ID: 945809854

View in Genome Browser
Species Human (GRCh38)
Location 2:214535515-214535537
Sequence CTGTTTGAATGTAATAAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 147}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945809854 Original CRISPR CTGTTTGAATGTAATAAACC TGG (reversed) Intronic
904882686 1:33712686-33712708 CTCCTTGAATGGAATTAACCAGG - Intronic
906284139 1:44575288-44575310 TTGTTTAAGTGAAATAAACCAGG - Intronic
908315192 1:62925556-62925578 CTGGTTGATTTTCATAAACCAGG + Intergenic
910769952 1:90821090-90821112 CTCTTTGGATGTAATTAACTAGG - Intergenic
910809531 1:91221738-91221760 CAACTTGAATGTAATAAAACTGG - Intergenic
912540318 1:110409933-110409955 CAGTTTGAATGTTATAATTCAGG + Intergenic
913675787 1:121138961-121138983 TTGTTTGAATGAAATAATACAGG + Intergenic
914597992 1:149173397-149173419 CAGTTTGAATGTCATAAAGATGG - Intergenic
917049811 1:170908272-170908294 CTGTATAAATGTAATAAATGTGG + Intergenic
917868588 1:179221948-179221970 CTGTTTGAATTTATTAAAAGTGG + Intronic
919092708 1:192993733-192993755 CCTTATGAATGTAATAAACGTGG - Intergenic
919445155 1:197694679-197694701 CTGATTGAAAGAAATAAATCTGG - Intronic
919722920 1:200859666-200859688 CTGTTTGCATGTAAGAGACCAGG + Exonic
921521569 1:216161994-216162016 CAATTTGACTGTAATATACCTGG + Intronic
923607322 1:235456171-235456193 ATGTTTCAATGTAATAAGTCAGG - Intronic
923846868 1:237743982-237744004 CTGTTTTCAAGTAATAAAACTGG - Intronic
1064032471 10:11891659-11891681 CAGTTTGAATGAAATAACCAGGG + Intergenic
1064786033 10:18895717-18895739 CTGCTTGCTGGTAATAAACCAGG + Intergenic
1066682900 10:37952455-37952477 CCCTTTGAATGTAATAAATGTGG - Exonic
1070299850 10:75195592-75195614 ATATTTGAATTTCATAAACCCGG + Intergenic
1070498579 10:77048617-77048639 CTGAATGAATGAAATAAACTTGG + Intronic
1071170494 10:82858345-82858367 CTGTTTTGCTGTAATAAACTGGG + Intronic
1075380307 10:122013394-122013416 CTGTTTGTTTGTATTAAAACGGG + Intronic
1076811679 10:132889505-132889527 CTGCTTGAATTCATTAAACCAGG + Intronic
1077677860 11:4213401-4213423 TTGTTTGGATGAAATAAACTTGG + Intergenic
1077933325 11:6756164-6756186 CCCTTTGTATGTAATTAACCAGG + Intergenic
1080704832 11:34680657-34680679 CTGTCTGAAAGTGAAAAACCTGG - Intergenic
1081219691 11:40445323-40445345 CCTTATGAATGTAATAAACATGG - Intronic
1083573474 11:63772387-63772409 CTGCTTGAATGTGATGATCCGGG + Intergenic
1090633074 11:128667607-128667629 CTTTTTCAATGTAATACAGCTGG - Intergenic
1092621005 12:10268382-10268404 GTGTTTGAAAGTAATGTACCAGG + Intergenic
1094104058 12:26790403-26790425 ATGTTTCAATTTCATAAACCAGG - Intronic
1097358182 12:58626062-58626084 ATTTTTGAATGTAATAATACTGG + Intronic
1097896696 12:64830993-64831015 CTGTTCAACTGTAATAATCCAGG - Intronic
1099345198 12:81491255-81491277 AGGTTTGAAAGTAAGAAACCTGG - Intronic
1099565353 12:84236450-84236472 TATTTTGAATGTAATAAATCAGG + Intergenic
1099636284 12:85216982-85217004 ATATTAGAAAGTAATAAACCTGG - Intronic
1100677970 12:96888596-96888618 CAGTTTGAATTTCATAATCCTGG - Intergenic
1101622890 12:106407258-106407280 CAGTTAGGATGTAAGAAACCAGG - Intronic
1102160108 12:110761964-110761986 CAGTCTGAATGTAAGAAAACTGG + Intergenic
1105285140 13:18997187-18997209 CTTTTTTAATGTAATGAGCCTGG - Intergenic
1106941749 13:34787690-34787712 CTGATGGAATGAACTAAACCAGG + Intergenic
1112522242 13:100106714-100106736 CTCTTTAAATGTGCTAAACCTGG - Intronic
1113588327 13:111480824-111480846 CTGGTTGAGTCTCATAAACCAGG - Intergenic
1113595273 13:111527227-111527249 CTGTTTGTTTGAAATAAACTAGG + Intergenic
1115544385 14:34452312-34452334 TTGTTTCAATGTAAGAAAACTGG - Intronic
1115904026 14:38187034-38187056 CTGTGTCAATTTAATAAGCCGGG + Intergenic
1116300053 14:43168036-43168058 CAATTTGAATGTAAAAAGCCAGG + Intergenic
1117242997 14:53854456-53854478 CTGCTGGAATGTATTAATCCAGG - Intergenic
1121252203 14:92507509-92507531 GTGTTTCAGTGTAATAAACCAGG - Intergenic
1121991668 14:98563760-98563782 AGGTTAGAAGGTAATAAACCAGG + Intergenic
1122076823 14:99241210-99241232 CTGTTTGGCTGTAATTACCCAGG + Intronic
1124993577 15:34700217-34700239 CTGTTTGAATCTTGAAAACCTGG + Intergenic
1131676810 15:94678211-94678233 CTGTTTAAATATGATACACCTGG + Intergenic
1133106369 16:3512561-3512583 CTGATTTAATGAAATACACCTGG + Intronic
1134111767 16:11519438-11519460 CTGTTTAAATTTAATAGAGCCGG + Intronic
1134764276 16:16743017-16743039 CTTCTTTAATGAAATAAACCAGG - Intergenic
1134981780 16:18616198-18616220 CTTCTTTAATGAAATAAACCAGG + Intergenic
1137413468 16:48249451-48249473 CTGTTTGTATATATAAAACCTGG + Intronic
1139831124 16:69799137-69799159 CTGCTTGGATGTAATGAATCAGG + Intronic
1141493827 16:84393230-84393252 CTGTGTGATTGGAATCAACCCGG + Intronic
1142993552 17:3747740-3747762 CAGTTTGCATTTAACAAACCTGG + Intronic
1149938453 17:60835265-60835287 CTGTTTGAAAGTAGTAATTCAGG - Intronic
1153379307 18:4418921-4418943 CAGTTTGAATATGATATACCTGG - Intronic
1153942160 18:9987814-9987836 AAGTTTGAATGTAATTAACTGGG - Intergenic
1154148731 18:11888540-11888562 CTGTTTAAAGATCATAAACCAGG + Intronic
1156070305 18:33199122-33199144 CTGTTTGTATTAATTAAACCTGG + Intronic
1157474021 18:48009905-48009927 CTGTTTTAATTTACTAAATCTGG - Intergenic
1158234840 18:55301260-55301282 CTGGTTGAATGTAATACAGTAGG + Intronic
1158637313 18:59171880-59171902 GAGGTTGAATGAAATAAACCAGG + Intergenic
1163971868 19:20806030-20806052 ATGTTTCAATGTGATAAACATGG + Exonic
1164067141 19:21725979-21726001 CTGTGCGAATGTAATAAAGTTGG - Exonic
1165777257 19:38412043-38412065 CTGTTTGAACATAATCTACCCGG + Intronic
1166021611 19:40036095-40036117 CTGTTTGAATGTAAGGAATGTGG - Exonic
1166025083 19:40075678-40075700 CTGTTTGAATGTAAGGAATGTGG - Exonic
929055265 2:37871183-37871205 CTGTGTGAAGGTGATAAACCGGG - Intergenic
929540304 2:42814275-42814297 CTGTTTGCATGTAAAAGATCTGG + Intergenic
929622967 2:43376189-43376211 CTGTCTGAATGTAGTAAGACAGG - Intronic
929937182 2:46301605-46301627 TTAATTGAAAGTAATAAACCAGG - Intronic
935676040 2:105595688-105595710 CTGTTTGAAAGCATTGAACCAGG + Intergenic
936473055 2:112815956-112815978 CAGGCTGAATGTAGTAAACCTGG - Intergenic
938143466 2:128814062-128814084 CATTCTGGATGTAATAAACCAGG - Intergenic
939300021 2:140324048-140324070 CTATGTGGATGTAATAAACCTGG + Exonic
940162978 2:150733658-150733680 CTGTTTGAAAATAATAAGCATGG - Intergenic
941616966 2:167731658-167731680 CTGTGTGAATGAAGGAAACCAGG + Intergenic
943343340 2:186707786-186707808 AAGTTTGAATGTAATTATCCAGG - Intronic
943791848 2:191942068-191942090 CTGTGTGACTGTAATTAAGCAGG + Intergenic
944021347 2:195108466-195108488 CTGTTAGAATGCAAGCAACCTGG + Intergenic
945809854 2:214535515-214535537 CTGTTTGAATGTAATAAACCTGG - Intronic
946152026 2:217781856-217781878 CTGTATCAATGTAATTATCCTGG + Intergenic
946460006 2:219860640-219860662 CTTTTTGATTGTAAGAAAGCTGG + Intergenic
1170124404 20:12947609-12947631 CTTTTTCAATGTGATAATCCAGG + Intergenic
1170609185 20:17898026-17898048 CTGTTTAAATTTAATAAGGCTGG + Intergenic
1171314835 20:24180638-24180660 CTGTTCAAATGTTATATACCAGG + Intergenic
1174677741 20:52374724-52374746 CTGTCTGAGTGAAATAAAACAGG - Intergenic
1174706436 20:52660934-52660956 CTGTTTGATAATAATGAACCGGG - Intergenic
1183091053 22:35522330-35522352 CTGTATCAACGTAAGAAACCAGG + Intergenic
950204616 3:11069319-11069341 ATGTTTAAATGTAATAAAGTAGG + Intergenic
951077177 3:18409335-18409357 CTTTTTGAATCTAATATATCAGG - Intronic
960107763 3:113816598-113816620 TTGTCTGAATGTAAGAAACATGG + Intergenic
964575889 3:158167916-158167938 CTCTTTGAAGGTAAGAAACTAGG + Intronic
967576574 3:191101958-191101980 CTGATTCAATGTAATAAACATGG - Intergenic
970846699 4:20547962-20547984 CATTTTGAATGTAATTAATCAGG + Intronic
972168221 4:36312935-36312957 CTGTTTAATTGCAGTAAACCAGG + Intronic
973098169 4:46227691-46227713 ATGGTTGAATGTAATTGACCTGG - Intergenic
976589085 4:86831274-86831296 CTGTTTAAATGAAATCATCCAGG - Intronic
978817513 4:112925677-112925699 CTACTTGAATGGAATAAACTTGG + Intronic
980245413 4:130233414-130233436 CTTTTTGAATGTAAAATATCTGG + Intergenic
980776940 4:137449314-137449336 CTTTTTGAAGGTAGTAAACCTGG + Intergenic
980886085 4:138764267-138764289 CTGATTGATTGATATAAACCTGG + Intergenic
982043568 4:151419266-151419288 CTGTTTGACTGTTTTCAACCTGG + Intronic
982591460 4:157317813-157317835 CAGTTTGATTGTAATTAGCCAGG + Intronic
984179033 4:176458008-176458030 CAGTTTGAATATGATATACCTGG - Intergenic
984857585 4:184208180-184208202 CTGCTTGAATGTAATCTCCCTGG + Intronic
984906786 4:184635516-184635538 CTTGTTGAATGTTATAAACCAGG + Intronic
985450361 4:190058628-190058650 CTGTTTGAATGCAAAAAAAGTGG + Intergenic
987195620 5:15523191-15523213 CTGTTTTACTCTAATAAACTCGG - Intronic
989403880 5:41039037-41039059 CTGTTTAAATGTAAACAGCCAGG + Intronic
990086528 5:51985608-51985630 CTGTTTGAAGGTAAGACAGCAGG - Intergenic
1000948613 5:167452655-167452677 CTGATTGAATGTCATAAAAGAGG - Intronic
1006404178 6:33834451-33834473 CTTATTTAATGTAATAACCCAGG - Intergenic
1006713967 6:36101875-36101897 CTGTTGGACTGTATTAAAACAGG + Intronic
1009882434 6:69585060-69585082 CTGTCTTAATGAAATAATCCAGG + Intergenic
1010002317 6:70959540-70959562 ATGACTGAATGAAATAAACCTGG - Intergenic
1010356621 6:74941758-74941780 CTGTTTGAATTTAAAATACAAGG + Intergenic
1014400248 6:120979876-120979898 TTTTTTAAATGTAATACACCAGG - Intergenic
1018658515 6:166063815-166063837 CATTTTGTATATAATAAACCTGG - Intergenic
1020829744 7:13079692-13079714 CTGTTTTAATGTACTTAACTGGG + Intergenic
1021201622 7:17734184-17734206 ATGTTTTAAGGTAATAAACCTGG + Intergenic
1023772323 7:43569294-43569316 CTTTTTAAATGTAATAAAAATGG + Intergenic
1029967815 7:104758557-104758579 TTATTTGAATGTAATTAACTGGG + Intronic
1030172495 7:106617738-106617760 GTGTTTGAAGTTAATAAAACTGG + Intergenic
1030597451 7:111557045-111557067 CTGTTTGAATGTAAAAGATATGG - Intronic
1030943203 7:115681358-115681380 CTGTTTCAGTGTCATGAACCTGG - Intergenic
1031033302 7:116758833-116758855 CTGTTTAAATGTAATAGAACAGG - Intronic
1031810772 7:126365791-126365813 CTTTTGGATTGTAATAAAACAGG + Intergenic
1031870754 7:127088063-127088085 TTGTTTGACTGTCATAAACATGG - Intronic
1032311869 7:130794929-130794951 TTGTCTGAATCTAATAATCCAGG - Intergenic
1037306642 8:17511725-17511747 CTGTTAGAAGCTAATAAACTGGG + Intronic
1037494617 8:19426664-19426686 CTGTTTTTATATAATAAATCTGG + Intronic
1038826629 8:31009803-31009825 CTGTTTGAAAGGAATGATCCAGG - Intronic
1039320861 8:36429409-36429431 CTTTTTGAAAGTAACAAACATGG - Intergenic
1041941511 8:63393098-63393120 CTGTTCAAAATTAATAAACCTGG - Intergenic
1042983989 8:74563559-74563581 CTATTTGCATGTAATAAATATGG + Intergenic
1043576704 8:81667283-81667305 CTGTTAAAATGTAATAAAACTGG + Intronic
1043786676 8:84410875-84410897 TTGTATGTATGTCATAAACCAGG - Intronic
1044034839 8:87288069-87288091 CTGTTTCTATGTAATAAACATGG - Intronic
1045684599 8:104699584-104699606 CTGTGTGACTGTAATAACTCTGG - Intronic
1048424852 8:134313499-134313521 ATGTTTGAAAATGATAAACCTGG + Intergenic
1050431504 9:5567045-5567067 CTTTTTGAAAGTAATACATCAGG - Intronic
1059121680 9:111645196-111645218 TTGTTTGAATGTAATGAATATGG + Intronic
1186016894 X:5206377-5206399 CTTTTATTATGTAATAAACCTGG + Intergenic
1187773238 X:22726478-22726500 CTATTTGAAAGTAATTATCCTGG + Intergenic
1188045102 X:25416673-25416695 TTTTTTGAATGAAATCAACCAGG - Intergenic
1190398475 X:50008469-50008491 CTGTCTGAATGCAATGCACCTGG + Intronic
1193758198 X:85434723-85434745 CTGTTTGAGTGTTTTAAACAAGG - Intergenic
1197892726 X:131282126-131282148 CTGATTGAAGGTAAGGAACCAGG - Intronic
1198144973 X:133846128-133846150 CTGTTTGAAATTAGTATACCAGG + Intronic
1199517817 X:148697931-148697953 GTATTTGAATGTAAAATACCAGG + Intronic