ID: 945805660

View in Genome Browser
Species Human (GRCh38)
Location 2:214487081-214487103
Sequence TTCCATGTGAAGACAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 571
Summary {0: 1, 1: 1, 2: 11, 3: 75, 4: 483}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945805658_945805660 23 Left 945805658 2:214487035-214487057 CCTATAAGAAGAGATTAGGACAG 0: 2
1: 1
2: 6
3: 31
4: 303
Right 945805660 2:214487081-214487103 TTCCATGTGAAGACAGAGGAAGG 0: 1
1: 1
2: 11
3: 75
4: 483
945805657_945805660 24 Left 945805657 2:214487034-214487056 CCCTATAAGAAGAGATTAGGACA 0: 31
1: 104
2: 118
3: 249
4: 599
Right 945805660 2:214487081-214487103 TTCCATGTGAAGACAGAGGAAGG 0: 1
1: 1
2: 11
3: 75
4: 483

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945805660 Original CRISPR TTCCATGTGAAGACAGAGGA AGG Intronic
900564647 1:3326249-3326271 GCTCATGTGAAGACAGAGGCGGG - Intronic
900698291 1:4026764-4026786 TTCCACGTGGATACTGAGGACGG + Intergenic
900779235 1:4606712-4606734 GACCATGTGAGGACAGAGAAAGG - Intergenic
900876642 1:5347681-5347703 TTCCATGAGAGGTCACAGGAAGG + Intergenic
902554424 1:17238661-17238683 TTCCAAGAGAAGAAAGAAGAGGG + Exonic
905629729 1:39511883-39511905 CTCTATGTGGAGACTGAGGACGG + Exonic
905668030 1:39774307-39774329 CTCTATGTGGAGACTGAGGACGG - Exonic
905861712 1:41356408-41356430 TGCCATGTGAAGACACAGGCGGG + Intergenic
905960560 1:42038981-42039003 TGCCTTGAGAACACAGAGGAAGG - Intergenic
907013026 1:50981993-50982015 TTCAATGTGAAGCCGGAGTAGGG + Intergenic
907268007 1:53274545-53274567 CCCCATGTGAAGCCATAGGACGG + Intronic
908020351 1:59892115-59892137 TGCCATGTGATGACACAGTATGG + Intergenic
908113078 1:60916238-60916260 TGCCATGTGAAGACACAGCAAGG - Intronic
908161202 1:61410161-61410183 TGCCATGTGAAGACATGGGAGGG + Intronic
908804293 1:67914235-67914257 TACCATGTGAAAACAAAGCAAGG + Intergenic
908870380 1:68604230-68604252 TGTCAGGTGAAGATAGAGGAAGG + Intergenic
909585767 1:77286040-77286062 TACCATGGGAACACAGAAGAAGG + Intronic
909838760 1:80290899-80290921 TTTCATGTGCACACAGTGGAAGG + Intergenic
910289532 1:85587139-85587161 TGCCATGTGGAGAAAGAGAAAGG + Intergenic
910643473 1:89489285-89489307 TTCCATCTGAAGACAGGAGAGGG + Intergenic
911237575 1:95427852-95427874 TTTCATCTGAAGACTGAGTATGG + Intergenic
911401157 1:97377452-97377474 TTTCATATCAAGGCAGAGGAAGG - Intronic
911482444 1:98460720-98460742 TTTCATGGGACCACAGAGGAGGG + Intergenic
912330273 1:108813983-108814005 TTCCACGAGAAGGCAGAGCATGG + Intergenic
912764020 1:112392704-112392726 GGCCATGTGAAGACGGAGGCAGG + Intergenic
913265125 1:117036002-117036024 GTCCATGTGAGCAGAGAGGAGGG - Intronic
913715175 1:121526529-121526551 CATCATGTGAAGACAGAGGCAGG + Intergenic
914505622 1:148286754-148286776 TTCCAGGAGTCGACAGAGGAAGG - Intergenic
914890853 1:151621880-151621902 TTCCAAGTAAAGACAGAGGCAGG - Intronic
915325706 1:155080393-155080415 TTCCATGGGAAGCGAGAGGGGGG - Intronic
915630861 1:157153482-157153504 TTCAATTTGAAGGCTGAGGAAGG - Intergenic
916025747 1:160831952-160831974 ATCCATGTGAAGACACTGGCAGG + Intronic
916360521 1:163962512-163962534 TTCCACTTGAAGAGAGAAGAGGG + Intergenic
917957978 1:180119695-180119717 TACTTTGGGAAGACAGAGGAAGG + Intergenic
918150601 1:181795227-181795249 TTTCCGGTGAACACAGAGGAGGG - Intronic
919488627 1:198175955-198175977 TAGCATGAGAAGACAGAGCAAGG - Intronic
920075511 1:203333590-203333612 GGCCATGTGAAGACACAGGCAGG + Intergenic
920107952 1:203567729-203567751 AGCCATGTGAAGACAGAGGCTGG + Intergenic
920447858 1:206033484-206033506 CTGACTGTGAAGACAGAGGAAGG - Intergenic
920879355 1:209865660-209865682 GACCATGTGAAGACACAGGCAGG - Intergenic
920948949 1:210554939-210554961 TTCCTTCAGAAGACAGAGGTAGG - Intronic
921166311 1:212510175-212510197 TTCCATGCAAAAAGAGAGGAGGG + Intergenic
921766714 1:218981289-218981311 TTCAATGGGGAGACAGAGAAAGG - Intergenic
921788358 1:219260770-219260792 TTCCATGGAAATACAGAGAAAGG - Intergenic
922056540 1:222047577-222047599 TTTCATATGAGGACAAAGGAAGG + Intergenic
922983248 1:229846700-229846722 CTCCACTTGAAGACAGAGGAAGG + Intergenic
923426030 1:233870621-233870643 TTCCATGAAAAAAAAGAGGAGGG + Intergenic
923560535 1:235036978-235037000 TGCCATGTGAGGACAGAGTGAGG + Intergenic
923809852 1:237301753-237301775 TACCATGCGAATAAAGAGGAGGG - Intronic
923958793 1:239053706-239053728 TTCCAGGTGATGACAGGTGATGG - Intergenic
924837465 1:247666862-247666884 ACCCTTGTGAAGAGAGAGGATGG + Intergenic
1063259729 10:4373360-4373382 ATCCATGGGAAGATACAGGAGGG - Intergenic
1063865456 10:10360443-10360465 ATGCATGTGAAAAAAGAGGAAGG + Intergenic
1063875484 10:10473218-10473240 AGCCATGTGAAGACAGAGACAGG + Intergenic
1064930757 10:20623540-20623562 TTACAAATGAAGACAGAGAAAGG - Intergenic
1065827926 10:29588818-29588840 TTACATGTGAAAACAAAGGAGGG - Intronic
1065939755 10:30553657-30553679 TTACATGTGAAAAGATAGGAGGG - Intergenic
1067030837 10:42878144-42878166 TATCATGTGAAGAGACAGGAAGG - Intergenic
1067116866 10:43441885-43441907 TTATATGTAAAGACAGGGGAAGG - Intronic
1067340735 10:45401196-45401218 TTCCAAGGGAAGAAAGTGGAAGG + Intronic
1068545369 10:58338245-58338267 TTATATGTAAAGACAGAGCATGG + Intronic
1070085923 10:73237011-73237033 AGCCATGTAAAGACAGAGGCAGG - Intronic
1070520255 10:77246491-77246513 GGCTATGTGAAGACAGGGGAGGG + Intronic
1071315952 10:84398199-84398221 CTCGGTTTGAAGACAGAGGAAGG - Intronic
1071829867 10:89360943-89360965 TGCCATGTGAAGAGAGAGCATGG - Intronic
1072527356 10:96285171-96285193 GACCATGTGAAGACAGAGGCAGG - Intergenic
1073784365 10:106872456-106872478 GACCATGTGAAGTCAGTGGAGGG + Intronic
1073941423 10:108703197-108703219 TTCCATGTGAGGACACAGAATGG - Intergenic
1074365056 10:112851043-112851065 TTCCATGTGAAAGCAGAGTTCGG - Intergenic
1074414060 10:113251675-113251697 TGCCATGGGAACTCAGAGGAAGG + Intergenic
1075715672 10:124553840-124553862 CTCCTTCTGCAGACAGAGGAGGG - Intronic
1075832255 10:125421486-125421508 TACCATGTGATGAGACAGGAAGG - Intergenic
1076169982 10:128311223-128311245 TTTCATGTGAAAATACAGGAAGG + Intergenic
1076326171 10:129624611-129624633 ATCCAAGGGAAGGCAGAGGAGGG + Intronic
1076742235 10:132492173-132492195 TTCTAAGTGAACACACAGGAAGG + Intergenic
1077050679 11:565187-565209 ATGCATGGGAAGGCAGAGGATGG + Intergenic
1078105220 11:8354173-8354195 TTTCATGTGGAGAAAGAGCAAGG - Intergenic
1078134258 11:8639124-8639146 ATCCATGTGATGGCAGAGAAGGG - Intronic
1078537565 11:12187188-12187210 CTCCATGGGATTACAGAGGAGGG - Intronic
1078831256 11:14979549-14979571 TTGGGTTTGAAGACAGAGGAAGG - Intronic
1079120435 11:17680298-17680320 TTCAAGGGGAAGAAAGAGGAAGG - Intergenic
1079142441 11:17821055-17821077 GGCCACGTGAAGACAGAGGCAGG + Intronic
1079290467 11:19183744-19183766 TTTCCTGTGATGACACAGGATGG - Intronic
1079468724 11:20758000-20758022 TGCCATGTGAAGATAGAGCAAGG - Intronic
1079814631 11:25039814-25039836 TTCCCTGAGAAGAGAGAGGCAGG + Intronic
1080660109 11:34288931-34288953 CTCCATTTGAAGGCAGAGGTAGG - Intronic
1080698561 11:34624342-34624364 TGCCATCTGAAGACAGAGGCAGG + Intronic
1080797682 11:35580618-35580640 TACCATGTGAAGACACGGCATGG + Intergenic
1080843862 11:36008990-36009012 CTCCATGTGGAGACAAAGGAAGG - Intronic
1080949590 11:37015846-37015868 CTACCTGTGAAGACAGAGGAGGG - Intergenic
1081256111 11:40897642-40897664 TTGCATGGGATGACAGAAGAAGG + Intronic
1081446900 11:43139437-43139459 AGCCATGTGATGACAGAGGCGGG + Intergenic
1081565216 11:44256558-44256580 CTACATGTGTACACAGAGGAAGG + Intergenic
1083116353 11:60463313-60463335 TTTCATGTGAATTCAGAGAAAGG + Intronic
1083313018 11:61795345-61795367 TCCCATGGCAACACAGAGGAGGG - Exonic
1083469896 11:62877004-62877026 TAGCATGTGAAGACAAAGGCAGG - Intronic
1083639533 11:64138041-64138063 TCCCCTCTGAAGGCAGAGGATGG - Intronic
1083737085 11:64687553-64687575 TACCATAAGTAGACAGAGGAAGG - Intronic
1084081109 11:66825533-66825555 TGCCATGTGAGGACACAGGGAGG + Intronic
1084370523 11:68739500-68739522 TTCCATTTTTGGACAGAGGAAGG - Intronic
1084447698 11:69213273-69213295 GGCCATGTGGAGACAGAGGCAGG + Intergenic
1084792520 11:71483519-71483541 CTCTATGTGAGGACAGTGGAAGG + Intronic
1084873730 11:72115472-72115494 ATACATGAGAACACAGAGGAGGG + Intronic
1085560408 11:77467275-77467297 TGCCATGTGAACACAGAGGAAGG - Intronic
1085662505 11:78382163-78382185 TGCCATGAGAGCACAGAGGAGGG - Intronic
1086066790 11:82754089-82754111 TTTCCTGTGTAAACAGAGGATGG - Intergenic
1086153732 11:83642373-83642395 TTCTATCTGAAAACAGAGAAGGG - Intronic
1086696929 11:89858273-89858295 TTACAAGTGAAGGGAGAGGAGGG - Intergenic
1086709229 11:89986215-89986237 TTACAAGTGAAGGGAGAGGAGGG + Intergenic
1087675273 11:101154469-101154491 ATACATGTGAACCCAGAGGAAGG + Intergenic
1088716798 11:112555788-112555810 TTCCATGTGCTGACTGAGTATGG + Intergenic
1089076659 11:115744011-115744033 TTTCATGTGAGGACAGGGTATGG - Intergenic
1089576744 11:119449816-119449838 GACCATGTGAAGACAGCAGAAGG + Intergenic
1089699077 11:120233684-120233706 TCCCAGGTGAGGGCAGAGGAGGG - Intergenic
1089962986 11:122632211-122632233 TCCCATATGAATTCAGAGGAAGG + Intergenic
1090165768 11:124545330-124545352 CTCCATGAGAGGACAGGGGAGGG - Intergenic
1090220076 11:125012543-125012565 GTCCATGTGAGCACAGAAGAAGG + Intronic
1090376622 11:126294059-126294081 TTCCAGGGGAAGACAGAAGTGGG - Intronic
1091307250 11:134544138-134544160 TTCCCTGTGAAGAAACAGGAAGG + Intergenic
1093211121 12:16310210-16310232 TTGCATGAGAAGGCAGAGCATGG + Intergenic
1094367072 12:29695130-29695152 GGCAATGTGAAGACAGAGGCAGG - Intronic
1094416834 12:30225278-30225300 TGCCATGAGAAGTCAGAGAAAGG - Intergenic
1094634983 12:32217580-32217602 TGACTTGTGAAGACAGAGAAAGG + Intronic
1095409077 12:41902648-41902670 GGCCATGTGAAGACAGAGGCAGG - Intergenic
1096871028 12:54592236-54592258 ACCCTTGTGAAGACAGAGGGAGG + Intergenic
1098338883 12:69431551-69431573 GCCCATATGAAGACACAGGATGG + Intergenic
1098818936 12:75206811-75206833 TTGAATCTGAGGACAGAGGAAGG - Intronic
1098930968 12:76413272-76413294 TTACTTGTGAAGACAAAGGGTGG - Intronic
1099068718 12:78017996-78018018 TTCCATGTGAATATAAAGCAAGG + Intronic
1099096859 12:78384993-78385015 TTCCATATGGTGAGAGAGGAGGG + Intergenic
1099132952 12:78859335-78859357 TTCCCTTTGAAATCAGAGGAAGG - Intergenic
1099563005 12:84202861-84202883 GTCCATGTGAAGAAACAGGGAGG - Intergenic
1100343963 12:93708946-93708968 TACCATGTGAAGACACAACAAGG - Intronic
1102731255 12:115112679-115112701 GGCCATGTGAAGACAGAGGCAGG - Intergenic
1103049927 12:117770299-117770321 CGTCATGTGAAGACAGAGGCAGG + Intronic
1103257406 12:119553901-119553923 TTCCATATGAATGCACAGGAGGG + Intergenic
1104085776 12:125473009-125473031 TTCACTCTGAAGACAGATGACGG - Intronic
1104381679 12:128312996-128313018 TTCCATGAGGAGAGGGAGGATGG - Intronic
1104397109 12:128443827-128443849 CACTTTGTGAAGACAGAGGACGG - Intronic
1104711856 12:130992882-130992904 TTCCAGGTGAAGGCAGAGGGTGG + Intronic
1105475387 13:20724184-20724206 TTCCATTTGAAGATCGAGAAAGG + Intergenic
1105718859 13:23094192-23094214 TTATATCTGGAGACAGAGGAGGG + Intergenic
1106305886 13:28508907-28508929 GACCATGTGAAGACACAGGGAGG + Intergenic
1107146496 13:37066299-37066321 GTGCAAGTGAAGACAGAGAAAGG + Intergenic
1108195407 13:47989665-47989687 TTACATGTGAATAGAGAGGGAGG - Intronic
1108775360 13:53759195-53759217 GTCCATGTGATTTCAGAGGAAGG + Intergenic
1109950525 13:69497314-69497336 TTCCATATTAAGAAAGATGATGG - Intergenic
1110537080 13:76663608-76663630 TGCCAAATGAACACAGAGGAGGG + Intergenic
1110907245 13:80907123-80907145 TTCCATGGCAAAAAAGAGGAAGG + Intergenic
1111574068 13:90127436-90127458 TTCCCTGTAAAAACAGAGGTGGG + Intergenic
1112182390 13:97096715-97096737 TTCCAGGTGAAGAGAGAGGAAGG + Intergenic
1113074926 13:106458840-106458862 TGCCAGGTGAAGACAGAGATGGG - Intergenic
1113698512 13:112365589-112365611 TGCCATGTGAGGACACAGCAAGG + Intergenic
1113739012 13:112698119-112698141 TGACATTTGAACACAGAGGACGG + Intronic
1114445558 14:22785368-22785390 TTCTGTGTGGAGACAGAGGAGGG - Intronic
1114520305 14:23329970-23329992 TTCCATGGGAAGAAAGAGACTGG + Intergenic
1115846583 14:37542386-37542408 TTGCAACTGAAGCCAGAGGAGGG - Intronic
1116607416 14:47018917-47018939 TGCCATGTGAACACAGAGGACGG - Intronic
1117339005 14:54777974-54777996 TTCTGCGTGAAAACAGAGGATGG - Intronic
1117773837 14:59162118-59162140 TTCTAAGTAAAGAAAGAGGAAGG + Intergenic
1118037149 14:61880060-61880082 TTTCATCTGCAGACAGAGGTGGG - Intergenic
1118836252 14:69480128-69480150 ATCCACGGGAAGACAGAGGAGGG + Intergenic
1121083695 14:91128769-91128791 TTCCAACAGAAGACACAGGAAGG + Intronic
1121259616 14:92556521-92556543 TTGCATGGGAAGATAGATGATGG + Intronic
1121284109 14:92721221-92721243 TTGTATGTGGAGACAGAGGCAGG + Intronic
1121567694 14:94923103-94923125 TGCCATGTGAATACAGGAGATGG - Intergenic
1121806430 14:96828935-96828957 TTCCATTAGAAGCCACAGGAGGG + Intronic
1121811373 14:96894121-96894143 CTCCTGGGGAAGACAGAGGATGG + Intronic
1121982347 14:98465920-98465942 TTCTTTGTGAAGAGAAAGGAAGG + Intergenic
1123126699 14:105952112-105952134 TTCCAGGTGGAGACAGAGGGAGG + Intergenic
1123407211 15:20028213-20028235 TTCCAGGTGGAGACAGAGGGAGG + Intergenic
1123516541 15:21034869-21034891 TTCCAGGTGGAGACAGAGGGAGG + Intergenic
1126681959 15:51210926-51210948 TTCCACGTGAAGACATTGCAAGG - Exonic
1126793023 15:52238104-52238126 GATCATGTGAAGACAGAGGGAGG + Intronic
1127672000 15:61204262-61204284 ATTCGTGTGAAGACAGACGAGGG - Intronic
1128240131 15:66096068-66096090 TCCCATGGGGAGCCAGAGGATGG - Intronic
1128932277 15:71716171-71716193 TGCCATGTGAAAACAAAGGCTGG - Intronic
1129979550 15:79855029-79855051 TTTAGTGTGAAGACAGAGCATGG - Intronic
1130911937 15:88276856-88276878 CACCATGGGAACACAGAGGAGGG + Intergenic
1131342955 15:91619869-91619891 TTTCCTGTGAAGAGAGAGGCTGG + Intergenic
1132422935 15:101689586-101689608 CATCACGTGAAGACAGAGGATGG + Intronic
1133030126 16:3006736-3006758 GGCCATGTGAAGACGGAGGCAGG - Intergenic
1133318477 16:4898545-4898567 GGCCATGTGAAGACGGAGGAAGG + Intronic
1133597452 16:7306443-7306465 TTCCATATGAAGATAGATGGAGG + Intronic
1133680200 16:8114080-8114102 TTCCCTGTGAAGAGAGAGGGTGG + Intergenic
1134304756 16:13022089-13022111 GGCCATGTGGAGACAGAGGCAGG - Intronic
1135084881 16:19467353-19467375 AACCATGTGAAGACACAGGCAGG - Intronic
1135665286 16:24330461-24330483 GTCCATCTGACGACAGAGGCTGG + Intronic
1135835164 16:25818860-25818882 TGATATCTGAAGACAGAGGATGG + Intronic
1135967671 16:27049326-27049348 TTCCATGTGAAGCGAGTCGAAGG - Intergenic
1136032431 16:27513540-27513562 TTAGATCTGAAGACAGAGGAAGG + Intronic
1136178237 16:28533305-28533327 TTCCGTGTGATCCCAGAGGAGGG + Intronic
1137312862 16:47283555-47283577 TGAAATTTGAAGACAGAGGATGG + Intronic
1137611896 16:49823847-49823869 TCCCATGGGAAGACAGAGGTAGG + Intronic
1137977627 16:53044484-53044506 TTGCATGTGAAGATAGGGGCTGG - Intergenic
1138916499 16:61471293-61471315 TTCCACTTGAAGAGAGGGGAGGG + Intergenic
1139024896 16:62804524-62804546 TGCCATGTGAAGACACAAGAAGG + Intergenic
1139220764 16:65179219-65179241 ATCCAAGTAAAGAAAGAGGAGGG + Intergenic
1139460212 16:67116044-67116066 TTAGATGTCAAGAAAGAGGAAGG - Intronic
1141384210 16:83604263-83604285 TGCCATGGGAAGTCAGAGAATGG - Intronic
1141926654 16:87174343-87174365 TTCCAGGTGGAGGCAGGGGATGG - Intronic
1142011092 16:87714506-87714528 TTCCTGCTGAAGCCAGAGGACGG - Exonic
1142131301 16:88432773-88432795 TTCCCTGTGAACAGAGAGGAGGG + Exonic
1142382768 16:89743040-89743062 TTCCATCAGAGGACAGAGAAGGG + Intronic
1142933329 17:3307137-3307159 TGCTATGGGAAGACAGAGGAAGG + Intergenic
1143138482 17:4726061-4726083 TTCCATTTAAGGAAAGAGGAGGG + Intergenic
1143675477 17:8429445-8429467 CTCCATGTGAGCTCAGAGGAAGG + Intronic
1143698521 17:8639118-8639140 GGCCATGAGAAGAAAGAGGAAGG - Intergenic
1143855000 17:9842012-9842034 TTCCTGATGAAAACAGAGGAAGG + Intronic
1143980488 17:10865258-10865280 TTGAATGTGAAGGAAGAGGATGG - Intergenic
1144241676 17:13318900-13318922 TTCCCTGGGAAGGCAGAGAATGG + Intergenic
1144581116 17:16460125-16460147 TGCCATGTGAGGACACAGGAAGG + Intronic
1145052620 17:19675121-19675143 TTCCTATTGAAGACTGAGGAAGG - Intronic
1145922791 17:28623390-28623412 TTTCATGAGAGGACAGAGAAAGG + Intronic
1146222067 17:31032806-31032828 TTCTGTGTGAAAACAGAAGAGGG - Intergenic
1146381802 17:32335703-32335725 TTCCCTGTGAAGAAATAGCATGG - Intronic
1146649519 17:34598171-34598193 TTCCATGGGGTGACAGGGGAAGG - Intronic
1146904283 17:36608256-36608278 CTCCATTTGCAGCCAGAGGAAGG + Exonic
1148445975 17:47737428-47737450 GTGCATGTGAAGACAGAGGTTGG + Intronic
1149382476 17:56107718-56107740 TACCAGGTGAACACAGGGGAGGG - Intergenic
1149403806 17:56326552-56326574 GTCCCTGTGGAGAGAGAGGATGG + Intronic
1149558775 17:57593471-57593493 GGCCATGTGAAGACAGAGGTAGG - Intronic
1150378323 17:64700709-64700731 ATCCCTGTGAAAACAGAGTAGGG + Intergenic
1150792129 17:68207250-68207272 TTCTGTGTGAAAACAGAAGAGGG - Intergenic
1151870602 17:76833985-76834007 TGCCATGTGAGGACACAGCAAGG + Intergenic
1151957410 17:77387288-77387310 GGCCATGTGAAGACGGAGCAGGG - Intronic
1151995041 17:77603124-77603146 TTCCTTGTGAAGGGAGAGGGAGG + Intergenic
1153409459 18:4777587-4777609 TGCCATGCAAACACAGAGGAAGG + Intergenic
1154317525 18:13316785-13316807 ATGCATGTGGTGACAGAGGAGGG + Intronic
1154428376 18:14289636-14289658 TTCCAGGGGAAAACTGAGGAAGG + Intergenic
1155533239 18:26789330-26789352 TTGCCTGTGAAGAGAAAGGAGGG - Intergenic
1157674536 18:49559497-49559519 TTTAATGTGGAGACACAGGAGGG + Intergenic
1157694536 18:49710398-49710420 TTCCAAATGCAGAGAGAGGAGGG - Intergenic
1158147324 18:54330030-54330052 TTCTATGTGAATGCAGAGGGGGG + Intronic
1158257946 18:55574184-55574206 TTCTATGTGAATATAAAGGAAGG - Intronic
1158410472 18:57200690-57200712 GGCCATGTGAAGACAGAGGTAGG + Intergenic
1159252742 18:65902202-65902224 AACCATTTGAAGACAGAGGTAGG + Intergenic
1159923043 18:74243564-74243586 TGAGATGTGAAGCCAGAGGAGGG - Intergenic
1160053803 18:75461110-75461132 TGCCATGTGAAGACACAGTGAGG - Intergenic
1161568550 19:5017095-5017117 TTCCCTGTGCAGAGGGAGGAAGG + Intronic
1162171354 19:8791731-8791753 TTCCATGTGAGGAGACAGGGAGG - Intergenic
1164411219 19:28007215-28007237 TTCCCTGTGATGATACAGGATGG - Intergenic
1164773769 19:30834488-30834510 TGTCATATGAAGACAGAGGATGG + Intergenic
1165112455 19:33510340-33510362 CTCCATATGGAGACAGAGGGAGG + Intronic
1165942942 19:39424358-39424380 TTCCATGCCAAGACAAAGGCTGG - Exonic
1166747676 19:45149347-45149369 TGCCACGTGAAGACAGAGGATGG + Intronic
1166919055 19:46216073-46216095 GGCCATGTGAAGACACAGGGAGG + Intergenic
1166922030 19:46235227-46235249 GGCCATGTGAAGACACAGGGAGG + Intergenic
1167549893 19:50153173-50153195 AACCATGTGAAGACAGAGGAAGG + Intronic
1168100993 19:54140874-54140896 TTCCGTGTGGAGACACAGGGAGG + Intronic
1168126888 19:54289135-54289157 TTCCAGGTGAAGGCAACGGAGGG + Intergenic
1168173563 19:54607325-54607347 TTCCAGGTGAAGGCAACGGAGGG - Intronic
925435408 2:3833086-3833108 CTGCCTTTGAAGACAGAGGAAGG - Intronic
925898878 2:8494497-8494519 CGCCATGTGAGGACAGAGGCCGG - Intergenic
926752140 2:16206333-16206355 GGCCATGTGAAGACAGAGGCAGG + Intergenic
926942174 2:18150274-18150296 ATCAATGTGAAGACTCAGGATGG - Intronic
927431854 2:23033256-23033278 TGCCATGTGAAGACATAGCAAGG - Intergenic
927917850 2:26948050-26948072 TGGCAGGTGAAGACAGGGGAAGG - Exonic
928717839 2:34083290-34083312 TCCCATGTGAAGACGCAGCAAGG - Intergenic
928731250 2:34235971-34235993 TGCCATGTGAGGACACAGCAAGG - Intergenic
929859626 2:45665890-45665912 GTCCCTGTGAGGGCAGAGGAGGG + Intronic
930393082 2:50785980-50786002 TTCCAGTTGATGCCAGAGGAGGG - Intronic
930492556 2:52093590-52093612 TTCCATTTGAGGAGAGAAGAGGG - Intergenic
931388342 2:61817157-61817179 TTCCATGCGAAGAAAGCGAAGGG - Intergenic
931570599 2:63665354-63665376 TGCCATGTGAAGGCAGAGATTGG - Intronic
935708334 2:105875630-105875652 TGCCATGTGAGGACACAGCAAGG + Intronic
935731901 2:106071188-106071210 ACCCATGTGAAGACAGAGGCAGG - Intronic
937115826 2:119404368-119404390 TTCCCAGTGAGGACACAGGAAGG + Intergenic
937780693 2:125833756-125833778 AGCCATGTGATGACAGAGGCAGG + Intergenic
938715378 2:134016010-134016032 TTCCATGTGATAACCAAGGAAGG + Intergenic
938797573 2:134731255-134731277 GACCATGTGAAAACAGAGGGAGG + Intergenic
939706839 2:145465377-145465399 TTCCATGTGAAATCAGATAATGG + Intergenic
940154754 2:150643714-150643736 TTTGATGACAAGACAGAGGAAGG - Intergenic
941435747 2:165469247-165469269 TTTGATATGCAGACAGAGGAGGG - Intergenic
941648854 2:168071131-168071153 TACCATGTTTAGACAGAGTAAGG - Intronic
942211746 2:173678176-173678198 ATCAATGTGAACACAGAGGGAGG + Intergenic
942971539 2:181962831-181962853 ATCCACATGAAGACAGGGGAAGG + Intronic
943022501 2:182592067-182592089 TTTGATTTGAAGTCAGAGGATGG - Intergenic
943124031 2:183774007-183774029 TTCCACGGGAAGACATAGGAAGG + Intergenic
943300783 2:186196293-186196315 TTCCCAGTGATGACAGAGAAAGG - Intergenic
943339397 2:186660873-186660895 GACCATGTGAAGACACAAGAAGG - Intronic
943770225 2:191708569-191708591 TCCCTTCTGAAGCCAGAGGATGG - Intergenic
943819383 2:192300643-192300665 AACCATGTGAAGACACAGGGAGG + Intergenic
944438078 2:199712770-199712792 TGCCATGTGATGACAGGGGCAGG - Intergenic
944911745 2:204317406-204317428 TGCTATGGGAACACAGAGGAGGG + Intergenic
945805660 2:214487081-214487103 TTCCATGTGAAGACAGAGGAAGG + Intronic
946017123 2:216612924-216612946 TTCCATGGAAAGACAGTTGAAGG + Intergenic
946160506 2:217832905-217832927 GTCTATGTAAAGACAGAGGGAGG - Intronic
946184295 2:217970070-217970092 CACCACGTGAAGACAGAGGATGG + Intronic
946803420 2:223445252-223445274 TTCCATCTGTAGTCAGAGGCAGG - Intergenic
946918623 2:224553714-224553736 TGCCCTGTGAAGACACAGCAAGG + Intronic
947529297 2:230898696-230898718 TGCCATGGGATCACAGAGGAGGG + Intergenic
948389060 2:237598975-237598997 AGCCATGTGAAGACGGAGGCAGG - Intronic
948719016 2:239884344-239884366 TTCCATGTGGGGACAGAGCCTGG + Intergenic
1168900309 20:1358303-1358325 TCCCATGGGAAGAAGGAGGAGGG + Intronic
1170043614 20:12063749-12063771 GACCATGTGAAGACAGAGGGTGG + Intergenic
1170812028 20:19681528-19681550 TTCCATGTGCAGACTGAGAAGGG + Intronic
1170892029 20:20384175-20384197 TGCCATGTGAGGACACAGGGAGG - Intergenic
1172063529 20:32203564-32203586 TTCCATGTGAAGAGAGAAAAGGG + Intronic
1172409323 20:34710039-34710061 TTCCCTGTGAGGACAGAGCCAGG - Exonic
1172521373 20:35568677-35568699 TTACATGGGAAGCCATAGGAAGG - Intergenic
1172587951 20:36097978-36098000 CTCCAGGTGGTGACAGAGGATGG + Intronic
1172701040 20:36853912-36853934 TTCCATGTGAACAGGAAGGAAGG + Intronic
1172884270 20:38220993-38221015 TTCCCTCTGAAGGCAGAGGAGGG - Intronic
1173157418 20:40626014-40626036 GACCATGTGAAGACAGAGGCAGG - Intergenic
1174366486 20:50059716-50059738 GGCCGTGTGAAGACAGAGGCAGG + Intergenic
1175262009 20:57680636-57680658 CTCAATGTGAAGACAGAAGCAGG + Intronic
1177562825 21:22778853-22778875 TGCCAAGTGAAGACACAGCAAGG - Intergenic
1177879359 21:26673719-26673741 TTCCATTTTAAGTCAGAGGATGG + Intergenic
1178093279 21:29187113-29187135 TTCCATGTGCAGGGAGAGCATGG + Intergenic
1178229211 21:30761790-30761812 TTCCATGGGAATATAGATGATGG - Intergenic
1178276690 21:31245251-31245273 TTCCAAGTGAAGGCTAAGGAGGG - Intronic
1179155767 21:38849773-38849795 TTCACTGTGAAGACAGAGGAAGG + Intergenic
1179169172 21:38959457-38959479 GGCCATGTGAAGGCAGAGAATGG + Intergenic
1179233517 21:39526013-39526035 GTCCATAGGAAGTCAGAGGAAGG + Intergenic
1180040507 21:45276925-45276947 TTCCATGTAAAGTCACAGCAGGG - Intronic
1180065080 21:45408440-45408462 ATCCAGGTGAAGACAGAACAAGG - Intronic
1180610716 22:17095975-17095997 TTCCCTCTCAAGAGAGAGGAGGG + Intronic
1181488420 22:23246126-23246148 TTCCCTTTGAAGGCAGAGGCCGG + Intronic
1181665621 22:24394326-24394348 TACCATGTGAAGACACAAGATGG - Intronic
1182807025 22:33081395-33081417 TTGCATGTGAAGACGTAGGGAGG + Intergenic
1184106667 22:42371325-42371347 GGCCATGTGAAGACAGATGCAGG - Intergenic
1184171859 22:42764768-42764790 TTCCTTCTGAAGGCAGAGAACGG + Intergenic
1184261241 22:43317933-43317955 GACAATGTGAAGACAGAGGGAGG + Intronic
1184270337 22:43377596-43377618 TTCCATTTTAAGAAAGATGAGGG + Intergenic
1184482470 22:44755853-44755875 CTCCAGGTCAAGAGAGAGGAAGG - Intronic
1185026545 22:48417426-48417448 TTCCATCAGAAGCCACAGGAGGG - Intergenic
949261882 3:2112000-2112022 CTCTGTGTGGAGACAGAGGAAGG + Intronic
950198831 3:11028573-11028595 TTCCAGGTGCAGAAAGAGGGTGG - Intronic
951188463 3:19741542-19741564 TAGCATGGGAAAACAGAGGAGGG - Intergenic
951717597 3:25665124-25665146 TTCCATTTGAAGGGAGAGCAGGG + Intergenic
951823302 3:26838396-26838418 ATCTATGTGACGAGAGAGGAGGG + Intergenic
951946055 3:28137569-28137591 TACCATGAGAAAACTGAGGAAGG + Intergenic
952653170 3:35750736-35750758 TGACATGCAAAGACAGAGGAGGG + Intronic
952929994 3:38352502-38352524 TTCCATGTAAAAACACTGGAAGG + Intronic
952946611 3:38482177-38482199 ACCTATGTGAGGACAGAGGAGGG - Exonic
953829435 3:46282804-46282826 GTCCAGGTGAAGGGAGAGGATGG + Intergenic
954704418 3:52471607-52471629 AGACATGTGATGACAGAGGAGGG - Intronic
954769442 3:52952924-52952946 TACCATGTGAAGACACAGCAAGG + Intronic
956781640 3:72607780-72607802 GGCCATGTGAAGACAGAGGCAGG + Intergenic
956974749 3:74566564-74566586 GACCATGTGAAGACAGAGGCAGG - Intergenic
957178737 3:76848676-76848698 CCCCATGTGAAGACACAGCAAGG - Intronic
958120574 3:89282505-89282527 TTCCATGTGTAGGAAGATGATGG - Intronic
960274681 3:115714995-115715017 TACCATGTGAGGACACAGCAAGG - Intronic
960644206 3:119860508-119860530 TTCCATATTCAGATAGAGGAAGG - Intronic
961979740 3:131064380-131064402 GGCCATGTGAAAACAGAGCAAGG - Intronic
962070749 3:132031698-132031720 TTCGAAGTGAAGTCAGAAGAAGG + Intronic
962406932 3:135108609-135108631 CTCCAAATGAAGTCAGAGGAGGG + Intronic
962749339 3:138422009-138422031 TACCTTGTGAAGACAAAGGCAGG + Intergenic
963274990 3:143320938-143320960 TGCCATGTGAAGACAAAGGAAGG + Intronic
963757996 3:149256115-149256137 TTACATGTGAAGAGGGTGGAGGG + Intergenic
963850689 3:150207559-150207581 TTCCCTGTAAAATCAGAGGATGG - Intergenic
965523826 3:169696175-169696197 TGCCATGTGAGGACATAGCAAGG - Intergenic
965755358 3:172021040-172021062 TTCCATGTCAAGCCACAGGTTGG - Intergenic
966322300 3:178714493-178714515 TTCCAGGTGATGACTGGGGAGGG + Intronic
966583347 3:181593259-181593281 CACCATGTGAAGACACAAGAAGG - Intergenic
967606573 3:191454134-191454156 TTCCTTGTGAAGGCATAGGCTGG + Intergenic
968593171 4:1469768-1469790 GGCCATGTGAAGACAGAGGCAGG - Intergenic
969328712 4:6460323-6460345 GACCATGTGAAGACACAGTAGGG + Intronic
970074581 4:12203078-12203100 TGCCATGGGAACACAGAGGAAGG + Intergenic
970421005 4:15905784-15905806 TTCGATGTGAAGACAGTGGAAGG - Intergenic
970427614 4:15959926-15959948 TTCCATGTGAAGACAGAGGCAGG + Intergenic
971197189 4:24480789-24480811 TGCCATTTGAAGACAGATGATGG + Intergenic
971287762 4:25306902-25306924 GTCCACATGAAGACAGAGGTGGG - Intergenic
971862194 4:32122243-32122265 TTCCATGAGAAGAAAGAGAGAGG - Intergenic
972019275 4:34288981-34289003 TTTCATTAGAAGAAAGAGGAAGG + Intergenic
972474944 4:39441274-39441296 TGCCATGTGAAGGAAGAGGTAGG - Intronic
974097258 4:57376961-57376983 TGCCATGTGAAGATAGATGTAGG - Intergenic
974369795 4:61000733-61000755 TTCCAGAAGAAGAGAGAGGAAGG + Intergenic
974379491 4:61120186-61120208 GGCCATGGGAAGACAGAGGCAGG + Intergenic
974484906 4:62492631-62492653 TGCCATGTGAGGACAGAGCCAGG + Intergenic
974513269 4:62873531-62873553 TTGCATTTAAGGACAGAGGAGGG + Intergenic
974691616 4:65304596-65304618 GACCATGTGAAGACACAGAAGGG + Intergenic
974824604 4:67111632-67111654 GGCCATGTGAAGACAGAGGGAGG - Intergenic
975690058 4:76954071-76954093 TTCCTTTTGCAGACATAGGATGG - Intronic
976334421 4:83869206-83869228 GGCCCTGTGAAGACAGAGGCAGG + Intergenic
976514878 4:85953852-85953874 TTCCAAGGGAAGACAGGAGAAGG + Intronic
977294395 4:95194569-95194591 TTGGATTTGAAGACAGCGGAAGG - Intronic
977534583 4:98242170-98242192 TTTAATGGGAAAACAGAGGAAGG - Intergenic
977545822 4:98375238-98375260 TGCCATGTGAAGACAGAGGCAGG - Intronic
979156359 4:117395338-117395360 TTTCATGTGATGAAAGAAGATGG + Intergenic
979422109 4:120517351-120517373 TTCCATGTGATGACATATGATGG - Intergenic
979552817 4:122010117-122010139 AGCCATGTGAAGACAGAGACAGG - Intergenic
979862440 4:125710373-125710395 GACCTTGTGAAGACAGAAGAAGG + Intergenic
980320648 4:131268668-131268690 TTCCATGTGAAGAGATATGAGGG - Intergenic
981070836 4:140536373-140536395 TTCTATGTGAATATAGAGGAAGG + Intronic
981913342 4:150007833-150007855 TGCCATGTGATGATAGAGGCAGG - Intergenic
983196711 4:164814731-164814753 TTTCATGAAAAGACAAAGGATGG - Intergenic
984329932 4:178301451-178301473 TTCTAGGAGAAGACAGAGGGTGG + Intergenic
984422512 4:179542764-179542786 GGCCATGTGAAGACAGAGGCAGG + Intergenic
984530436 4:180909500-180909522 TTCCATGGGAAGGAAGAGGAAGG - Intergenic
986023297 5:3825077-3825099 CTCCATGTGAAGACAGAGATTGG + Intergenic
986377338 5:7145699-7145721 ATCCATGTGAAGACACCGTAAGG - Intergenic
986668049 5:10120086-10120108 TTGCAGGAGAAGACAGAGGGGGG + Intergenic
986987051 5:13512101-13512123 GGCCATGTGAAGACACAGGGAGG - Intergenic
987769660 5:22284398-22284420 TCTCATCTGAAGACTGAGGATGG + Intronic
988419897 5:30992526-30992548 TGCCATGTGATGACAGAGGAAGG - Intergenic
988730082 5:33963786-33963808 TTCCATCTGATGACAATGGAGGG + Exonic
989430563 5:41350217-41350239 TTCAATGAGAAAACAGAGGACGG - Intronic
990283789 5:54279427-54279449 TGCCATGTGAGGACATAAGAAGG - Intronic
990414912 5:55576945-55576967 TTCCATTAGAAGACTGAAGAGGG + Intergenic
990853576 5:60236755-60236777 CTGGATTTGAAGACAGAGGAAGG + Intronic
991517354 5:67452312-67452334 TACCATGGGAAGTGAGAGGAAGG - Intergenic
991718545 5:69474634-69474656 TTCCATGTGAAGGGAAGGGAAGG - Intergenic
993423814 5:87737052-87737074 TGCCATCTGAAGAAAGGGGATGG - Intergenic
993862518 5:93153492-93153514 TTCCATGGGTAGAGGGAGGAGGG - Intergenic
994957933 5:106558836-106558858 GTCTATGGGGAGACAGAGGAAGG - Intergenic
995062232 5:107823358-107823380 AACCATGGGAATACAGAGGAGGG - Intergenic
995155481 5:108907249-108907271 TTTAATGAGAAGGCAGAGGAGGG - Intronic
995219439 5:109631331-109631353 TTCCAAGTCATGACAGAGCACGG - Intergenic
996065680 5:119076476-119076498 TCACATGTGAAGAAAGAGAAAGG + Intronic
996136784 5:119852587-119852609 TTCAATGATGAGACAGAGGAAGG - Intergenic
996212235 5:120825532-120825554 TGCCATGTGAGGACATAGCAAGG + Intergenic
996850458 5:127945816-127945838 GTCCATGTGAACACAAAGAAGGG - Intergenic
997674461 5:135702366-135702388 TGCCATGTGATGACAGAGGCAGG + Intergenic
997731282 5:136179540-136179562 TTCAATGTGCAGCCAGTGGATGG + Exonic
997961326 5:138323978-138324000 TTCCATGAGAAGACTGGGCAGGG + Intronic
998039297 5:138942185-138942207 TTGGCTTTGAAGACAGAGGAAGG + Intergenic
998404164 5:141864262-141864284 TTCCAGCTGAAGGCAGTGGATGG - Exonic
999058348 5:148606401-148606423 TTTCATGTGAACACAGTTGAAGG + Intronic
999069297 5:148726549-148726571 TTCCCTGTGAGTACAGAGCATGG - Intergenic
999195005 5:149775825-149775847 TTGCATGTGGAGAAAGAGAAGGG - Intronic
999201998 5:149823226-149823248 TCCCATGTGAGGAATGAGGAAGG + Intronic
999717029 5:154369591-154369613 ATCCATTTGGAGAGAGAGGAGGG - Intronic
1000384177 5:160658258-160658280 GTCCATGGGAGCACAGAGGAAGG + Intronic
1001253524 5:170166614-170166636 TTTCATGTGGAGACCAAGGAAGG + Intergenic
1001537205 5:172506533-172506555 TGACAGGTGAAGACAGATGAAGG - Intergenic
1002296779 5:178235782-178235804 TTCCTTAGGGAGACAGAGGAGGG + Intergenic
1003320129 6:5043914-5043936 TTCCTTGGGAAGAAACAGGAAGG - Intergenic
1003466029 6:6380874-6380896 ATGCATGTGAAGAGAGAGAAGGG + Intergenic
1003644299 6:7902051-7902073 GGGCATGTGAGGACAGAGGACGG + Intronic
1004383668 6:15153798-15153820 TTCCTAGTGAAGACAGGGCACGG + Intergenic
1004597247 6:17111856-17111878 TGCCATGTGAGGACACAGAAGGG - Intronic
1004876681 6:19962684-19962706 TACCCTGTGAAGATGGAGGAAGG + Intergenic
1005081049 6:21956869-21956891 TTCCTGGTGAGGACAGAGAAAGG - Intergenic
1005209952 6:23449154-23449176 GACAATGTGAAGACAGAAGAAGG + Intergenic
1006861346 6:37173360-37173382 TTCCTTGGGAGGTCAGAGGAAGG + Intronic
1007196509 6:40066215-40066237 TTCCCTCTGAAGCCAGAGGCAGG - Intergenic
1008252563 6:49258362-49258384 TACCATGTGAGGACACAAGAAGG - Intergenic
1008669098 6:53748347-53748369 CTGCCTTTGAAGACAGAGGAAGG + Intergenic
1009978682 6:70701034-70701056 TTCCGTGTGAGGAGAGAAGAGGG - Intronic
1010117119 6:72326954-72326976 TTCCCTTTGATGACAGAGGAAGG + Intronic
1010183306 6:73113309-73113331 TTCCATATGTAGACAGAGCTTGG - Intronic
1010275584 6:73965192-73965214 TTGCATGAGAAGAAACAGGATGG + Intergenic
1010770582 6:79824326-79824348 AAACATGTGAAGACAGATGAGGG + Intergenic
1011808802 6:91105347-91105369 TGCCATGTGATGCCACAGGAAGG + Intergenic
1012065294 6:94542597-94542619 GTCCATGTGAACACAAAGAAGGG + Intergenic
1013356527 6:109350248-109350270 TTCCCTGTGCAGGGAGAGGAGGG + Intergenic
1013995076 6:116298458-116298480 TTAGTTTTGAAGACAGAGGACGG + Intronic
1014432127 6:121383345-121383367 TTCCATATGTAGACAGAATAAGG + Intergenic
1014912304 6:127109634-127109656 TTCCATGTGAAGACATAGCAAGG - Intergenic
1015423987 6:133043420-133043442 TTCCATTAGAAGATAGAGCAAGG + Intergenic
1015439464 6:133231706-133231728 CTCCATGAGCAGACAGAGCATGG + Intergenic
1015983718 6:138864832-138864854 TTACCTTTGAAAACAGAGGATGG + Intronic
1017547816 6:155470266-155470288 ATGCATGTGAAGACAGAGCATGG - Intergenic
1017760117 6:157562195-157562217 AACCATGAGAAGAGAGAGGAAGG + Intronic
1017972894 6:159328560-159328582 TTCCATCTGCAGTCAGGGGAAGG - Intergenic
1018234901 6:161714424-161714446 TGCCATGTGAAGACACAGCAAGG + Intronic
1018761897 6:166900391-166900413 TTCCGGGTGAAGGCACAGGAGGG + Intronic
1019281384 7:202176-202198 TCCCATGTGCATAGAGAGGACGG + Intronic
1020926934 7:14340378-14340400 TTCCACTTGAAGACAGTGGGAGG - Intronic
1021461595 7:20893602-20893624 TGCTTTGTGAGGACAGAGGAAGG - Intergenic
1021696044 7:23277270-23277292 CTCCATGTGAGGCCTGAGGACGG + Intergenic
1022357538 7:29630121-29630143 GGCCATGTGAAGACAGAGGCAGG - Intergenic
1022367850 7:29743085-29743107 GGCCATGTGAAGACAGAGGCAGG - Intergenic
1023195472 7:37633795-37633817 TTCCAATTAAAGACAGAGGTTGG - Intergenic
1023379369 7:39591078-39591100 GACCATGTGAAGACACAAGAAGG - Intronic
1023941003 7:44768352-44768374 TCCCATGTGCAGACAGATCAGGG + Exonic
1023981248 7:45071731-45071753 CTGGCTGTGAAGACAGAGGAAGG - Intronic
1024611275 7:51066346-51066368 TTCCCTGTGTCCACAGAGGAAGG - Intronic
1026312224 7:69196406-69196428 GTCCAAGAGAAGGCAGAGGAAGG - Intergenic
1027510876 7:79078087-79078109 TTCCATTGTAAGACGGAGGATGG + Intronic
1027839699 7:83293250-83293272 GTGCATGTGGATACAGAGGATGG + Intergenic
1027982636 7:85245575-85245597 TTTCATGTGTATACTGAGGATGG - Intergenic
1028101150 7:86822552-86822574 TTGCATGTGAGCAAAGAGGAAGG + Intronic
1028208274 7:88041727-88041749 TTATCTGGGAAGACAGAGGAAGG - Intronic
1029805247 7:102989217-102989239 TTCCTTGTGAATGCAGAAGAAGG + Intronic
1030402375 7:109068074-109068096 GGCCATGTAAAGACAGAGGCAGG - Intergenic
1030556408 7:111030457-111030479 TCCCATGTGAAGGAAGAGAAAGG - Intronic
1031656213 7:124359549-124359571 ATCCATGTGAAGATACAGCAAGG - Intergenic
1031936430 7:127739828-127739850 TTCCTTGTCCAGACAGAGGCAGG - Intronic
1031970837 7:128063783-128063805 TTACAGGTGAAGTCATAGGACGG + Intronic
1032004408 7:128288742-128288764 TGGCATGTGGAGACAGAGGCAGG + Intergenic
1032073035 7:128821455-128821477 TGCCATGGCAAGAAAGAGGAGGG - Intronic
1033736934 7:144231868-144231890 TTCCAGGAGATGACTGAGGAGGG + Intergenic
1033746123 7:144319078-144319100 TTCCAGGAGATGACTGAGGAGGG - Intergenic
1035031199 7:155861919-155861941 TTCAATGTGTAGACTGAGGTGGG - Intergenic
1037541798 8:19879283-19879305 TTCACTGTGAAGACAAATGAGGG - Intergenic
1037993285 8:23335804-23335826 TGGGGTGTGAAGACAGAGGAAGG + Intronic
1038127268 8:24688665-24688687 GTCCAAGAGAAGACAGAGAATGG + Intergenic
1038129202 8:24710510-24710532 TTTCATGGGAACACAAAGGAGGG - Intergenic
1038197450 8:25381292-25381314 TTGCATGTGAAGCCAGGGGCTGG - Intronic
1038533315 8:28336342-28336364 TTCTGTGGGAAGACAGAGGCAGG + Intronic
1038749497 8:30282517-30282539 TTCCATGGGAAGCAGGAGGAAGG - Intergenic
1039176634 8:34815161-34815183 CTCCATGGGAAGACACAAGAAGG + Intergenic
1040718941 8:50293301-50293323 AACCATGTGAAGACATAGGTAGG - Intronic
1041259611 8:56009551-56009573 GACCATGTGAAGACACAGGGAGG - Intronic
1041334161 8:56760876-56760898 CACCATGTGAAGTCAGAGGCAGG - Intergenic
1041430102 8:57771034-57771056 TTCAATGTAAAGAAAGTGGAAGG + Intergenic
1041984141 8:63900273-63900295 TGCCTTGTGAAGAAAGATGATGG + Intergenic
1042469197 8:69163775-69163797 GTCCATGTGATAGCAGAGGATGG + Intergenic
1044750717 8:95412877-95412899 TTAAATGAGAAGAAAGAGGAGGG - Intergenic
1044928010 8:97225322-97225344 CTCCTTGTGAAGAAAGAGGCAGG - Intergenic
1044942186 8:97354487-97354509 TTCTATGGGATGACAAAGGAAGG - Intergenic
1045203740 8:100014904-100014926 GTCCATGGGAACACACAGGATGG - Intronic
1045498339 8:102726919-102726941 TTGCATTTGAAAACACAGGAGGG + Intergenic
1045710819 8:104981659-104981681 TACGATGTGAAGAGAGTGGACGG - Intronic
1045756235 8:105546131-105546153 TTCCAGGTGAAGAAAAAGGGAGG - Intronic
1046607454 8:116387770-116387792 TGCCATGTGAAGAAGGATGAAGG + Intergenic
1047337298 8:123949001-123949023 AGCCATGTGGACACAGAGGAGGG + Intronic
1047503293 8:125458909-125458931 TTCTGTGGGAACACAGAGGAGGG + Intergenic
1047773352 8:128048779-128048801 TGCCCTTTGAAGAAAGAGGAAGG + Intergenic
1047808815 8:128385755-128385777 TTCCATGTGATGACAACAGAGGG - Intergenic
1047928739 8:129705534-129705556 TGCCATGTGAAGAAGGAAGAAGG - Intergenic
1048276304 8:133068565-133068587 TTCCATGAGAACACCCAGGAAGG - Intronic
1048570953 8:135655552-135655574 ATGCATCTGGAGACAGAGGAAGG + Intronic
1048729385 8:137420484-137420506 TTCCAAGTGATGACACAAGATGG + Intergenic
1049017775 8:139933074-139933096 GTCCATGGGTAGACAGCGGAGGG - Exonic
1049537891 8:143190414-143190436 GGCCACGTGAAGACAGAGGAGGG - Intergenic
1050285500 9:4097475-4097497 TTCAGTGAGAAGGCAGAGGAAGG + Intronic
1050498119 9:6265911-6265933 TTCCATGTGAACAAGGAGCATGG - Intergenic
1050555401 9:6785285-6785307 TGCCATGTGAAGATGGAGGCAGG - Intronic
1050966401 9:11809594-11809616 GTGCATGTGAACACAAAGGAGGG - Intergenic
1051712420 9:19945610-19945632 TTCCATGTGATGATATAGTAAGG - Intergenic
1052944715 9:34159033-34159055 TTCCAAGTGAACATATAGGAAGG - Intergenic
1053044249 9:34900842-34900864 TTCCATGTGAGGACACAGCAAGG + Intergenic
1055252733 9:74327822-74327844 TGCCATGAGATGACAGAGCAAGG - Intergenic
1055344461 9:75320290-75320312 CACCATGTGAAGACTGAGGCAGG - Intergenic
1055440491 9:76331762-76331784 CTGCCTTTGAAGACAGAGGAAGG + Intronic
1056802204 9:89700152-89700174 GTCCATGGGAGGACAGAGAAGGG - Intergenic
1056967964 9:91180000-91180022 TGCGCTTTGAAGACAGAGGAAGG + Intergenic
1057205983 9:93173037-93173059 CTCCATGTGAATATAGAAGAGGG - Intergenic
1057348462 9:94274086-94274108 GACCATGTGAAGACACAGGGAGG - Intronic
1057552352 9:96061246-96061268 TGCCATGTGAAGGGAGAAGATGG + Intergenic
1058250172 9:102684258-102684280 TACCATGTGAGGACACAGGTAGG - Intergenic
1058378276 9:104350204-104350226 GTTCATGTGAAGAGAAAGGAGGG - Intergenic
1059663947 9:116428112-116428134 AGCTGTGTGAAGACAGAGGAAGG + Intronic
1060475358 9:123982815-123982837 CTCCATGAGAAGACAGAGAAGGG - Intergenic
1060936184 9:127517487-127517509 TTCCATGTGCAGGCAAAGCAGGG - Intronic
1062584828 9:137244526-137244548 TTCCCTGAGAAGCCTGAGGAGGG - Intronic
1186012596 X:5151652-5151674 GTTCATGTGAAGACACAGCAGGG + Intergenic
1186938441 X:14476896-14476918 TTGGCTGTGAAGAAAGAGGAAGG + Intergenic
1187555627 X:20348687-20348709 TGCCATGTGAAGACACAGCGAGG - Intergenic
1187637502 X:21247130-21247152 TTCTAGATGAAGGCAGAGGAAGG + Intergenic
1190577518 X:51855551-51855573 AACCATGTGAGGACACAGGAAGG - Intronic
1190990926 X:55549443-55549465 TTCATTTTGAACACAGAGGATGG - Intergenic
1191108615 X:56788242-56788264 TCCCATGTGAATAAAGAGGAAGG - Intergenic
1191709004 X:64128336-64128358 TTACATGTTAATACAGAGTATGG - Intergenic
1192538148 X:71946152-71946174 TGCCATGGGAGGACAGAGAAGGG + Intergenic
1194230372 X:91315330-91315352 TTCCTTGTGAAGATTGAGCATGG - Intergenic
1194275681 X:91878161-91878183 TTCTATGTAAAGGCTGAGGATGG + Exonic
1194665009 X:96667776-96667798 AACCAAGTGAAGACACAGGAAGG - Intergenic
1194767224 X:97855781-97855803 TTAGATGTGAAGAAAAAGGAAGG - Intergenic
1195154966 X:102113693-102113715 TTCCACTTGAAGAGAGGGGAGGG - Intergenic
1195588215 X:106591390-106591412 AGCCATGTGAAGACTGAGGCAGG - Intergenic
1195858855 X:109359066-109359088 ATCCATGGCAAGCCAGAGGAGGG + Intergenic
1195958839 X:110364178-110364200 GCCCATCTGAAGACAGAGGCAGG - Intronic
1196397531 X:115281071-115281093 GGCCATGTGATGACGGAGGAAGG - Intergenic
1198190132 X:134295763-134295785 TTCCATGGCAAGACAAAGAATGG - Intergenic
1198446835 X:136725754-136725776 GTCCTTGTGAAGACAGAGTCAGG - Intronic
1198671163 X:139082551-139082573 GCCCATGTGAAGACAGAGACAGG + Intronic
1198895024 X:141444338-141444360 GACCATGTGAAGACATAGGAAGG - Intergenic
1198942567 X:141973270-141973292 TTACATGTGAAGGCAGGGGCAGG + Intergenic
1199005068 X:142686256-142686278 TTCCCTGTGAACCCAGAGGTGGG + Intergenic
1199130178 X:144175939-144175961 TACCATGTGAGGACATAGCAAGG - Intergenic
1199191149 X:144972631-144972653 CACCATGTGAAGACACAGCAAGG + Intergenic
1199672513 X:150158995-150159017 TTTCATGTGCAGAAAGAGGGAGG - Intergenic
1199688276 X:150284114-150284136 TTCCATGTGAAGATACAGCAAGG - Intergenic
1200050959 X:153431506-153431528 GGCCATGTGAAGACAGAGACAGG + Intergenic
1200592927 Y:5099595-5099617 TTCTATGTAAAGGCTGAGGATGG + Exonic
1202103897 Y:21341090-21341112 AGCCATGTGAAGACAGAGGTAGG - Intergenic