536878 20:25900331-25900353 CTGAAATCAGGGAGTCAGCATGG + Intergenic
1171804227 20:29660822-29660844 CTGAAATCAGGGAGTCAGCATGG - Intergenic
1171839824 20:30195601-30195623 CTGAAATCAGGGAGTCAGCATGG + Intergenic
1171871231 20:30527630-30527652 CTGAAATCAAGGTGTCAGCAGGG + Intergenic
1172583597 20:36066705-36066727 ATGAAATCAACGAGGCAGCCAGG - Intergenic
1173007476 20:39151157-39151179 CAGGAATCCAAGAGGCAGCAGGG - Intergenic
1173098181 20:40058676-40058698 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1173348289 20:42221458-42221480 CAGAAAGCAAAGGGGAAGCAAGG + Intronic
1173428794 20:42967542-42967564 CTGAAATCAAGGTGTCAGCAGGG - Intronic
1173813550 20:45971133-45971155 CTGACAGCCAAGAGGAAACAAGG - Intronic
1174194744 20:48764977-48764999 CTGAAATCAAGGTGCCAGCAGGG - Intronic
1174208560 20:48858678-48858700 CTGAAAATAGACAGGCAGCAGGG + Intergenic
1174309010 20:49635906-49635928 CTGAAGGCCAAGAGGCTCCAAGG + Exonic
1174566699 20:51469839-51469861 CTGAAATCAAGGTGTCAGCAGGG - Intronic
1174615034 20:51828957-51828979 GTGAAACCAGAGAAGCAGCAGGG - Intergenic
1174651246 20:52127546-52127568 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
1174729667 20:52903405-52903427 GGGAAGGCAAAGAGGAAGCAAGG + Intergenic
1174864783 20:54125255-54125277 TAAAAAGCAAAGAGCCAGCATGG + Intergenic
1175123570 20:56735460-56735482 CTGAAAGCAAACAGATTGCAGGG - Intergenic
1175214831 20:57386572-57386594 CTAAAATCAAGGTGGCAGCAAGG + Intergenic
1175258119 20:57658977-57658999 CTGAAAGCAGGGAGGCACCTGGG - Intronic
1175323492 20:58106426-58106448 CTGAAATCAAGGTGTCAGCAGGG + Intergenic
1175503088 20:59464062-59464084 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1175557006 20:59871430-59871452 TTGACAGTAAAGGGGCAGCATGG + Intronic
1175564489 20:59962338-59962360 CTGAAACCAAGGCGTCAGCAGGG + Intronic
1175616690 20:60405762-60405784 ATGAAAACAAAGAGGCAGAGAGG - Intergenic
1175667722 20:60874302-60874324 CTGAAAGGGAGGAGGCAGGATGG + Intergenic
1176192308 20:63817817-63817839 CTATAAGCCAAGAGGCACCAGGG + Intronic
1176305718 21:5122119-5122141 CAGAAAGCTAACAAGCAGCACGG - Intronic
1176582180 21:8541952-8541974 CTGAAATCAGGGAGTCAGCATGG - Intergenic
1176589290 21:8627130-8627152 CTGAAAGCAGGGTGTCAGCATGG + Intergenic
1177089401 21:16748179-16748201 CGGAAGGCAAAGCGGAAGCAGGG - Intergenic
1177489026 21:21797346-21797368 CTGAAATTAAAGTGTCAGCAGGG - Intergenic
1177590262 21:23154857-23154879 CTGAATCAGAAGAGGCAGCAGGG + Intergenic
1177713191 21:24806459-24806481 CTTAAAGCAATTATGCAGCAAGG - Intergenic
1177770018 21:25503852-25503874 CTGAAGGCAAAGGGAAAGCAAGG - Intergenic
1177775728 21:25563646-25563668 CAGAAATCAGGGAGGCAGCAAGG - Intergenic
1178024164 21:28446147-28446169 CGGAAGGCAAAGAGGAAGCAAGG - Intergenic
1178212979 21:30559093-30559115 CGGAAGGCAAAGGGGAAGCAAGG - Intronic
1178246197 21:30955056-30955078 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1178354094 21:31896129-31896151 CTGAGATCAAAGTGTCAGCAGGG - Intronic
1178368943 21:32011143-32011165 CTGAAATCAAGGTGTCAGCAGGG + Intronic
1178630191 21:34252765-34252787 CTGAAATCAAGGTGTCAGCAGGG - Intergenic
1178740326 21:35194025-35194047 CGGAAGGCAAAGAGGAAGGAAGG + Intronic
1178751498 21:35308497-35308519 CTAAAATCAAAGTGGCAGCAGGG + Intronic
1178754603 21:35336685-35336707 CTGAAATCAATGAGTCAGCAGGG - Intronic
1178797181 21:35755690-35755712 CGGCAGGCAAGGAGGCAGCAGGG + Intronic
1178821643 21:35980992-35981014 CTGAGAGCAAAGAAGGGGCAAGG - Intronic
1178862012 21:36297503-36297525 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1178933370 21:36838891-36838913 CTGAAATCAAGGTGTCAGCAGGG - Intronic
1179081882 21:38178977-38178999 CTGAAAGGAAAGATGGAGGATGG - Intronic
1179085395 21:38212211-38212233 CAGAAAGCAAAGGGGAAGCAAGG - Intronic
1179312963 21:40213027-40213049 CTGAAATCAAGAAGTCAGCAGGG - Intronic
1179343839 21:40537786-40537808 CTGAGATCAAGGAGTCAGCAGGG - Intronic
1179407307 21:41136607-41136629 CTGAAAGGAATGAAGCTGCATGG - Intergenic
1179851339 21:44139912-44139934 CAGAAAGCTAACAAGCAGCACGG + Intronic
1179910161 21:44443212-44443234 CTTGAAGCTCAGAGGCAGCAGGG + Intergenic
1179912258 21:44456475-44456497 CTGAAAGGGAAGACGCAGGAGGG - Intronic
1179994293 21:44966914-44966936 CGGGAAGGAGAGAGGCAGCAGGG + Intronic
1180265015 22:10519000-10519022 CTGAAATCAGGGAGTCAGCATGG - Intergenic
1180272117 22:10604127-10604149 CTGAAAGCAGGGTGTCAGCATGG + Intergenic
1181078524 22:20397825-20397847 CTGAAATCAAGGTGTCAGCAGGG + Intronic
1181310430 22:21941790-21941812 CTGAAAGCAAACCGACAGGAGGG + Intronic
1181887429 22:26032311-26032333 CTGAAATCAAGGTGTCAGCAGGG + Intergenic
1182100949 22:27656806-27656828 CTGAAATCAAGGTAGCAGCATGG - Intergenic
1182120925 22:27786187-27786209 CTGAAGGCAGAGAGACAGGAAGG + Intronic
1182133243 22:27874762-27874784 CTGCAAAGAAAGAGACAGCAGGG + Intronic
1182416676 22:30225787-30225809 CTGAAATCAAGGTGCCAGCAGGG + Intergenic
1182808397 22:33095222-33095244 CTAAAATCAAAGTGTCAGCAGGG + Intergenic
1183214939 22:36473533-36473555 CAGAAAGAAAAGAGGAAGGAAGG + Intronic
1183298314 22:37045143-37045165 CTGAAACCAAAAACCCAGCAGGG + Intergenic
1183495157 22:38139110-38139132 CAGAAAGGAAAGAGGCATCTAGG + Intronic
1184521075 22:44994490-44994512 CTGAAAGGAAAGTGTCAGCAGGG - Intronic
1185016918 22:48349658-48349680 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
949102510 3:163076-163098 TTGAAGGCAGAGAGGAAGCAGGG - Intergenic
949107834 3:222209-222231 CTAAAATCAAGGTGGCAGCAGGG + Intronic
949138018 3:594633-594655 CTGAAAGCAGGGTGTCAGCATGG - Intergenic
949359863 3:3220335-3220357 CAGAAGGCGAAGAGGAAGCAAGG + Intergenic
949578833 3:5366046-5366068 CTGAAATCAACGTGTCAGCAGGG - Intergenic
949740117 3:7222566-7222588 CTGAAATCAAGGTGTCAGCAGGG - Intronic
949783198 3:7712797-7712819 CTGAAATCAAGGTGGCAGCAGGG + Intronic
950576376 3:13834507-13834529 ATGAAGTCAAAGAGGCAGCAGGG - Intronic
950736122 3:15009786-15009808 CTGAAATCAAGGTGTCAGCAGGG + Intronic
950741405 3:15055037-15055059 CAGAAGGCAAAGGGGGAGCAAGG + Intronic
950838346 3:15942232-15942254 CTGAAATCAAGGTGTCAGCAGGG - Intergenic
950913347 3:16617397-16617419 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
951009122 3:17655902-17655924 ATGAAATCAAAGTGTCAGCAGGG - Intronic
951061859 3:18218139-18218161 CGGAAAGGAAAGAGGAAGAAAGG + Intronic
951203811 3:19904302-19904324 CTGAAATCAAAGTGTCAGTAAGG + Intronic
951574951 3:24103881-24103903 CTAAAATCAAAGTGTCAGCAGGG - Intergenic
951756672 3:26098400-26098422 CTAAAATCAAAGTGTCAGCAGGG + Intergenic
952070180 3:29625109-29625131 GTGAAGGCAAAAAGGAAGCAAGG - Intronic
952690884 3:36204261-36204283 CTTAAATCAACAAGGCAGCAGGG + Intergenic
952845571 3:37685329-37685351 CTAAAAGCTATGAAGCAGCAGGG - Intronic
953475591 3:43203213-43203235 TTTAATGCAAAGAGACAGCATGG - Intergenic
953487676 3:43317649-43317671 CTAACAGCAAGGAGGCAGCGTGG - Intronic
953624687 3:44561222-44561244 CAGAAGGCAAAGAGGAAGGAAGG + Intronic
953704288 3:45219701-45219723 CTAAAACCAAAGACCCAGCAAGG + Intergenic
955217304 3:56994994-56995016 CAGAAGGCAAAGAGGAGGCATGG - Intronic
955485910 3:59434161-59434183 CTGAAATCAAGGTGTCAGCAGGG + Intergenic
955586134 3:60480109-60480131 CAGAAGGCAAAGAGAAAGCAAGG + Intronic
955617384 3:60823635-60823657 CTGAAATCAAAGTGTCACCAGGG - Intronic
955694672 3:61623975-61623997 CTGAATGCAAGGAGGCAGTGAGG - Intronic
955825204 3:62938804-62938826 CTGAAATCACAGTGTCAGCAGGG + Intergenic
956257276 3:67296866-67296888 CCTAAGGCAAAGAGACAGCAAGG + Intergenic
956354780 3:68378875-68378897 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
956487039 3:69733850-69733872 CTGCAAGCTCAGAGGCACCAAGG - Intergenic
956811959 3:72872148-72872170 CTGAAATCAAAATGCCAGCAAGG + Intergenic
956969701 3:74508262-74508284 CAGAAGGCAAAGAAGCAGCAAGG - Intronic
957544864 3:81624121-81624143 CAGAAGGCAAAGAGGAAGCAAGG + Intronic
957679464 3:83414193-83414215 CTGAAGCTAAAAAGGCAGCATGG - Intergenic
957728294 3:84096993-84097015 CTGAAACCATAGAGGCAAGAAGG + Intergenic
957783301 3:84848329-84848351 CTGAAGGCAAAGGGGAAGCAAGG + Intergenic
958557885 3:95703709-95703731 CAGAAAGCAAAGGAGAAGCAAGG + Intergenic
958672311 3:97220525-97220547 CAGAAGGCAAAGGGGAAGCAAGG + Intronic
958686976 3:97411136-97411158 CTGAAAGAAAATGGACAGCAAGG + Intronic
958916197 3:100053297-100053319 TTGAAATCAAAGTGTCAGCAGGG + Intronic
959143531 3:102515669-102515691 CAGAAAGCAAAGGGGAAGCAAGG - Intergenic
959435465 3:106309925-106309947 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
959532328 3:107447731-107447753 CTGAAATCAAGGTGTCAGCAGGG - Intergenic
959678161 3:109060826-109060848 CAGAAGGCAAAAAGGAAGCAAGG + Intronic
959786763 3:110308570-110308592 CTGAGAGCAAGGAATCAGCAGGG + Intergenic
960089818 3:113627872-113627894 CTGCAAGAAAGGAGGCAGAAGGG + Exonic
960355899 3:116652920-116652942 CAGAAAGCAAAGGGGAAGAAAGG + Intronic
960382558 3:116982100-116982122 CTGAAAGCAGATAAACAGCAAGG - Intronic
960453936 3:117846368-117846390 GTGAAAGGAAAGAAGTAGCATGG - Intergenic
960481067 3:118190619-118190641 CAGAAAGCAAAAAGGAAGAAAGG - Intergenic
960580766 3:119276714-119276736 CTGAGATCAAAGTGCCAGCAGGG + Intergenic
960766247 3:121133800-121133822 CGCAAGGCAAAGAGGAAGCAAGG + Intronic
960954564 3:123022840-123022862 CTGAAAGGAAAGGGACAGAAGGG - Intronic
960958687 3:123053589-123053611 CTGAAATCAAGGTGTCAGCAGGG - Intergenic
961345894 3:126263229-126263251 CTGAAAGCAAGGGGCCAGGAGGG - Intergenic
961934310 3:130566998-130567020 CAAAAAGCAAAGAAGCAGCGAGG + Exonic
961958974 3:130834088-130834110 CTGAAATCAAGGTGTCAGCAGGG + Intergenic
962160195 3:132990760-132990782 CTCCAAGCAAGGAGACAGCAGGG - Intergenic
962803004 3:138906178-138906200 CTGAAATCAAAATGTCAGCAGGG + Intergenic
962826427 3:139104130-139104152 CTGAAAGCTAAGGGACTGCATGG + Intronic
962888271 3:139648245-139648267 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
962908140 3:139823913-139823935 CTGAAATCAAAGTGTCAGCAGGG + Intergenic
963009475 3:140755762-140755784 TTGAAATCAAAGTGTCAGCAGGG + Intergenic
963255529 3:143140824-143140846 CTGAAGGCAAAGGTGAAGCAAGG - Intergenic
963318525 3:143786792-143786814 ATGAATGCACAGAGGAAGCATGG + Intronic
963522939 3:146378907-146378929 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
963584369 3:147165568-147165590 CTGAAATCAAAGTGTCAGCAAGG + Intergenic
964002390 3:151790933-151790955 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
964136367 3:153349237-153349259 CTGAGGGTAAAGAGGCAGAAAGG - Intergenic
964147447 3:153482640-153482662 CTGCAAGAAAAGAGGAATCAGGG + Intergenic
964275638 3:155005756-155005778 CAGAAGGCAAAGTGGAAGCAAGG - Intergenic
964275885 3:155008631-155008653 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
964299231 3:155269802-155269824 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
964406195 3:156351889-156351911 CTCAAAGCCAAGCGGGAGCAAGG - Intronic
964417357 3:156461325-156461347 CTGGAAGCTAAGAGGAAGCAAGG - Intronic
964509146 3:157431203-157431225 CGGAAAGCAAAGGGGAAACAAGG - Intronic
964677663 3:159301720-159301742 CGGAAGGCAAAGGGGAAGCAAGG - Intronic
965369489 3:167843007-167843029 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
965802019 3:172504475-172504497 CTGAAATCAAGGTGTCAGCAAGG + Intergenic
965924079 3:173956603-173956625 CAGGAAGCAAACAGGCACCAGGG - Intronic
965950617 3:174303795-174303817 CAGAAGGCAAAGAGGAAGCAAGG - Intergenic
965957485 3:174388866-174388888 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
966088306 3:176098430-176098452 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
966421226 3:179736401-179736423 CTGAAAGCAGAGAGTAGGCATGG + Intronic
967301816 3:188021659-188021681 CTGAAACCAAGGCGTCAGCAGGG - Intergenic
967629781 3:191732024-191732046 CTGAAATCAAAGTGGCAGTAGGG + Intergenic
968036582 3:195553032-195553054 CTGAAATCAAGGTGTCAGCAGGG + Intergenic
968530375 4:1087860-1087882 CAGAAGGCAAAGGGGGAGCAAGG - Intronic
968530672 4:1089825-1089847 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
968673218 4:1863500-1863522 CTGAAAACAAGGTGCCAGCAGGG - Intergenic
969049564 4:4363101-4363123 CTGAAATCACAGTGGCAACAGGG - Intronic
969232928 4:5844327-5844349 CTGGAAGGAAAGAGGAAGTAAGG + Intronic
969336701 4:6514791-6514813 CTGAAAACATAGTGTCAGCAGGG + Intronic
969536055 4:7756690-7756712 CTGAGAGCAGAGTGGCGGCAGGG + Intergenic
969622878 4:8287504-8287526 CGGAAGGCAAAGGGGAAGCAGGG + Intronic
969636222 4:8370711-8370733 CTGCAACCACAGAGCCAGCATGG + Intronic
969650570 4:8465409-8465431 ATGAAGTCAAAGAAGCAGCAGGG - Exonic
969684586 4:8664064-8664086 CTGAAAGAAAAAGGGCAGCAGGG + Intergenic
969923029 4:10558825-10558847 ATGAAAGCAATGAGGCAGGCAGG + Intronic
969986351 4:11215146-11215168 CAGAAGGCGAAGAGGAAGCAAGG + Intergenic
969996821 4:11321686-11321708 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
970010880 4:11457850-11457872 CTGAGATCAAAGTGTCAGCATGG + Intergenic
970075721 4:12217255-12217277 CTGAAATCAAAGCGCCAGCAGGG + Intergenic
970087091 4:12361993-12362015 CAGAAGGCAAAGAGCAAGCAAGG + Intergenic
970188603 4:13488000-13488022 CTGAAATCAAAGTGTCAGCAGGG - Intergenic
970252311 4:14128804-14128826 TTGAAAGAACAGAGGCAGAAGGG + Intergenic
970268870 4:14321336-14321358 CTAAAATCAAGGAGTCAGCAGGG + Intergenic
970310843 4:14780754-14780776 CTGAAATCAAAGTGCCTGCAGGG - Intergenic
970566297 4:17335316-17335338 CTGAAAGCAAGAAGTCAGCAGGG - Intergenic
970577578 4:17443241-17443263 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
970712442 4:18879034-18879056 CAGAATGCAAAGGGGAAGCAAGG + Intergenic
970735312 4:19160137-19160159 CTTAAAGCAAACAGGCAGTTTGG + Intergenic
970881258 4:20934873-20934895 CTGAAATCAAGGTGTCAGCAGGG + Intronic
970938759 4:21606502-21606524 CTGAAATCAAGGTGTCAGCAGGG + Intronic
971734383 4:30427450-30427472 CAGAAGGCAAAGAGGGAACAAGG + Intergenic
971855069 4:32032414-32032436 CGGAAGGCAAAGGGGAAGCAAGG + Intergenic
972033764 4:34494655-34494677 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
973089368 4:46113285-46113307 GTGAAGGCAAAGGGGAAGCAAGG + Intronic
973832075 4:54771698-54771720 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
973899920 4:55458384-55458406 CTGACTGGAAAGAGGCAGCCAGG - Intronic
974125861 4:57694294-57694316 CTGAAAGCAAATAGGAAAAATGG - Intergenic
974302859 4:60092293-60092315 CAGAAAGCAAAGGAGAAGCAAGG + Intergenic
974382750 4:61162277-61162299 CTGAAATCAAAGAGTCAGCTGGG - Intergenic
974529698 4:63091898-63091920 CGGAAGGCAAAGGGGAAGCAAGG + Intergenic
974620560 4:64348212-64348234 CGGAAGGCAAAGACGAAGCAAGG + Intronic
974806246 4:66883739-66883761 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
975095944 4:70456502-70456524 CTGAAGGCAAAGGGGAAGCAAGG + Intronic
975174416 4:71270965-71270987 CTGGAAGAGAAGAGGCAGGATGG - Intronic
975286884 4:72631613-72631635 CCACAAGCAAAGAGGCAGCCAGG - Intergenic
975724230 4:77276443-77276465 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
976282830 4:83342081-83342103 CAGAAGGCAAAGAGGGAGCGAGG + Intergenic
976287415 4:83384145-83384167 CGGAAGGCAAAGGGGAAGCAAGG + Intergenic
976702875 4:87990156-87990178 CTGAAATCAAGGAGTCAGCAGGG - Intergenic
976836694 4:89382734-89382756 CTGAAATCAAGGTGTCAGCAGGG + Intergenic
977016238 4:91695887-91695909 CAGAAGGCAAAGAGGAAGCAGGG + Intergenic
977064066 4:92291210-92291232 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
977201492 4:94121786-94121808 CTGAAAGCTGAGAAGGAGCAGGG - Intergenic
977262207 4:94811318-94811340 CTGAAGGCAAAGAAAGAGCAGGG + Intronic
977393018 4:96437392-96437414 TAGAAGGCAAAGAGGAAGCAAGG + Intergenic
977646160 4:99415178-99415200 TGGAAGGCAAAGAGGAAGCAAGG - Intronic
977728237 4:100322192-100322214 CTGAAGGTAAAGGGGAAGCAAGG + Intergenic
978121947 4:105090625-105090647 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
978315405 4:107430343-107430365 CTCAGAGCAAAGATGGAGCAAGG + Intergenic
978316260 4:107440831-107440853 CTGAAATCAAGGTGTCAGCAGGG - Intergenic
978568972 4:110115824-110115846 CTAAAATCAAAGAGTCACCAGGG + Intronic
978667249 4:111199091-111199113 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
978983826 4:114983998-114984020 TGGAAAGCAAAGGGGAAGCAAGG - Intronic
979399691 4:120233367-120233389 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
979508448 4:121524819-121524841 CTGAAATCAAAGTGTCAACAAGG - Intergenic
979529035 4:121749259-121749281 CTGAGATCAAAGTGTCAGCAGGG + Intergenic
979647524 4:123088753-123088775 CTGAAGGAGAAGAGGAAGCAAGG - Intronic
979810037 4:125025869-125025891 ATGAAAGCAAAGAGGGGACATGG + Intergenic
980080745 4:128341336-128341358 CAGAAGGCAAAGAAGAAGCAAGG - Intergenic
980647608 4:135662736-135662758 CAGAAAACAAAGAAGAAGCAAGG - Intergenic
980729874 4:136811837-136811859 CAGAGAGGAACGAGGCAGCATGG + Intergenic
980730572 4:136818978-136819000 CAGGAAGCAAAGAGGCAGCATGG - Intergenic
980841015 4:138261526-138261548 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
980934704 4:139215303-139215325 CTGGAAGCAAAGGGCAAGCAAGG - Intergenic
980971545 4:139572068-139572090 CTGAAATCAAGGTGTCAGCAGGG + Intronic
981116491 4:140996886-140996908 CTGGAAGTAATGAGGCAGAAAGG + Intronic
981451651 4:144905108-144905130 CTGAAATCAAGGTGTCAGCAGGG - Intergenic
981588879 4:146334660-146334682 TTGCAACTAAAGAGGCAGCAGGG + Intronic
981682531 4:147416057-147416079 CTGAGATCAAAGTGTCAGCAGGG - Intergenic
981768056 4:148274578-148274600 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
981864355 4:149397544-149397566 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
982019438 4:151189039-151189061 CTGAAATCAAGGTGTCAGCAGGG - Intronic
982103446 4:151990910-151990932 TTGAATGCACAGAGACAGCAGGG - Intergenic
982108630 4:152033179-152033201 CTAAATGCAATGAGGAAGCATGG + Intergenic
982989251 4:162249960-162249982 CTGGACTCAAAGAGGCACCACGG - Intergenic
983035359 4:162858345-162858367 CTAAAATCAAGGTGGCAGCAGGG + Intergenic
983667917 4:170202948-170202970 CGGAGTGCAAAGAGGAAGCAAGG - Intergenic
983709182 4:170693426-170693448 CAGAAAGCAAAGGGGAAGCAAGG + Intergenic
983895639 4:173078680-173078702 CTGAAATCAAGGAATCAGCAGGG + Intergenic
984050737 4:174861907-174861929 CAGAAGGCAAAGGGGAAGCAAGG + Intronic
984349660 4:178574406-178574428 CAGAAAGCCAAGAAGCAGTAAGG + Intergenic
984926926 4:184815262-184815284 CTGTGAGCAAAGAGGCAGGGAGG + Intronic
986203005 5:5596292-5596314 CAGAAGGCAAAGAGGGAGAAAGG - Intergenic
986292957 5:6415070-6415092 CTGAAATCAAGGTGCCAGCAGGG + Intergenic
986405548 5:7421305-7421327 CTGAAATCACAGTGTCAGCAGGG + Intronic
986449898 5:7853307-7853329 CAGAAAGCAAAGGGGAAGCAAGG - Intronic
986517991 5:8583127-8583149 CAGAAAGCAAAAGGGAAGCAAGG - Intergenic
986614502 5:9602482-9602504 CTGAGAGCAAGGTGCCAGCAGGG - Intergenic
986646188 5:9918486-9918508 CTGAAAGCTAGGAGGCCACAGGG + Intergenic
986713499 5:10505026-10505048 CTGTTTGCAAGGAGGCAGCAGGG + Exonic
986869096 5:12027031-12027053 CAGAAAGCAAAGGGTAAGCAAGG + Intergenic
986897758 5:12391255-12391277 CTGAAAACAAAAAAGCAGTAAGG - Intergenic
986900326 5:12422733-12422755 CAGAAGGCAAAGCGGCAGCAAGG - Intergenic
986987043 5:13512033-13512055 CTGAGAGCAAGGTGTCAGCAAGG + Intergenic
986991965 5:13564714-13564736 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
987274085 5:16343835-16343857 CTTAAGGGAAAGAGGCAGAAAGG - Intergenic
987289424 5:16494584-16494606 CAGAAGGCAAAGAAGAAGCAAGG - Intronic
987326259 5:16814075-16814097 CAGAAATCAAAGGGTCAGCAGGG - Intronic
987650538 5:20734439-20734461 CGGAAGGCAAAGAGAAAGCAAGG + Intergenic
987812949 5:22862458-22862480 CTGACAGCAAATTGGCACCAAGG - Intergenic
987825141 5:23021253-23021275 CCAAAATCAAAGTGGCAGCAGGG - Intergenic
987843224 5:23247325-23247347 CAGAAGGCGAAGAGGAAGCAAGG - Intergenic
987893924 5:23919784-23919806 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
987959325 5:24784894-24784916 CTGAAATCAAAGTGTTAGCAGGG + Intergenic
988230169 5:28466425-28466447 TAGAAGGCAAAGAGGAAGCAAGG - Intergenic
988275871 5:29080511-29080533 CTCAAAGCAAAGAGGTATGATGG + Intergenic
988612163 5:32737031-32737053 CTGACAGCCAGGAGGCAGCTGGG - Intronic
988628414 5:32901726-32901748 TGGAAGGCAAAGAGGAAGCAAGG + Intergenic
988730631 5:33969506-33969528 CTCAAAGCAACGAGGCATCCTGG - Intronic
988745013 5:34127021-34127043 CGGAAGGCAAAGAGAAAGCAAGG - Intergenic
988780517 5:34516934-34516956 CTGAAGGAAATGAGGCAGCAAGG - Intergenic
988877030 5:35457865-35457887 CGGAAGGCAAAGGGGAAGCAAGG - Intergenic
989197167 5:38726904-38726926 CGGAAGGCAAAGGGGAAGCAAGG + Intergenic
990021266 5:51129594-51129616 CAGAAAGCGAAGGGGAAGCAAGG - Intergenic
990054063 5:51547871-51547893 CTGAAATCAAGGTGTCAGCAGGG + Intergenic
990266426 5:54081671-54081693 CAGAAGGCGAAGAGGAAGCAAGG - Intronic
990484452 5:56243868-56243890 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
990623636 5:57587522-57587544 CAGAAGGCAAAGAGGAAGCAAGG - Intergenic
991226856 5:64283700-64283722 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
991489663 5:67170296-67170318 CTGAAAGGAAAGAGACAGTTGGG - Intergenic
991505676 5:67321546-67321568 CAGAAAACAAAGGGGAAGCATGG - Intergenic
991559141 5:67930663-67930685 CAGAAGGCAAAGAGGAAGCAAGG + Intergenic
991605257 5:68394692-68394714 CTGAGAGAAAAGGGCCAGCATGG + Intergenic
992488475 5:77218057-77218079 CTTAAAGCAAATTTGCAGCAGGG - Intronic
992562545 5:77966839-77966861 CGGAAGGCAAAGGGGAAGCAAGG + Intergenic
992596805 5:78355600-78355622 CTAAAATCAAAGTGTCAGCAAGG + Intergenic
992681279 5:79155842-79155864 CTGAAAGCAAAGCAACAGCTGGG + Intronic
992748305 5:79839879-79839901 CTAAAAGCAAGGAGGCTGGAAGG + Intergenic
993039196 5:82793054-82793076 CAGAACGCAAAGAGGAAGCAAGG - Intergenic
993226788 5:85176665-85176687 CAGAAAGCAAAGGGGAAGCAAGG + Intergenic
993282298 5:85940270-85940292 CTGAAATCAAGGTGTCAGCAGGG + Intergenic
993450015 5:88061767-88061789 CTGAATCCAAAGATGCTGCAAGG + Intergenic
993453250 5:88098076-88098098 CAGAAAGCAAAGGGGAAGAAAGG - Intergenic
993486615 5:88495164-88495186 CTGAAATCAAGGTGTCAGCAGGG - Intergenic
993783494 5:92099066-92099088 CTGAAATCAAGGTGTCAGCAGGG + Intergenic
993933882 5:93976662-93976684 CAGAAAGCAAAGGGCAAGCAAGG - Intronic
994049261 5:95344082-95344104 CTGAAATCAAGGTGCCAGCAGGG + Intergenic
994466526 5:100140137-100140159 CTGAGAGCAAAGAGGAAAAAAGG + Intergenic
994682816 5:102910380-102910402 CTGAAAGCACAGAGGTTGGAGGG - Intronic
994921245 5:106046801-106046823 CTGTAAGCCAAGAAACAGCAAGG + Intergenic
994992182 5:107010948-107010970 TGGAAGGCAAAGAGGAAGCAAGG + Intergenic
995213542 5:109569068-109569090 CTGAAAGCAAAAAGTCTGGAAGG - Intergenic
995286608 5:110396116-110396138 CAGAAGGCAAAGGGGAAGCAAGG + Intronic
995311545 5:110717815-110717837 CAGAAAGCAAAGGGGAAGCAAGG - Intronic
995353907 5:111215130-111215152 TGGAAGGCAAAGAGGAAGCAAGG - Intergenic
995820060 5:116219625-116219647 CAGAAAACAAGGAGTCAGCAGGG - Intronic
995888444 5:116922139-116922161 CTGAAATCAAGGAGGCGGCAGGG - Intergenic
996435141 5:123425626-123425648 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
996605373 5:125314618-125314640 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
996616247 5:125444628-125444650 TGGAAGGCAAAGAGGAAGCAAGG - Intergenic
996683212 5:126250737-126250759 CTGAAATCAAGGTGTCAGCAGGG + Intergenic
996770534 5:127080970-127080992 CTGAAATCAAGGTGTCAGCAGGG + Intergenic
996833770 5:127768505-127768527 CTGAGATCAAAGTGTCAGCAGGG - Intergenic
997007553 5:129836474-129836496 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
997025738 5:130058791-130058813 CTGAAAGCAAGGTGTCAGCAGGG + Intronic
997296737 5:132773299-132773321 CTGGCAGCACAGAGGCAGGAAGG + Intronic
997438910 5:133895121-133895143 CTGAAAGCAAAGTGTCAGGAGGG + Intergenic
997721843 5:136084330-136084352 GTGAAAGGAGAGAGGGAGCAAGG + Intergenic
997855282 5:137367732-137367754 GTGAAAGAGAAGAGGCATCAGGG - Intronic
997885640 5:137627618-137627640 CCTAAAGCAAAGAGGCATAAAGG + Intronic
998155513 5:139784598-139784620 GTGAGAGCAGGGAGGCAGCAGGG - Intergenic
998435064 5:142101094-142101116 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
998577229 5:143329172-143329194 CAGAAGGCAAAGAGGAAGCAAGG + Intronic
998927721 5:147145035-147145057 CTGAAATCAAGGTGTCAGCAGGG + Intergenic
999065649 5:148683075-148683097 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
999418039 5:151416992-151417014 CAGAAGGCAAAGAGGAAGCAAGG - Intergenic
999969415 5:156844418-156844440 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1000099511 5:158001817-158001839 CTGAAATCAAAATGGTAGCAGGG - Intergenic
1000111715 5:158114380-158114402 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1000130363 5:158291273-158291295 CAGAGAAAAAAGAGGCAGCAAGG + Intergenic
1000382183 5:160639070-160639092 CACAAAGCACAGAGGCAGGAAGG - Intronic
1000684797 5:164235387-164235409 CAGAGACCAAACAGGCAGCACGG + Intergenic
1000686394 5:164254975-164254997 CGAAAAGCAAAGAGGAAGCAAGG - Intergenic
1000725850 5:164769970-164769992 CGGAAGGCAAAGGGGAAGCAAGG + Intergenic
1000991242 5:167914283-167914305 CTAAAATCAAGGAGTCAGCAAGG + Intronic
1001393813 5:171402819-171402841 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
1001433591 5:171682522-171682544 CTGAAAGCACAGCTGAAGCAGGG - Intergenic
1001876446 5:175205986-175206008 CCGACAGCAGAGAGCCAGCACGG + Intergenic
1002349005 5:178569665-178569687 CTGAAATCAATGAGTCAGCTGGG + Intronic
1002582215 5:180215749-180215771 CTGAAAGCAAGGTGTTAGCAGGG - Intergenic
1002621955 5:180494397-180494419 TTGAAAGCAAACAAGCATCATGG - Intronic
1002779883 6:357876-357898 CTGACAGCCAGGAGGCAGCCAGG + Intergenic
1002850340 6:989559-989581 CAGAAGGCAAGGAGGGAGCAAGG + Intergenic
1003214989 6:4100904-4100926 CAGAAAGCAAAGGGGAAGCCAGG - Intronic
1003402880 6:5805433-5805455 CAGAAGGCAAAGAGGAAGCAGGG - Intergenic
1003878324 6:10457900-10457922 CTGAAATCAAGGAGTCAGCAAGG + Intergenic
1004004873 6:11629209-11629231 CTGAAATCAAGGTGGCAGCAGGG - Intergenic
1004123594 6:12850637-12850659 CTGAAACCAAGGTGTCAGCAGGG + Intronic
1004519217 6:16346498-16346520 CTAAATGCAAAGAGGGAGCAAGG - Intronic
1004553517 6:16673107-16673129 CTGAAATCAAAGTGTCAGCCAGG - Intronic
1004675705 6:17839873-17839895 CTGAAATCAAGGGGTCAGCAGGG - Intronic
1004793104 6:19050954-19050976 CTCTAAGCCAGGAGGCAGCAGGG + Intergenic
1005005971 6:21288001-21288023 CTGAAATTAAAGTGTCAGCAGGG + Intergenic
1005171568 6:22991607-22991629 CGGAAAGCAAAAAAGAAGCAGGG - Intergenic
1005190493 6:23216312-23216334 CTGAGATCAAGGAGCCAGCATGG + Intergenic
1005204990 6:23392508-23392530 CTAAAAGCAAGGTGTCAGCAAGG - Intergenic
1005213380 6:23495974-23495996 CTGAAATCAAGGCGTCAGCAGGG - Intergenic
1005484895 6:26290334-26290356 CTGAATGCAAAGATGGAACAAGG - Intergenic
1005543137 6:26834765-26834787 CGGAAGGCAAAGAGAAAGCAAGG - Intergenic
1005813513 6:29532915-29532937 CTGAAAGGGAAGGGGCACCAGGG + Intergenic
1006236614 6:32638889-32638911 CTGAAAGGGAAGAGGGAGAAAGG - Intronic
1006246581 6:32742464-32742486 CTGAAAGGGAAGAGGGAGAAAGG - Intronic
1006787264 6:36677029-36677051 CTGAAAGCAGAGGGGCTTCAAGG + Intronic
1007009481 6:38401292-38401314 CAGAAGGCAAAGAGGAAGCAAGG - Intronic
1007029623 6:38616267-38616289 CTGAAATCAAAGTGTCAGCAGGG - Intronic
1007275239 6:40668539-40668561 CTGAATGCAAATAAGCAGCCAGG + Intergenic
1007751873 6:44076032-44076054 CTGAAAGCAATGGGGCAGGGCGG + Intergenic
1007827399 6:44611005-44611027 CTAAAATCAAAGTGACAGCAGGG + Intergenic
1008048848 6:46879512-46879534 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
1008275946 6:49544521-49544543 CTGAGAGCAAAGGGTCAGCATGG + Intergenic
1008479403 6:51969331-51969353 CTGAAATCAAAGTGTCAGCATGG - Intronic
1008810863 6:55497112-55497134 ATGAATGCATAAAGGCAGCATGG + Intronic
1008984784 6:57529380-57529402 AGTAGAGCAAAGAGGCAGCATGG - Intronic
1009013959 6:57876931-57876953 CGGAAGGCAAAGAGAAAGCAAGG - Intergenic
1009172834 6:60422313-60422335 AGTAGAGCAAAGAGGCAGCATGG - Intergenic
1009661599 6:66619654-66619676 CGGAATGCAAAGAGAAAGCAAGG + Intergenic
1009714993 6:67379840-67379862 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1009791321 6:68404719-68404741 CAGAAAGCAAAAAGGAAGCAAGG + Intergenic
1009822741 6:68825780-68825802 CGGAAAGCAAAGGGGTAGCAAGG - Intronic
1009849538 6:69178252-69178274 CTGAACACAAAGAAGAAGCAGGG - Intronic
1010003087 6:70967968-70967990 CGGAAGGCAAAGAGTAAGCAAGG + Intergenic
1010366490 6:75058129-75058151 CAGAAGGCAAGGAGGAAGCAAGG + Intergenic
1010592818 6:77730521-77730543 CTGAAAGAAAAGAGTTAGTAGGG - Intronic
1010688124 6:78876250-78876272 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
1010808729 6:80271490-80271512 CTGAAAGCAAACAAGCAACCAGG - Intronic
1010825899 6:80474518-80474540 CTGAAATCAAAGTATCAGCAGGG - Intergenic
1011121728 6:83961547-83961569 TAGAAAGCAAAGAAGAAGCAAGG - Exonic
1011128226 6:84029481-84029503 CCAAAAGCAAAGTGCCAGCAGGG + Intergenic
1011374708 6:86676480-86676502 CTGAAAGAAAAGTGGCAGGGTGG + Intergenic
1011385651 6:86795546-86795568 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1011445342 6:87433146-87433168 CTGAATAAAATGAGGCAGCAAGG - Intronic
1011498872 6:87966076-87966098 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1011552874 6:88546148-88546170 ATGAAAGCAGAGAGGCAGTTTGG + Intergenic
1011909922 6:92423067-92423089 TGGAAAGCAAAAAAGCAGCAGGG + Intergenic
1011955824 6:93024646-93024668 CAGAAAGCAAAGGGGAAGCAAGG + Intergenic
1011956048 6:93026612-93026634 CAGAAGGCAAAGAGGAAGCAAGG + Intergenic
1012025129 6:93979975-93979997 CTGAAAGCTAAAAGTCAGAAGGG + Intergenic
1012039215 6:94183922-94183944 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1012797828 6:103785718-103785740 CTGAAGGCAAAGGAGAAGCAAGG + Intergenic
1012798598 6:103795997-103796019 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1013133899 6:107261414-107261436 CAGAAGGCAAAGTGGGAGCAGGG - Intronic
1013773570 6:113653382-113653404 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1013812406 6:114059688-114059710 CAGAAGGCAAAGAAGAAGCAAGG - Intronic
1013904287 6:115197580-115197602 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1013904557 6:115199557-115199579 CTGAAGGCAAAGGGGAAGCAAGG + Intergenic
1013932869 6:115555830-115555852 CTGCAAGCAAAGATGCTCCAAGG - Intergenic
1014002943 6:116385183-116385205 ATGAAGGCAGAGAGGCAGTATGG + Intronic
1014213893 6:118734990-118735012 CTCAGAGCCAAGAGACAGCACGG + Intergenic
1014283406 6:119466623-119466645 CTGAAATCAAGGTGTCAGCAGGG - Intergenic
1014415119 6:121174414-121174436 CTGAATCAAAAGAGTCAGCACGG + Intronic
1014541192 6:122678300-122678322 CTGAATGAAAAGAGGCAGGAGGG + Intronic
1014750642 6:125252076-125252098 TGGAAAGCAAAGGGGCAGCAAGG - Intronic
1014759203 6:125337194-125337216 TTGAAAAAAAAGAGGAAGCAAGG + Intergenic
1014815561 6:125931934-125931956 CAGAAGGCAAAGGGGAAGCAAGG - Exonic
1014854741 6:126385770-126385792 CAGAAAGCGAAGGGGAAGCAAGG - Intergenic
1015003451 6:128248715-128248737 GTGAAAGCACAGAGACACCAAGG + Intronic
1015295857 6:131591418-131591440 GTGAAATCAAAGAGGCGGAATGG + Exonic
1015360160 6:132330702-132330724 CTGAAAGTAGAGAGCAAGCAAGG - Intronic
1015637061 6:135287528-135287550 CTGAAAGCTAGGAGACAGCAGGG + Intronic
1015798091 6:137033115-137033137 CTGATATCAAGGAGTCAGCAGGG + Intronic
1015798494 6:137036683-137036705 CTGAAATCAAGGTGTCAGCAGGG - Intronic
1016053452 6:139554121-139554143 CTGAAATCAAAGTGTCGGCAGGG - Intergenic
1016207536 6:141487717-141487739 CCAAAAGCAAGGAGCCAGCAGGG - Intergenic
1016293212 6:142546201-142546223 ATGAAAGCAAAGTGGAAGCAGGG + Intergenic
1016632417 6:146248515-146248537 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
1016632698 6:146250498-146250520 TGGAAGGCAAAGAGGAAGCAAGG - Intronic
1016743840 6:147557409-147557431 CTGAAATCAACGTGTCAGCAAGG + Intronic
1016810502 6:148256697-148256719 TTGACTGCAAAGAGGCAGAAGGG + Intergenic
1016908408 6:149173626-149173648 CTGAAATCAAGGTGTCAGCAGGG - Intergenic
1016980758 6:149851910-149851932 CAGAAGGCAAAGGGGAAGCAAGG + Intronic
1017061350 6:150488027-150488049 CTGAAATCAAGGTGTCAGCAGGG + Intergenic
1018944922 6:168341063-168341085 CTACAAGCAAAGGGGCAGCATGG - Intergenic
1019279873 7:194143-194165 CTGAAAGCCCAGCGGCAGCCTGG - Intronic
1019981080 7:4622710-4622732 CAGAAGGCAAAGAGGAAGCAAGG - Intergenic
1020607898 7:10360812-10360834 CTGAAGGCAAAGGGGAAGCAAGG - Intergenic
1020913187 7:14159187-14159209 ATGAAAGAAGAGAGGCAGCGTGG - Intronic
1020958155 7:14769683-14769705 CTGAAATCAAGGTGTCAGCAGGG + Intronic
1021114271 7:16730764-16730786 CTGGAATCAATGTGGCAGCAGGG - Intergenic
1021338982 7:19439784-19439806 CAAAAGGCAAAGAGGAAGCAGGG - Intergenic
1021526838 7:21597532-21597554 CAGAAGGCAAAGGGGAAGCAAGG + Intronic
1021567280 7:22028169-22028191 CTGAGATCAAAGTGCCAGCAGGG - Intergenic
1021829844 7:24594426-24594448 TTGAAAGCAAAGAGGCTGAAAGG - Intronic
1022306314 7:29149653-29149675 CTGAAATTAAAGTGCCAGCAGGG + Intronic
1022352443 7:29578513-29578535 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1022454393 7:30545853-30545875 CTAGAAGCAAGGAGCCAGCAAGG - Intronic
1022718585 7:32921893-32921915 CTGAAAGTAAAGTTGCAGTAGGG - Intergenic
1022865037 7:34408986-34409008 CTGTATGCATTGAGGCAGCAGGG + Intergenic
1022976783 7:35566050-35566072 CTGAAATCAAGGTGTCAGCAGGG - Intergenic
1022976890 7:35566913-35566935 CTGAAATCAAGGTGTCAGCAGGG + Intergenic
1023125056 7:36947116-36947138 CCCAAAGCAGAGAGGGAGCAGGG - Intronic
1024011766 7:45272891-45272913 TGGAAGGCAAAGAGGAAGCAAGG - Intergenic
1024311433 7:47973109-47973131 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
1024835469 7:53513138-53513160 CTGAAATCAAAGTGCCAGCAGGG - Intergenic
1024841923 7:53596550-53596572 CTGAAAGCTAAGCTGCAGCGAGG - Intergenic
1025288347 7:57687040-57687062 CTGAAATCAGGGAGTCAGCATGG + Intergenic
1025887886 7:65615511-65615533 CTGAAAGCAAGGTGCCAGCGTGG + Intergenic
1026067227 7:67085449-67085471 CGGAAGGCAAAGGGGAAGCAAGG - Intronic
1026103444 7:67401746-67401768 CTGAGATCAAAGAGTCAGCAGGG - Intergenic
1026112542 7:67469835-67469857 CGGGGAGCAAAGATGCAGCATGG - Intergenic
1026210317 7:68298369-68298391 CTCAAGGAAAAGAGGCATCATGG + Intergenic
1026297652 7:69069002-69069024 CAGAAAGCAAAAGGGAAGCAAGG - Intergenic
1026534454 7:71228520-71228542 CTGAAATCAAGGTGTCAGCAGGG + Intronic
1026590162 7:71687441-71687463 CTGGAAGCCAAGAGGCTGCTGGG - Intronic
1026709702 7:72726879-72726901 CGGAAGGCAAAGGGGAAGCAAGG + Intronic
1027507825 7:79040249-79040271 CAGAAGGCAAAGGGGAAGCATGG - Intronic
1027659071 7:80967229-80967251 CAGAAGGCAAAGAGGAAGCAAGG + Intergenic
1027728708 7:81841570-81841592 TGGAAAGCAAAGAGAAAGCAAGG - Intergenic
1027919971 7:84380699-84380721 CTAAAATCAAGGAGTCAGCAGGG + Intronic
1028101901 7:86831049-86831071 CTGAAATCAAGGTGTCAGCAAGG - Intronic
1028104712 7:86863449-86863471 CTGAAAGGAAAGCATCAGCAGGG + Intronic
1028320820 7:89458306-89458328 ATGAAAGCTAACAGCCAGCAAGG + Intergenic
1028366706 7:90040623-90040645 CTGAAATCAATGTGTCAGCAAGG + Intergenic
1028632320 7:92948383-92948405 TTGAATGCAAAGAGTTAGCATGG + Intergenic
1028653543 7:93176060-93176082 CGGAAGGCAAAGGGGAAGCAAGG - Intergenic
1029296657 7:99545471-99545493 CTGATGGAAAAGAGGAAGCAAGG + Intergenic
1029610707 7:101625207-101625229 CTGACATCACAGAGGCAGGAAGG - Intronic
1029807510 7:103012072-103012094 ATGAAAGAAAAAAGGCAGCTAGG + Intronic
1029915049 7:104200028-104200050 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
1030123932 7:106137000-106137022 GAGAAACCAAAGAGACAGCAAGG - Intergenic
1030173337 7:106626816-106626838 CTGAAATCAAAGTGTCAGCAGGG - Intergenic
1030611365 7:111693142-111693164 TGGAAGGCAAAGAGGAAGCAAGG + Intergenic
1030703981 7:112672136-112672158 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1030729708 7:112972069-112972091 CAGAAGGCAAAGGGGGAGCAAGG - Intergenic
1030758725 7:113323591-113323613 CAAAAAGCAAAGAAGAAGCATGG - Intergenic
1030764294 7:113389871-113389893 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1030989390 7:116281799-116281821 CTGAAATTAAAGTGTCAGCAGGG + Intergenic
1031201968 7:118699830-118699852 CTAAAATCAAAGTGTCAGCAAGG - Intergenic
1031255084 7:119436577-119436599 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1031296144 7:120006818-120006840 ATGAAAGCCAAAAGACAGCAAGG - Intergenic
1031567831 7:123321733-123321755 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1031642020 7:124176197-124176219 CAGAAGGCAAAGAGGAAGCAAGG - Intergenic
1031785358 7:126024219-126024241 CGGAAGGCAAAGAGGAAGCAAGG - Intergenic
1031806946 7:126318110-126318132 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1031854502 7:126906227-126906249 CTGAGAGCAAGGTGCCAGCATGG - Intronic
1031903382 7:127434546-127434568 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1032213105 7:129933968-129933990 CTCAAAGCAAAAATGCTGCAAGG + Intronic
1032739676 7:134725947-134725969 CTGAAAGCAAAGTGTCATCAGGG - Intergenic
1032828208 7:135593419-135593441 CTGAAAGAAAATAGTCAGAAGGG + Intronic
1033097021 7:138441090-138441112 CTGGAGGCCAAGATGCAGCATGG + Intergenic
1033132101 7:138753390-138753412 CTGAAATCAAGGCGTCAGCAGGG - Intronic
1033283113 7:140019573-140019595 GTGACAGCAAAGAGTCACCAGGG - Intronic
1033414438 7:141149727-141149749 CTGCAAGCTAAGAGCCACCAAGG + Intronic
1033448046 7:141439056-141439078 CTGCAGACAAAGAGCCAGCATGG - Intronic
1033804138 7:144935747-144935769 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1033843318 7:145401976-145401998 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1033901754 7:146150992-146151014 CTGAAGGCGAAGAGGAAGCAAGG + Intronic
1033910841 7:146261112-146261134 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
1034000031 7:147401799-147401821 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
1034259285 7:149744709-149744731 CTGAAAGCAAGGTGCCAGCTGGG + Intergenic
1034686038 7:152972328-152972350 CTGAGAGCACAGAGGCAGGAAGG + Intergenic
1034686048 7:152972398-152972420 CTGAGAGCATAGAGGCAGGAAGG + Intergenic
1034689136 7:152999990-153000012 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1035120594 7:156563615-156563637 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1035211542 7:157332326-157332348 CAGCAAGCACAGAGGCTGCAGGG - Intergenic
1035285649 7:157804969-157804991 CTGAGAGCTCAGGGGCAGCAAGG - Intronic
1035563712 8:627804-627826 GTCATAGCAAAGAGCCAGCAAGG + Intronic
1035591862 8:822335-822357 CTGGAAGGAAACAGGCAGCCGGG + Intergenic
1035627685 8:1084567-1084589 CTGAAAGCACAGAAGCAGTGAGG - Intergenic
1035918269 8:3649506-3649528 TGGAAAGCAAAGGGGAAGCAAGG + Intronic
1035948456 8:3991809-3991831 CAAAAAGCAAAGAGGCAGTGTGG - Intronic
1036146281 8:6257818-6257840 CTGAAAGCAAAGGGAATGCATGG + Intergenic
1036429835 8:8679844-8679866 CTGAAATCAAGGTGTCAGCAGGG - Intergenic
1037019232 8:13947620-13947642 CTGAAATCAAGGAGTCAGCCAGG - Intergenic
1037096169 8:14990397-14990419 CTGAAAGTACAGATGCAGCTTGG - Intronic
1037288693 8:17328180-17328202 CTGATAGGAAAGAAGCAACAGGG - Intronic
1037491208 8:19398635-19398657 ATGAAAGCAAAGAGGCCCCATGG - Intergenic
1037672661 8:21028623-21028645 CAGAAAGGAAAGAGGGAGAAGGG + Intergenic
1037758136 8:21724619-21724641 CTGCAAGCAAAGGGTCTGCAGGG + Intronic
1037989364 8:23309559-23309581 CTTAGAGCCAAGAGGCTGCATGG - Intronic
1038360771 8:26873787-26873809 TTGAAAGCAAATAAGAAGCAAGG + Intergenic
1038401742 8:27289091-27289113 ATGTTAGCAAAGAGGCACCAGGG - Intronic
1038530189 8:28312203-28312225 CTGAAATCAAGGTGTCAGCAAGG - Intergenic
1038697849 8:29821826-29821848 ATGAAGGCAAAAAGGCAGAAGGG - Intergenic
1038713646 8:29972465-29972487 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1039000379 8:32973219-32973241 CAGAAAGCAAAGGTGAAGCAAGG - Intergenic
1039421575 8:37447761-37447783 CTGACTGCAAAGAGGCATGAAGG + Intergenic
1039449219 8:37658248-37658270 CTGAAATCAAGGTGTCAGCAGGG + Intergenic
1039753625 8:40499256-40499278 CTGAAAGAAAAGAGGAAGGGCGG + Intergenic
1039804941 8:40989753-40989775 CTGATGGCAAACATGCAGCATGG + Intergenic
1039811002 8:41048260-41048282 CTGAAAGCAAGGTGACAGCAGGG - Intergenic
1040798038 8:51308552-51308574 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1041522239 8:58769441-58769463 CTGACAGCAATGTGCCAGCATGG + Intergenic
1041780884 8:61577645-61577667 CAGAAGGCAAAGAGGAATCAAGG + Intronic
1042885105 8:73540415-73540437 CTGAAATCAAAGTGTCAGCAGGG - Intronic
1042945278 8:74147886-74147908 CTGGAAGCAATGAGGTAGGAAGG - Intergenic
1042988447 8:74610551-74610573 CTGAAAAAAAAGAGGCAACTTGG + Intronic
1043073432 8:75666048-75666070 CGGAAGGCAAAGGGGAAGCAAGG - Intergenic
1043198909 8:77338296-77338318 CAGAAGACAAAGAGGAAGCAAGG - Intergenic
1043209368 8:77491701-77491723 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1043845799 8:85162202-85162224 CAGAAAGCTAAGGGGAAGCAAGG + Intergenic
1044055817 8:87568811-87568833 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
1044056075 8:87570682-87570704 CAGAAAGCAAAGGGGATGCAAGG - Intronic
1044370067 8:91399706-91399728 TTGAAACCAAGGAGGCAGCATGG + Intergenic
1044410418 8:91876255-91876277 CTGAAATCAAGGTGTCAGCAGGG + Intergenic
1044438869 8:92199486-92199508 CTGAAATCAAGGTGTCAGCAGGG + Intergenic
1044474436 8:92609547-92609569 CTGAAATCAAGGCGTCAGCAGGG + Intergenic
1044571985 8:93730232-93730254 CTGCAAAAACAGAGGCAGCAAGG + Exonic
1045423371 8:102039136-102039158 CAGAAATCAAGGAGGTAGCAGGG - Intronic
1045543907 8:103111413-103111435 CTGAAATCAAGGTGTCAGCAGGG - Intergenic
1046061813 8:109149316-109149338 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1046189392 8:110772264-110772286 CAAAAAGCAACGAGGCAGTACGG - Intergenic
1046339133 8:112828512-112828534 CCGAAAGCAAAGGGGAAGCCAGG - Intronic
1046520985 8:115325651-115325673 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1046620623 8:116525893-116525915 CTGGAAGAATAGAGGCAGCTGGG + Intergenic
1046665571 8:116998860-116998882 CTGAAATCAAGGTGTCAGCAAGG - Intronic
1046997566 8:120541379-120541401 CAGAGAGCAAAGAGACAGGAGGG - Intronic
1047107951 8:121755574-121755596 CAGAAAGCAAAGGGGAAGCAAGG - Intergenic
1047276169 8:123407202-123407224 CTGAAATCAAAGCGTCAGCCAGG - Intronic
1047366452 8:124216106-124216128 CTGAAATCAAGGTGTCAGCAGGG + Intergenic
1047381241 8:124365810-124365832 CTAAAATCAAAGTGTCAGCAAGG - Intronic
1047415150 8:124658618-124658640 CAGAATGCAAAGAGGGAGCTAGG + Intronic
1047433622 8:124815824-124815846 CTGAATGCTGAGAGGCACCAGGG + Intergenic
1047691584 8:127360337-127360359 CAGAAGGCAAAGGGGAAGCAGGG + Intergenic
1047735287 8:127759762-127759784 AAGAAAGAAAAGAGGCAGCAAGG - Intergenic
1048367755 8:133753291-133753313 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1048644639 8:136406314-136406336 CTGGAAGCAGGGAGGCAGAAAGG + Intergenic
1048903435 8:139062722-139062744 AAGAAAGCAAAGAGACACCAGGG + Intergenic
1048946135 8:139449265-139449287 CTGAGATCAAAGGGTCAGCAGGG + Intergenic
1049164932 8:141119714-141119736 CTGACAGTAAATAGGCAGAAAGG - Intronic
1049343589 8:142126842-142126864 CTGACAGCAAGGTGCCAGCAGGG + Intergenic
1049478576 8:142808206-142808228 GTGAAAGCAAAGAAGGGGCAGGG + Intergenic
1049609645 8:143548510-143548532 CTGAGAGCAAAGTGCCAGCTTGG - Intergenic
1050092925 9:2033679-2033701 CTGAAATCAAAGCATCAGCAGGG + Intronic
1050119910 9:2297661-2297683 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1050175061 9:2861264-2861286 CTGGAAAGAAATAGGCAGCATGG + Intergenic
1050333147 9:4565467-4565489 CAGAAGGCAAAGGGGAAGCAAGG + Intronic
1050430569 9:5557668-5557690 ATGAAAGCAATGATGCAGAAGGG - Exonic
1050889479 9:10806188-10806210 CTGAGTGAAAAGAGGCAGGAGGG - Intergenic
1051151829 9:14088330-14088352 TTGAGAGGAGAGAGGCAGCAGGG + Intronic
1051255309 9:15207068-15207090 CAGGAGGCAAAGAGGAAGCAAGG - Intronic
1051430091 9:16972811-16972833 TGGAAGGCAAAGAGGAAGCAAGG - Intergenic
1051586199 9:18729462-18729484 GTGAAAGCATTCAGGCAGCAAGG + Intronic
1051763717 9:20498978-20499000 CTGAAATCAAAGTGTCAGTAGGG + Intronic
1051767299 9:20539481-20539503 CTGAAGGCAAAGGGGAAGCAAGG + Intronic
1052101270 9:24448704-24448726 CTAGAAGCAAAGAGGCATGATGG + Intergenic
1052231600 9:26161033-26161055 ATGAAGGCAGAGAGGTAGCAGGG + Intergenic
1052280579 9:26728929-26728951 CTGAAATCAAAGTGTCAGCAAGG + Intergenic
1052472939 9:28923130-28923152 CTGAAAGCAGGGTGCCAGCAGGG - Intergenic
1052494309 9:29208319-29208341 TTGATAACAAAGAGGCGGCAAGG - Intergenic
1052528803 9:29655897-29655919 CTGAATGCAAAGATGGAACAAGG - Intergenic
1052561061 9:30084589-30084611 CTGCAATCAAAGTGTCAGCATGG + Intergenic
1052788517 9:32852383-32852405 CTGAAAGCATTGTGGCAGAAAGG - Intergenic
1053310770 9:37017927-37017949 CTGTAAGCCAAGGGGCTGCACGG - Intronic
1053455594 9:38231027-38231049 CTTAAAGCAAGAAGGGAGCAGGG - Intergenic
1053652323 9:40181717-40181739 TGGAAAGCAAAGCGGAAGCAAGG + Intergenic
1053902718 9:42811030-42811052 TGGAAAGCAAAGGGGAAGCAAGG + Intergenic
1054532259 9:66194498-66194520 TGGAAAGCAAAGCGGAAGCAAGG - Intergenic
1054753765 9:68935850-68935872 AGGAAAGAAAAGAGGCAGAAAGG + Intronic
1054823591 9:69548336-69548358 CTAAAAGCAAAGCGTCGGCAGGG - Intronic
1055011339 9:71569342-71569364 CTGAAGTCAAAGTGTCAGCAGGG - Intergenic
1055432767 9:76260698-76260720 CTAAAAGCAGAGTGGCAGCAGGG - Intronic
1055477820 9:76680793-76680815 CTGAAAGCAAAGGGAAAGCAAGG + Intronic
1055630221 9:78216103-78216125 CTGAAATCAAGGTGTCAGCAGGG - Intergenic
1055868800 9:80849149-80849171 CTAAAATCAAAGTGTCAGCAGGG + Intergenic
1056062184 9:82895018-82895040 CTAAAAGCAGAGAGGCTGCAAGG - Intergenic
1056097482 9:83270300-83270322 CTGAAACCAAAGAAGAAGAATGG + Intronic
1056435840 9:86575512-86575534 CAGAAAGCAAAGAAGAAGCAAGG + Intergenic
1056490904 9:87105984-87106006 ATGAAAGAAAAGAGGGAGGAAGG + Intergenic
1056590593 9:87963439-87963461 CTCAAAGCAAGGAGGCTTCAAGG - Intergenic
1056595570 9:88005249-88005271 CTGAAAGAAAAGAGAGAGCCGGG - Intergenic
1056684527 9:88748639-88748661 CTGAAGGCAAAGAGGGAGGCTGG + Intergenic
1056783150 9:89566495-89566517 CTGAAATCAAGATGGCAGCAGGG - Intergenic
1056877063 9:90343646-90343668 CTAAGAACAAAGAGGCAGAAAGG - Intergenic
1056914975 9:90738522-90738544 CTGAAAGCAAAAGGGAAGAAAGG - Intergenic
1057233450 9:93339534-93339556 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
1057296361 9:93845461-93845483 CTAAAAACAAATAGACAGCATGG - Intergenic
1057415451 9:94858451-94858473 CTAAAATCAAGGTGGCAGCAGGG + Intronic
1057468202 9:95335376-95335398 CTGAAATCAAAGTGTCAGCTGGG + Intergenic
1057515424 9:95716422-95716444 AGCAAAGCAAAGAGGCATCATGG - Intergenic
1057528922 9:95826973-95826995 CTGGAAGGCAAGAGGGAGCAGGG - Intergenic
1057878014 9:98772404-98772426 CTGAAATCAAGGTGTCAGCAGGG - Intronic
1057880749 9:98791124-98791146 CTGAAATGTAGGAGGCAGCATGG - Intronic
1057978660 9:99635191-99635213 CCCAAAGCAAAGATGAAGCAAGG - Intergenic
1057994833 9:99811730-99811752 AGGAAAGCAGGGAGGCAGCAGGG + Intergenic
1058165196 9:101611174-101611196 CTGAAATCAAGGTGTCAGCAGGG + Intronic
1058187101 9:101867987-101868009 CTGATAGTTAAAAGGCAGCATGG + Intergenic
1058288699 9:103210968-103210990 CTAAAGGCAAAGGGGAAGCAAGG + Intergenic
1058397716 9:104574169-104574191 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1058935209 9:109763652-109763674 CTGAAATCAAGGTGTCAGCAGGG + Intronic
1059101337 9:111474865-111474887 CTCAAATCATAAAGGCAGCATGG + Intronic
1059410344 9:114127923-114127945 CTGAAATCAAGGAGCCAGCAGGG + Intergenic
1059422961 9:114204403-114204425 CTGAAAGCACACAGTCAGCTTGG + Intronic
1059481366 9:114593158-114593180 CAGAAAGCATAGAGGAGGCAGGG + Intronic
1059581592 9:115555489-115555511 CAGAAAGCGAAGGGGAAGCAAGG + Intergenic
1059592494 9:115677256-115677278 CTAAAAGCAAAGAGGGATCATGG - Intergenic
1059769120 9:117411502-117411524 CAGAAACAAAAGAGGCAGAATGG + Intronic
1059830593 9:118090926-118090948 CTGAAATCAAAGTGTCAGCAGGG - Intergenic
1059841506 9:118222632-118222654 CTGAGGGCATAGTGGCAGCATGG + Intergenic
1059949855 9:119450977-119450999 CTAAAATCAAGGAGTCAGCAGGG + Intergenic
1060007975 9:120017180-120017202 CTGAAATCAAAATGTCAGCAGGG + Intergenic
1060248330 9:121965350-121965372 CGGAAGGCAAAGGGGAAGCAAGG + Intronic
1060458177 9:123820413-123820435 CTGAATGCAGAGAGGCCACATGG + Intronic
1060507061 9:124205693-124205715 CTGAAATCAGAGAGCCAGTAGGG - Intergenic
1060507275 9:124207582-124207604 CTGAAATCAAGGCGGCAGCAGGG + Intergenic
1060726530 9:126009641-126009663 CTGAAGGCGAAGAGAAAGCAAGG + Intergenic
1061429469 9:130522217-130522239 CAGAAGGCAAAGAGGAAGAAAGG + Intergenic
1061561254 9:131405325-131405347 TTGGAAGAAAACAGGCAGCAAGG - Intronic
1061954196 9:133953173-133953195 CTGAAACCAAGGTGTCAGCAGGG - Intronic
1062345695 9:136113943-136113965 CTGAAAGGAAAGAGGCCTCAGGG - Intergenic
1203612196 Un_KI270749v1:19968-19990 CTGAAATCAGGGAGTCAGCATGG - Intergenic
1185848614 X:3464455-3464477 CGGAAGGCAAAGGGGAAGCAGGG + Intergenic
1185938637 X:4288252-4288274 CTGAAATCAAAGTGCTAGCATGG + Intergenic
1186140152 X:6563363-6563385 CGGAAGGCAAAGGGGAAGCAAGG + Intergenic
1186473528 X:9839250-9839272 TTCATAGCAACGAGGCAGCAGGG + Intronic
1186711537 X:12202964-12202986 CTGAAACCAAGGTGTCAGCAGGG - Intronic
1186950429 X:14618670-14618692 CTGAAATCAAAGTGTCAGCTGGG + Intronic
1187082267 X:16003249-16003271 TGGAAGGCAAAGAGGAAGCAAGG - Intergenic
1187091502 X:16101740-16101762 CTGAAATCAAGGTGTCAGCAGGG + Intergenic
1187288879 X:17932805-17932827 CTGAAATCAAAGTGACAGCAGGG + Intergenic
1187323995 X:18269409-18269431 TGGAAGGCAAAGAGGAAGCAAGG - Intronic
1187437434 X:19285514-19285536 CAGAAGGCGAAGAGGAAGCAAGG - Intergenic
1187574636 X:20541464-20541486 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1187597465 X:20788912-20788934 CTGAATTCAAAGTGTCAGCAGGG - Intergenic
1187728149 X:22225022-22225044 CTAAAATCAAAGTGTCAGCAGGG + Intronic
1188018897 X:25135413-25135435 TGGAAGGCAAAGAGGAAGCAAGG - Intergenic
1188103678 X:26122634-26122656 CAGAAAGTGAAGAGGAAGCAAGG + Intergenic
1188172323 X:26942895-26942917 CTGAGATCAGAGAGACAGCAGGG + Intergenic
1188343072 X:29029028-29029050 TGGAAGGCAAAGGGGCAGCAAGG + Intronic
1188405035 X:29797415-29797437 CTGAATGTAAAGAGTCACCAAGG + Intronic
1188510218 X:30927848-30927870 CTGAAATCAAAGTGTCAGCAGGG + Intronic
1189017220 X:37296809-37296831 CAGAAGGCAAAGAGGGAGCAAGG + Intergenic
1189136726 X:38558356-38558378 CTGACATCAAAGTGTCAGCAGGG + Intronic
1189620041 X:42826136-42826158 CTGAAATCAAGGTGGCTGCAGGG + Intergenic
1189903485 X:45733647-45733669 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1190122837 X:47676711-47676733 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1190167698 X:48086741-48086763 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1190253686 X:48746805-48746827 CTAAAAGCAAGGTGTCAGCAGGG + Intergenic
1190404423 X:50072496-50072518 ATAAAAGCAAAGAGTCAACATGG + Exonic
1190772681 X:53528087-53528109 CAGAAAGCAAAGGAGAAGCAAGG - Intergenic
1192090972 X:68155471-68155493 CGGAAGGCAAAGGGGAAGCAAGG - Intronic
1192306448 X:69965240-69965262 CTTAGAGTAAAGAGGGAGCATGG + Intronic
1192572296 X:72216354-72216376 CTGAAATCAAGGTGTCAGCAGGG - Intronic
1193050791 X:77097097-77097119 CAGAAGGCAAAGAAGAAGCAAGG - Intergenic
1193875677 X:86859852-86859874 CTGAAATCAAAGTGTCATCAGGG + Intergenic
1194092608 X:89597821-89597843 CAGAAGGCAAAGGGGCAGCAAGG + Intergenic
1194134883 X:90129481-90129503 TGGAAAGCAAAGGGGAAGCAAGG - Intergenic
1194779706 X:98009972-98009994 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1194786486 X:98090876-98090898 GTGAAAGCAAAGATGGAGAAGGG + Intergenic
1195127805 X:101825342-101825364 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1196306435 X:114108433-114108455 CGGAAGGCAAAGGGGAAGCAAGG - Intergenic
1196637292 X:118017400-118017422 TTGAAAGCGAAAAGGCAACATGG + Intronic
1196722155 X:118864517-118864539 CTCAAAGCAAAGAAGCAGCAAGG + Intergenic
1196779804 X:119373565-119373587 CTGAAATCAAGGGGTCAGCAAGG - Intergenic
1197747058 X:129938707-129938729 CAGAAACCCAAGAGGTAGCATGG - Intergenic
1198236557 X:134740900-134740922 CTGAAAGCAAGATGTCAGCAGGG - Intronic
1198370010 X:135981231-135981253 TGGAAGGCAAAGAGGAAGCAAGG + Intergenic
1198497008 X:137203258-137203280 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1198693429 X:139308538-139308560 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1198865748 X:141121095-141121117 AGGAAGGCAAAGAGGAAGCAAGG - Intergenic
1199061538 X:143361369-143361391 CAGAAAGCAAAGGGGAAGCCAGG + Intergenic
1199132881 X:144214243-144214265 CTGAAACCAAAGTGTCAGCAGGG + Intergenic
1199306063 X:146268895-146268917 GTGAAGGCAAAGGGGAAGCAAGG - Intergenic
1199936175 X:152575770-152575792 CTGAGATCAAGGTGGCAGCAAGG + Intergenic
1200045177 X:153397197-153397219 CTGCCACCAAAGAGGCTGCAAGG - Intergenic
1200125401 X:153811435-153811457 CTGGAAGGAAACAGGCCGCATGG - Intronic
1200243402 X:154509339-154509361 CTGAAATCAAAGTGTCAGCAGGG - Intronic
1200322621 X:155205720-155205742 ATGGAAGCAGAGAGGAAGCATGG - Intronic
1200329568 X:155282184-155282206 CTGAAAGAAAAGTGGGAGCAAGG - Intronic
1200445255 Y:3253924-3253946 CAGAAGGCAAAGGGGCAGCAAGG + Intergenic
1200480669 Y:3699572-3699594 TGGAAAGCAAAGGGGAAGCAAGG - Intergenic
1200797228 Y:7351960-7351982 CTGAAGGCAAAGGAGAAGCAAGG - Intergenic
1200815031 Y:7522376-7522398 CGGAAGGCAAAGGGGAAGCAGGG - Intergenic
1200912772 Y:8545800-8545822 CTGAAAGCAAAGGAACATCAAGG - Intergenic
1201412268 Y:13711905-13711927 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1202323158 Y:23657720-23657742 CTCAAAGAAAAGAAGAAGCAAGG + Intergenic
1202382852 Y:24292490-24292512 CGGAAGACAAAGAGGAAGCAAGG - Intergenic
1202487932 Y:25377635-25377657 CGGAAGACAAAGAGGAAGCAAGG + Intergenic
1202547614 Y:26012334-26012356 CTCAAAGAAAAGAAGAAGCAAGG - Intergenic