ID: 945810369

View in Genome Browser
Species Human (GRCh38)
Location 2:214542469-214542491
Sequence AAGCTTCTCCTGCTGCTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 461
Summary {0: 1, 1: 0, 2: 2, 3: 52, 4: 406}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945810368_945810369 14 Left 945810368 2:214542432-214542454 CCTAACACGGAGGTGGGAGCAAA 0: 1
1: 0
2: 0
3: 16
4: 130
Right 945810369 2:214542469-214542491 AAGCTTCTCCTGCTGCTGCCTGG 0: 1
1: 0
2: 2
3: 52
4: 406

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945810369 Original CRISPR AAGCTTCTCCTGCTGCTGCC TGG Intronic
900120918 1:1048313-1048335 GGGCTTCACCTGCAGCTGCCCGG + Exonic
900364895 1:2307292-2307314 CAGGTCTTCCTGCTGCTGCCAGG + Exonic
900574690 1:3377246-3377268 TCCCGTCTCCTGCTGCTGCCAGG - Intronic
900710321 1:4109267-4109289 AGGCTGAGCCTGCTGCTGCCGGG - Intergenic
901438572 1:9264061-9264083 CAGCTGCTCCGGCTGCTGCTGGG - Exonic
901457573 1:9372045-9372067 CAGCTGCTGCTGTTGCTGCCGGG + Intergenic
901529035 1:9842262-9842284 AAGCTGCTGATGCAGCTGCCAGG - Intergenic
901822667 1:11840234-11840256 CACCCTCTCCTGGTGCTGCCTGG + Exonic
902277219 1:15348688-15348710 AAGCTGCCCCCGCTGCTCCCGGG + Intronic
903034111 1:20483978-20484000 CAGCCGCTCCTGCTGCAGCCAGG + Intronic
903369449 1:22825825-22825847 ATGCTTCTCTGGCTCCTGCCAGG - Intronic
904392418 1:30194802-30194824 AGGCTTCCCCTCCTGCTGCATGG - Intergenic
904548579 1:31296629-31296651 CGGCGTCGCCTGCTGCTGCCCGG + Exonic
905264835 1:36744465-36744487 AACTTTCTGCTGCTTCTGCCGGG - Intergenic
905293345 1:36938426-36938448 AACCTTGACCTGCTACTGCCGGG + Intronic
906256534 1:44354997-44355019 CAGCCTCTCCCGCTGCTGACGGG - Exonic
907417764 1:54326329-54326351 CAGCTTCTCCAGCATCTGCCCGG + Intronic
910266561 1:85344401-85344423 AGGATGCTCCTCCTGCTGCCCGG + Intronic
911052406 1:93681814-93681836 GAGCTGCGCCTGCTGCTGGCCGG - Intronic
911247477 1:95534908-95534930 GAGCTGCTCCTGGTGCTACCTGG - Intergenic
913662124 1:121013274-121013296 AAGCTTCTCCTTCTGCACCCTGG - Intergenic
914013498 1:143796459-143796481 AAGCTTCTCCTTCTGCACCCTGG - Intergenic
914164326 1:145164726-145164748 AAGCTTCTCCTTCTGCACCCTGG + Intergenic
914652123 1:149705068-149705090 AAGCTTCTCCTTCTGCACCCTGG - Exonic
914843348 1:151266068-151266090 CAGCTTCTGCTGCTGAGGCCGGG + Exonic
916663825 1:166947727-166947749 CAGCTGCTCCGGCTCCTGCCCGG + Intronic
920178223 1:204116660-204116682 TACCTGCTCCTGCTGCTGCCGGG - Exonic
921415681 1:214883968-214883990 AAGTTTCTCCAGTTTCTGCCAGG + Intergenic
921436393 1:215128402-215128424 GTGCTACTTCTGCTGCTGCCAGG + Intronic
921491966 1:215788283-215788305 TGGCTTCTCCTACTGCAGCCAGG - Intronic
921840321 1:219821322-219821344 TTGCTTCTGGTGCTGCTGCCAGG + Intronic
923004920 1:230040824-230040846 AAGTTTCTCCTGCTGAGGTCAGG + Intergenic
924246176 1:242087248-242087270 AGGCATCTGCTGCTGCTGCTTGG + Exonic
924470943 1:244342081-244342103 AATGATCTCCTGCTGCTGACGGG + Intergenic
1063094884 10:2900446-2900468 AGGATGCTGCTGCTGCTGCCAGG + Intergenic
1063667105 10:8069224-8069246 GAGTTTCACCTGCTGCTCCCCGG - Intronic
1063705913 10:8430680-8430702 AAGGATCTCCTGCTGCTGGGAGG + Intergenic
1064769616 10:18710537-18710559 AAGCTCCTGCTGCGGCTGGCGGG + Intergenic
1065874505 10:29985163-29985185 AAGCTGGTACTGCTGATGCCTGG - Intergenic
1065917291 10:30364657-30364679 GAGCCTCCCCTGCTCCTGCCTGG + Intronic
1065976477 10:30846824-30846846 AAGCACCTGCTCCTGCTGCCTGG + Intronic
1066583059 10:36901495-36901517 CACCTTCTCCTTCTGGTGCCAGG - Intergenic
1067147419 10:43703440-43703462 GAGTGTCTCCAGCTGCTGCCTGG - Intergenic
1067827983 10:49593220-49593242 AAGCTCCCCCTGGTGGTGCCAGG - Intergenic
1068443810 10:57095094-57095116 AAGTGCCTCCTCCTGCTGCCTGG + Intergenic
1068721036 10:60246587-60246609 AAGCATTTGCTGCTGCTTCCTGG - Intronic
1069553717 10:69382815-69382837 ATGCCTGTCCTGCTCCTGCCAGG + Intronic
1069654881 10:70080386-70080408 GAGCCCCTCCTGCTGCAGCCTGG - Intronic
1069658229 10:70106076-70106098 AGGCTGCTACTGCTGATGCCTGG - Intronic
1069669786 10:70192444-70192466 AAGCTGCTCCTACTGCTTCCTGG - Intergenic
1069702763 10:70438743-70438765 TACCTTCTCCCACTGCTGCCAGG + Intronic
1070503200 10:77090591-77090613 ATGCTTCCCCTGCAGCTGCCTGG - Intronic
1070606231 10:77900369-77900391 ACGCTTCTGCTTCTCCTGCCTGG + Intronic
1071274868 10:84044452-84044474 AAGCTTTTCCTCCTGGTTCCTGG + Intergenic
1072033182 10:91540584-91540606 AAGCTTCACCTGCTGATATCTGG - Intergenic
1072290311 10:93959201-93959223 CAGCTTCTGCTGCTGAGGCCGGG - Intergenic
1073423637 10:103443161-103443183 CAGCTTCTCCTGCTCCTCTCTGG - Exonic
1073716590 10:106114900-106114922 ATGTTTTTCCTGCTGGTGCCAGG + Intergenic
1075007712 10:118842507-118842529 AAGCGCCTGCTCCTGCTGCCTGG + Intergenic
1075219997 10:120576517-120576539 CAGCTTCTCCTGTTCCTTCCTGG + Intronic
1075496823 10:122928418-122928440 AAGCTGCTTCTCCTGGTGCCAGG - Intergenic
1075721302 10:124589129-124589151 AACCTGTTCCTGCTGCTGCAAGG + Intronic
1075740661 10:124694120-124694142 CCGCTTCTCCCTCTGCTGCCTGG + Intronic
1076082223 10:127592752-127592774 CTGCTGCTCCTGCTGCTGACAGG + Intergenic
1076232816 10:128835680-128835702 CAGCATCTCCTGCTGCTCACAGG + Intergenic
1076516575 10:131048523-131048545 AAGCATCTCCTACACCTGCCAGG - Intergenic
1076633779 10:131869467-131869489 AAGTTTCTCCTCTTGCTGCTGGG - Intergenic
1076813754 10:132903507-132903529 GAGCTTCACATGCTGCAGCCTGG - Intronic
1077536349 11:3126603-3126625 AGGCTTCTCAGGCCGCTGCCTGG + Intronic
1078155981 11:8800416-8800438 AAGCTTCTCCTGGTTCTACAAGG + Intronic
1078262572 11:9724135-9724157 AAGCTTTTCCTGCTCATGCTAGG + Intronic
1078264933 11:9747998-9748020 AAGCTGCTCCAGCTGCTCCATGG - Exonic
1078937717 11:15966217-15966239 AAGTATTTCCTGCTGCAGCCAGG + Intergenic
1079996886 11:27304757-27304779 AAGTGTCTGCTCCTGCTGCCTGG + Intergenic
1081683728 11:45026962-45026984 AGCCTGCTCCTGCCGCTGCCGGG - Intergenic
1082785309 11:57313359-57313381 CAGCTTCTCCTGGTCCTGACTGG + Exonic
1083118598 11:60489756-60489778 AACTTTCTCTTCCTGCTGCCTGG + Intergenic
1083151259 11:60793222-60793244 AAGCATCTCCTGCCTCTGCTGGG - Intronic
1083899200 11:65635560-65635582 CACCAGCTCCTGCTGCTGCCCGG - Exonic
1084526119 11:69699033-69699055 TAGCTTGCCCAGCTGCTGCCTGG - Exonic
1086200578 11:84196558-84196580 AATTTTCTCCTGCTGCTAACAGG + Intronic
1086685794 11:89731798-89731820 AACCTTCTCCAGTTGCTTCCTGG - Intergenic
1087205065 11:95385940-95385962 ACTCTTCTCCTGCTGGTCCCTGG + Intergenic
1087392056 11:97548441-97548463 AGGCTGCTGCTGCTGCTGCTGGG - Intergenic
1088487530 11:110355184-110355206 AGGCTTTTCCTTCTCCTGCCAGG - Intergenic
1088817883 11:113433811-113433833 AAGCTTCTCCCCCTGCTCCCTGG + Intronic
1089586616 11:119513580-119513602 AAGCCCCTGCTGCTGCTGGCAGG + Intergenic
1090340663 11:126017204-126017226 AACCTTCTCCAGTTGCTTCCTGG + Exonic
1090802039 11:130179069-130179091 CAGCTTCTCCTCCTGGTGACAGG + Intronic
1092746013 12:11673197-11673219 AAGCTGCCCCTTCTGCAGCCAGG - Intronic
1093556398 12:20480083-20480105 AAGCTCTTGCTGCTGCTACCTGG + Intronic
1094503070 12:31037431-31037453 CACCTTCTCCTGCTCCTGCCAGG + Intergenic
1096469002 12:51864609-51864631 CAGCTTCTGCAGCGGCTGCCGGG + Intergenic
1097867895 12:64574657-64574679 AAGCTGCTCCTTCTGGTTCCAGG + Intergenic
1099070262 12:78037251-78037273 CAGCTTCTGCTGATGCTGCTTGG - Intronic
1099888357 12:88559372-88559394 AAGCTGTTACTGCTGCTGACTGG - Intronic
1100770924 12:97922153-97922175 CAGTGTCTCCTACTGCTGCCTGG + Intergenic
1100780715 12:98023343-98023365 CTGGTTCTCCTGCTCCTGCCAGG + Intergenic
1101830510 12:108253110-108253132 ACTCTCCTCCTGCTGCTGCCTGG + Intergenic
1102107217 12:110335776-110335798 AAGCTCCTTCTGCTCCTCCCTGG - Intronic
1102667566 12:114588618-114588640 CAGCTTTACATGCTGCTGCCTGG + Intergenic
1102965032 12:117119135-117119157 AAGCTGCTGCTGCTGCTGGCTGG + Intergenic
1103563394 12:121804062-121804084 CCGCTGCTGCTGCTGCTGCCCGG - Intergenic
1103662027 12:122527735-122527757 AAGCGTTTGATGCTGCTGCCGGG - Intronic
1103950977 12:124550813-124550835 GGGCTTCTCCTGGTGATGCCAGG - Intronic
1104095435 12:125552895-125552917 AAGCTGATCCTGCTGCAGCCAGG - Intronic
1105209167 13:18247749-18247771 AAGGTGCTGCTGCTGCTGCAGGG - Intergenic
1105571141 13:21603998-21604020 AGGCCGCTCCTGCTCCTGCCAGG + Exonic
1105705164 13:22963819-22963841 GAGCCTCGCCTGCTGCTGACGGG + Intergenic
1105851554 13:24340289-24340311 CAGCTCCTCCCGCTGCTACCGGG - Intergenic
1106454197 13:29912222-29912244 CAGCTGCTTCTGCTCCTGCCTGG + Intergenic
1108344045 13:49526864-49526886 AAGCTTTACCAGCTCCTGCCTGG - Intronic
1108636071 13:52335624-52335646 AAGCTGCTCCTGGTTCTGCCTGG - Intergenic
1108651739 13:52487626-52487648 AAGCTGCTCCTGGTTCTGCCTGG + Intergenic
1109525173 13:63566205-63566227 AAGTGTCTGCTACTGCTGCCTGG + Intergenic
1109699127 13:66002462-66002484 AAGCTTCTCCTAATACTGCATGG - Intergenic
1110706218 13:78603466-78603488 CTGCTGCTCCTGCTGCTGCCAGG + Exonic
1111132299 13:83992901-83992923 AATCTTCTCATGCTTCTGTCAGG + Intergenic
1112001217 13:95211553-95211575 GAGCTTCACCTGCTTCAGCCAGG - Intronic
1113906552 13:113822016-113822038 CAGCCTCTCCTGCAGCTGCGCGG + Exonic
1114488550 14:23080429-23080451 TTCCTTCTCCTGCTGCTGTCTGG + Exonic
1114713410 14:24801407-24801429 AAGCTTCTGGTGCTACTGCAGGG + Intergenic
1115899602 14:38129897-38129919 ATTCTGCTCCTGCTGCCGCCCGG + Intergenic
1116997022 14:51335125-51335147 AAGCTTCTCCTGATTATGCCAGG - Intergenic
1117618471 14:57559257-57559279 ATGCTTCTCCTCCTGCTTCTGGG + Intergenic
1117930795 14:60838793-60838815 AAGCGCCTGCTCCTGCTGCCTGG + Intronic
1118522238 14:66597555-66597577 AAGAGTCTGCTCCTGCTGCCTGG - Intronic
1119165145 14:72486297-72486319 AAGCTTCTACTGCTGAAGCTGGG + Intronic
1119747324 14:77053485-77053507 TAGCACCACCTGCTGCTGCCGGG + Intergenic
1120729457 14:87986237-87986259 AAGCTTCTACTGCTTCTTCCTGG + Intronic
1121060010 14:90898351-90898373 GTGCTACTGCTGCTGCTGCCTGG + Intronic
1122387197 14:101357186-101357208 GGGCTTCTCCTGCAGCTTCCTGG - Intergenic
1123020015 14:105393309-105393331 CAGCATGTTCTGCTGCTGCCTGG - Exonic
1123052967 14:105556041-105556063 AAGCATCTTCAGCTGCAGCCAGG - Intergenic
1123077550 14:105676431-105676453 AAGCATCTTCAGCTGCAGCCAGG - Intergenic
1124800998 15:32832746-32832768 AAGCTCTTCCTTCTGCTGGCTGG - Intronic
1124823321 15:33068941-33068963 AGGCGTGTCCTGCTGCTGCCAGG - Intronic
1124931755 15:34126765-34126787 AACATTCTCCTGCTGCAGTCAGG - Intergenic
1125277058 15:38004335-38004357 AAGTTTCTCCCTGTGCTGCCTGG + Intergenic
1128139393 15:65287752-65287774 AAACTTCTCCTTCTGCATCCAGG + Intronic
1128561863 15:68673965-68673987 AAGCTCCTACTGCTGCTTCTGGG - Intronic
1129319082 15:74763853-74763875 ATGCTTCTGCTCCTGCTGGCGGG + Intergenic
1129690403 15:77710100-77710122 TGGCTTCTCCTGCTCCTTCCAGG + Intronic
1130814043 15:87411768-87411790 AGTTTTCTGCTGCTGCTGCCTGG - Intergenic
1131228763 15:90645843-90645865 TAGCTTCCCTTGCTTCTGCCCGG + Intergenic
1132869044 16:2107469-2107491 TGGCTGCTCCTGCTGCTGTCAGG - Intronic
1132978938 16:2725007-2725029 AAGCGCCTGCTCCTGCTGCCTGG + Intergenic
1133014528 16:2933352-2933374 GGCCTTCTCCTGCTGCCGCCGGG - Exonic
1134006363 16:10821139-10821161 AAGCTGATGCTGCTGCTCCCTGG + Intergenic
1134212468 16:12289246-12289268 ACCCTTCTCCTCCTGCTGCATGG - Intronic
1134550098 16:15134866-15134888 TGGCTGCTCCTGCTGCTGTCAGG - Intronic
1134718371 16:16368129-16368151 TGGCTGCTCCTGCTGCTGTCAGG + Intergenic
1134956381 16:18384030-18384052 TGGCTGCTCCTGCTGCTGTCAGG - Intergenic
1135920629 16:26645910-26645932 CCCCTTCTCCCGCTGCTGCCTGG - Intergenic
1136172707 16:28498190-28498212 GGGCTCCTCCTGCTGCTCCCAGG - Exonic
1137648961 16:50102303-50102325 AAGCTTCTCCTGCTACCACAAGG - Exonic
1138519359 16:57562266-57562288 AAGCAGCTCCTGCTGCCCCCAGG - Intronic
1138874838 16:60936782-60936804 CAGCCTCTCCTGCTGATACCCGG + Intergenic
1139060242 16:63241614-63241636 AACCTTCTCCAGGTGCTGTCAGG - Intergenic
1139268220 16:65659252-65659274 AAGCCTTTCCTGCTGGTTCCAGG - Intergenic
1140456689 16:75109863-75109885 CAGCACCTCCTGCTTCTGCCTGG + Exonic
1141350812 16:83293965-83293987 AATCTTCTCCTCCTGCTCACAGG - Intronic
1141592589 16:85078466-85078488 GGGCGTCTCCTGCTGCTGCCTGG - Intronic
1141776033 16:86122954-86122976 AAGCTCCTCCTCCTGCGGCACGG + Intergenic
1141789923 16:86227407-86227429 AGGCTGCTGCTGCTGCTGCCTGG + Intergenic
1142114249 16:88348144-88348166 TCGCTTCTGCTGCTGCTGTCAGG - Intergenic
1142123827 16:88400422-88400444 GAGCTCCTGCTGCTGCTCCCAGG + Intergenic
1142309328 16:89303144-89303166 AAGCATCTGCTTCTGCTTCCTGG - Intronic
1142767628 17:2074440-2074462 ATGCTCCTCCTCCTGCTCCCAGG - Intronic
1142862250 17:2769775-2769797 AAGCTTTTCCATCTACTGCCAGG + Intergenic
1143730533 17:8880387-8880409 ATCCTTCTCCTTCTACTGCCAGG + Exonic
1143848459 17:9791241-9791263 ATGCTCCCCCTGCTGCTGCTGGG - Exonic
1144045784 17:11453305-11453327 AAGCTGCTGTTGCTGCTGCCTGG - Intronic
1144993592 17:19250885-19250907 AAGCCTCTTCTGCCTCTGCCTGG + Intronic
1145002816 17:19317435-19317457 TAGCACCACCTGCTGCTGCCAGG - Intronic
1145276627 17:21435265-21435287 CAGCTTCTCCTTCCACTGCCAGG - Intergenic
1145314468 17:21721153-21721175 CAGCTTCTCCTTCCACTGCCAGG - Intergenic
1145389252 17:22443144-22443166 GAGCAGCTCCTGCTGATGCCGGG - Intergenic
1145712923 17:26993130-26993152 CAGCTTCTCCTTCCACTGCCAGG - Intergenic
1146260372 17:31416669-31416691 CCCCTTCTCCTGCTGCTGCAGGG - Intronic
1146558362 17:33847030-33847052 AGACTCCTCCTGCTGCTGCTAGG - Intronic
1146591779 17:34133612-34133634 ATGTTTCACCTGCTGGTGCCAGG - Intronic
1147596906 17:41723469-41723491 AGGCCCCTCCTTCTGCTGCCTGG - Exonic
1147948442 17:44093441-44093463 CAGCATCTCCTGCTGCTGCTTGG + Exonic
1148206130 17:45781416-45781438 AAGCTGATTCTGCTGCTGGCTGG + Intergenic
1148330570 17:46811603-46811625 CACCCTGTCCTGCTGCTGCCTGG - Intronic
1148966685 17:51441618-51441640 GAGCTTCTACTTCTGCTGCTGGG + Intergenic
1149884771 17:60328767-60328789 CAGCTTCTCTGGCTGCTCCCGGG - Intronic
1149910586 17:60563442-60563464 ATGCTTATCCTGCTGCTCCAGGG - Intergenic
1151352903 17:73542284-73542306 AAGCTGCCCCTGCTGCTGTCAGG - Intronic
1151878966 17:76883410-76883432 AATATTCTCCTGCTTCGGCCAGG + Intronic
1152363348 17:79842331-79842353 TAGTTTCTCCTGCGGCTCCCTGG - Intergenic
1152934892 17:83130672-83130694 CAGCCTCGCCTGCTGCTGGCGGG - Intergenic
1153498298 18:5722185-5722207 AAGCTTCTTCTGGAGCTCCCAGG - Intergenic
1153968479 18:10203284-10203306 AAACTTCTACAGCAGCTGCCAGG + Intergenic
1155151998 18:23130380-23130402 AAGCTTCTCATGTTCCTGCCTGG + Intergenic
1156081960 18:33346307-33346329 AAGCTTCTTCAGCGTCTGCCCGG + Exonic
1156458665 18:37308935-37308957 AGGCTCATCCTGCTGCTGGCTGG + Intronic
1157484226 18:48075611-48075633 AGGCTTCCCCTGCAGCTGCAGGG + Intronic
1158566927 18:58561840-58561862 AAACTTCACCTGCAGCTGCAGGG + Intronic
1159494195 18:69179630-69179652 AAGCTTCTCATGTTGCTCCTTGG + Intergenic
1160032998 18:75278655-75278677 GAGCCTGGCCTGCTGCTGCCTGG + Intronic
1161173120 19:2823250-2823272 GAGGTACTCCTGCTGCTCCCAGG + Intronic
1161514466 19:4689026-4689048 AAGCTCCACCCGCTGCTGCAAGG + Intronic
1161585699 19:5104185-5104207 CTGCTCGTCCTGCTGCTGCCGGG - Intronic
1161769342 19:6222898-6222920 AATCTTAGCCTGCAGCTGCCGGG - Intronic
1161775621 19:6260572-6260594 AAGGGGCTCCGGCTGCTGCCTGG - Intronic
1161797255 19:6394167-6394189 GTGCTTCTCCTGCTCCTTCCTGG - Intergenic
1162025316 19:7890492-7890514 GAGATTCTCCTGCTTCAGCCGGG + Intronic
1162927567 19:13937972-13937994 CTGCTGCTCCTGCTGTTGCCGGG - Exonic
1163202654 19:15779835-15779857 TGGCTGCTCCTGCTGCTGGCTGG - Intergenic
1165111577 19:33505487-33505509 GAGCTCCTTCGGCTGCTGCCCGG - Intronic
1165148474 19:33747633-33747655 AGCCCTCTCCTGCTCCTGCCGGG - Intronic
1165373033 19:35421771-35421793 AAGCTGCTGGTGCTTCTGCCTGG + Intergenic
1165773625 19:38392149-38392171 CAGCTTCTCCTCCCGCTCCCAGG - Intronic
1165888802 19:39098625-39098647 ACGCTTCGCAAGCTGCTGCCAGG + Exonic
1166428503 19:42701231-42701253 ATGCTTTTACTGCTGCAGCCTGG + Intronic
1166897389 19:46032555-46032577 AAGTGCCTCCTCCTGCTGCCTGG + Intergenic
1167000312 19:46741875-46741897 AAGCTTCAGCAGCTGCTGGCAGG + Intronic
1167118020 19:47499370-47499392 AAGCCTTTCCTTCTGCTCCCTGG - Intronic
1167311512 19:48740178-48740200 CAGCTTCGCCAGCTGCTTCCTGG + Exonic
1167313312 19:48750097-48750119 AAGCTTCTCCAGAAGATGCCAGG + Exonic
1168243674 19:55099335-55099357 AACCTGCTCCTGGTGCTGGCAGG + Intronic
1168290686 19:55355618-55355640 AAGCTTCTCTCCCTCCTGCCTGG + Intronic
1168671661 19:58245402-58245424 GCGATTCTCCTGCTGCAGCCAGG + Intronic
925048107 2:789826-789848 AAGTTCCTGCTCCTGCTGCCTGG + Intergenic
925364462 2:3302520-3302542 CTGCTTCTCCTTCTGCTGCTGGG + Intronic
926092486 2:10059872-10059894 GAGCTCCTGCTCCTGCTGCCTGG + Intronic
927651890 2:24918337-24918359 GAGCTCCTCCTGCTGCTGCTGGG + Exonic
927685624 2:25168651-25168673 GAGCTGCTCCTTGTGCTGCCGGG - Exonic
927694399 2:25230420-25230442 CAGCTTCCCCTGCAGGTGCCAGG - Exonic
927970835 2:27305681-27305703 CAGCTTCTCCTCTTGCTCCCGGG - Exonic
929894131 2:45943797-45943819 CAGCCTCCCCTGCTGCTGTCTGG - Intronic
929910243 2:46083612-46083634 AGGCTTATCCTGGTGCTGCAGGG + Intronic
931497525 2:62825850-62825872 AATCTTCTCTTGTTTCTGCCTGG + Intronic
932043064 2:68319825-68319847 AAACCTCTCCTCCTCCTGCCCGG - Exonic
932794351 2:74681719-74681741 AGGCTTCTCCTGCTGAGTCCTGG + Exonic
934613771 2:95758883-95758905 AGGCTTCTGCTGCTGCTCCCAGG + Intergenic
934616506 2:95774641-95774663 AAACCACTCCTCCTGCTGCCTGG - Intergenic
934644387 2:96049919-96049941 AAACCACTCCTCCTGCTGCCTGG + Intergenic
934647133 2:96065531-96065553 AGGCTTCTGCTGCTGCTCCCAGG - Intergenic
934837803 2:97606009-97606031 AAACCACTCCTCCTGCTGCCTGG + Intergenic
934840505 2:97621352-97621374 AGGCTTCTGCTGCTGCTCCCAGG - Intergenic
935258680 2:101335693-101335715 CAGAGTCTCCTGCTGTTGCCAGG - Intergenic
935679038 2:105620274-105620296 AGGTCTCTTCTGCTGCTGCCAGG + Intergenic
936348405 2:111692493-111692515 AAGCTTCTCCTGCTGGAGGGTGG + Intergenic
936522613 2:113220574-113220596 TAACTGCTCCTTCTGCTGCCTGG + Intronic
937133049 2:119527651-119527673 CAGTTTCTCCTTCTTCTGCCAGG - Intergenic
937229433 2:120389038-120389060 TAGCTTCTACTCCCGCTGCCTGG + Intergenic
938140575 2:128791536-128791558 AGGATATTCCTGCTGCTGCCTGG + Intergenic
938374958 2:130798970-130798992 AAGCATCTCCAGCCTCTGCCAGG + Intergenic
939109258 2:137987893-137987915 AAGATTCTCATGCTGCTTCTGGG + Intronic
942543412 2:177038063-177038085 AAGCCTTTCCTGCTGCTCCATGG - Intergenic
942950240 2:181713184-181713206 CATTTTCTCTTGCTGCTGCCAGG + Intergenic
943180303 2:184531336-184531358 AAGTGTCTGCTCCTGCTGCCTGG - Intergenic
944695185 2:202194282-202194304 AAACTCCTCTTGCTGTTGCCGGG - Exonic
944901905 2:204223868-204223890 AAGTGCCTCCTGCCGCTGCCTGG - Intergenic
945223164 2:207504942-207504964 GGGCTTCTCCTCCTGCTGTCAGG - Intergenic
945810369 2:214542469-214542491 AAGCTTCTCCTGCTGCTGCCTGG + Intronic
946047477 2:216833294-216833316 CAGCAGCTACTGCTGCTGCCAGG + Intergenic
947636823 2:231684495-231684517 CACGTGCTCCTGCTGCTGCCGGG + Intergenic
947849496 2:233274020-233274042 ATTCTTCTTCTGATGCTGCCAGG + Intronic
948223406 2:236290849-236290871 ACCCTTCCCCTGCTTCTGCCGGG - Intergenic
948353557 2:237360014-237360036 CAGTTTCTCCAGATGCTGCCAGG - Intronic
948434448 2:237943762-237943784 AAGTGTCTGCTCCTGCTGCCTGG + Intergenic
948667244 2:239544380-239544402 CGCCTCCTCCTGCTGCTGCCTGG + Intergenic
948929962 2:241125869-241125891 ACGCTTCTCCTGCTCCCGACGGG + Intronic
949007215 2:241656460-241656482 ACACTTCTCTTGCTGCTGCCTGG + Intronic
1169153235 20:3306926-3306948 AAACTGCTCCTGCTGCTGAGTGG + Intronic
1169783201 20:9331073-9331095 AAGATTCTCCAGCAGTTGCCTGG + Intronic
1171536665 20:25898742-25898764 AGGCACCTCCTCCTGCTGCCTGG + Intergenic
1171804443 20:29662415-29662437 AGGCACCTCCTCCTGCTGCCTGG - Intergenic
1171839603 20:30194007-30194029 AGGCTCCTCCTCCTGCTGCCTGG + Intergenic
1172955499 20:38755110-38755132 CAGCTTCTCCTCCCGCCGCCGGG - Exonic
1173645800 20:44632412-44632434 AAGCTCCTCTGGCTGCTGCGTGG + Intronic
1174789253 20:53462523-53462545 AAGCTGCTCCTTCTGAAGCCAGG - Intronic
1174955786 20:55096626-55096648 ATTATGCTCCTGCTGCTGCCTGG - Intergenic
1175113925 20:56668387-56668409 CAGCTTCTGGTGCTTCTGCCAGG - Intergenic
1175416448 20:58804423-58804445 AGGCTTCTGCCTCTGCTGCCTGG + Intergenic
1175627766 20:60503140-60503162 AGGCTTCTGCAGCTGCTGCTGGG + Intergenic
1176028607 20:62999263-62999285 AAGCGTCTTCACCTGCTGCCGGG - Intergenic
1177875484 21:26626331-26626353 AAGCACCTACTCCTGCTGCCTGG - Intergenic
1178623170 21:34194013-34194035 CAGCTGCTCCTGATGTTGCCTGG + Intergenic
1178626001 21:34219402-34219424 AAGCTTCCTTTACTGCTGCCTGG + Intergenic
1179556659 21:42182893-42182915 AAGCTGCTGCTGCCGCTGGCTGG - Intergenic
1180054074 21:45348098-45348120 GGGCTGCTGCTGCTGCTGCCTGG - Intergenic
1180061300 21:45386332-45386354 AAACTGCTCCTGCTGCTGGGGGG - Intergenic
1180985753 22:19903164-19903186 CAGCCTCTCCTGCAGCTGCCAGG - Intronic
1181527826 22:23500273-23500295 CAGCTTGTCCTGCTAGTGCCTGG - Intergenic
1182123132 22:27799614-27799636 ATGCTGCTGCTGCTGCTGCTGGG + Exonic
1182425708 22:30271013-30271035 AAGCTTTTCCTGCTGGTGAGAGG - Intergenic
1182528518 22:30937342-30937364 AGGCCTCTCCAGCTGCAGCCAGG - Intronic
1183455793 22:37922370-37922392 CAGGTTCTCCTGCTGCAGACTGG - Exonic
1183665774 22:39244958-39244980 CAACTTCTCCTCCTGCAGCCGGG - Intergenic
1183784414 22:40021321-40021343 AACCTCCTCCTGCTCCTGACAGG + Exonic
1184442786 22:44528558-44528580 CAGTTGCTTCTGCTGCTGCCTGG - Intergenic
1184659509 22:45959452-45959474 CAGCTTGTCCTGTTGCTGGCGGG - Intronic
1184994412 22:48194927-48194949 AAGCTTCTCTTCCCTCTGCCTGG + Intergenic
1185053027 22:48563565-48563587 AAGGGGCTCTTGCTGCTGCCGGG + Intronic
1185116172 22:48939620-48939642 GAGCTACTCCTGCTGGGGCCAGG - Intergenic
1185275458 22:49948677-49948699 AGTCAGCTCCTGCTGCTGCCAGG + Intergenic
949164312 3:919969-919991 GAACTTCTCCTGCAGCTCCCTGG + Intergenic
949226249 3:1699532-1699554 AAGTGTCTGCTGCCGCTGCCTGG + Intergenic
949848822 3:8400227-8400249 AAGCTTCTTCTTCTGTTTCCGGG - Intergenic
954073321 3:48158911-48158933 AAGCTTGGGCTGCTGCTGGCTGG + Exonic
954885463 3:53869629-53869651 AAGGATCTCCTTCTGCTCCCTGG - Intronic
955916491 3:63912681-63912703 CTGCTGCTGCTGCTGCTGCCGGG - Exonic
957534125 3:81479018-81479040 AAGCTTCTCCTTCAGCTGCTTGG - Intergenic
960438548 3:117657774-117657796 AAGCATCTCCTGCTGTTTACAGG + Intergenic
960705390 3:120476193-120476215 TGGCCTCTCTTGCTGCTGCCTGG - Intergenic
961864805 3:129945825-129945847 AAGCTTCTCCTGGGGTTGCAGGG + Intergenic
962979023 3:140471036-140471058 AGGCATCTCCTGGAGCTGCCTGG - Intronic
963935058 3:151043785-151043807 CTTCTACTCCTGCTGCTGCCAGG + Intergenic
964042796 3:152283477-152283499 AAGCTTCTGCTTCAGTTGCCAGG - Intronic
964384627 3:156134324-156134346 AAGCTTTTCTTGCTGCTGTCAGG + Intronic
964388784 3:156176786-156176808 TGGCGTCGCCTGCTGCTGCCCGG + Intronic
964913950 3:161816837-161816859 AAACTATTTCTGCTGCTGCCTGG - Intergenic
965925366 3:173972223-173972245 AAGCTTCTCCCGCTGCAGGCAGG - Intronic
966473328 3:180317125-180317147 AAGCAGCTCCAGCTGCTTCCTGG + Intergenic
966516783 3:180828804-180828826 GGCCTTCTCCTGCTGCCGCCGGG + Intronic
966914615 3:184577907-184577929 AAGCTGCTCCTGGAGCTGCTGGG - Exonic
967261465 3:187647043-187647065 AGGCTTCTCCTCCTGCTGCTAGG - Intergenic
967627538 3:191703384-191703406 CAGCTGCTGCTGCTGCTGCCAGG + Intergenic
968083653 3:195864061-195864083 CCGCTGCTCCTGCTGCTCCCGGG - Exonic
968670958 4:1851310-1851332 AAGCTGCACTTGCTGCTCCCTGG - Intronic
969219958 4:5752978-5753000 CAGCTCCTCCTTCTGCCGCCCGG - Exonic
970674484 4:18433035-18433057 GAGCTTCTCCTGCTGCAGACAGG + Intergenic
971197448 4:24482997-24483019 AGGCTGCTGCTGCTGCTGGCTGG + Intergenic
971477129 4:27082908-27082930 AAGTTTTTTCTGCTTCTGCCTGG - Intergenic
971478412 4:27093054-27093076 AAGCAGCCCCTGCTGCTGCTTGG - Intergenic
971713760 4:30150022-30150044 GAGCTGCTCTTGCTTCTGCCTGG + Intergenic
974536122 4:63178212-63178234 AAGGTTGTCCTGCTGCTTCAGGG + Intergenic
975399834 4:73922231-73922253 AAGTCTCTTCTGCTTCTGCCTGG - Intergenic
975594298 4:76033306-76033328 TTGTTTCTCCTGCTGCTGCCAGG + Intronic
975687165 4:76928559-76928581 AAGCATCTCTTGGTGGTGCCAGG + Intergenic
976555122 4:86441825-86441847 AAGCCTCTCCTGCTGCTTCCTGG + Intronic
977259810 4:94784960-94784982 AAGCTTCACCAGCAGCTGCTTGG + Intronic
977294209 4:95193197-95193219 ATGCTTCTGCTGCTGATGCCTGG - Intronic
979558732 4:122078856-122078878 GAGTTTTTCCTACTGCTGCCAGG + Intergenic
979600019 4:122577205-122577227 AAGCTGCTCCTGCAGGTGCCAGG - Intergenic
981513688 4:145584751-145584773 GAGGTTCTTCTCCTGCTGCCTGG + Intergenic
981908579 4:149952481-149952503 AAGGTCCTGCTGCTTCTGCCTGG + Intergenic
982100158 4:151959536-151959558 CTGCTGCTGCTGCTGCTGCCTGG + Intergenic
982682197 4:158444835-158444857 CAGCAACTCCTGCTGCTGGCAGG - Intronic
982918954 4:161250094-161250116 AAGTGTCTGCTCCTGCTGCCTGG - Intergenic
983069791 4:163254456-163254478 AAGTGTCTGCTCCTGCTGCCTGG - Intergenic
983491820 4:168398217-168398239 AAGTGTCTGCTCCTGCTGCCTGG + Intronic
983786466 4:171736865-171736887 GGATTTCTCCTGCTGCTGCCTGG + Intergenic
985318098 4:188680008-188680030 CAGCTTCTCCAGCTGCTGCGGGG - Intergenic
985495673 5:203680-203702 AACCTGCTCCCGCTCCTGCCTGG + Exonic
985832033 5:2240880-2240902 AATCCCCTCCTGCTTCTGCCGGG + Intergenic
986011918 5:3724556-3724578 ATTTTTCTCCTGCTGGTGCCAGG - Intergenic
986341746 5:6794853-6794875 AAGCTTTTCCTGCTTTTGCTTGG + Intergenic
986653054 5:9983555-9983577 AAGGTTAGCCTGCTGCTGCATGG - Intergenic
986776913 5:11024124-11024146 AAGGTTCCCTTCCTGCTGCCAGG - Intronic
989243296 5:39224422-39224444 GAGCTTCATCTGCTGCTGTCTGG - Intronic
990571373 5:57082395-57082417 AATCTTCTCATGCTTCTGGCAGG - Intergenic
993080373 5:83289869-83289891 GAGCTTCTCCTGATTCTGCCAGG - Intronic
995551678 5:113287928-113287950 AAGCTTCTCTCCCTGCTTCCAGG + Intronic
995745011 5:115393960-115393982 AAGTGCCTCCTTCTGCTGCCTGG - Intergenic
996479234 5:123955123-123955145 AAGCTTCCTCTGCTGCTCTCAGG - Intergenic
996605257 5:125313701-125313723 CAGCTGCTCCAGCTCCTGCCTGG - Intergenic
996913076 5:128678214-128678236 AAACCTCTCCTGATGCTCCCAGG + Intronic
997078571 5:130710840-130710862 TAGCTGCTCCTGCTGCTACTTGG - Intergenic
997349335 5:133219235-133219257 AACCTTCTCCAGCTCCTGCTTGG + Intronic
997658077 5:135569911-135569933 GAGCTGTTCCTGCTCCTGCCAGG - Intergenic
997884200 5:137615797-137615819 CAGCTTCTCCTACTGCTCCAGGG - Intergenic
998188384 5:140000706-140000728 CACCTCCTCCTGCTGCAGCCAGG + Intronic
998747216 5:145274442-145274464 AAACTTCTCCAGCTGCCGCGGGG - Intergenic
999104126 5:149054458-149054480 ATGCTCCTCCTGCTGCTCCCAGG + Intronic
1001102164 5:168823361-168823383 GTGCCTCCCCTGCTGCTGCCTGG - Intronic
1001222716 5:169916148-169916170 AAGCAGCTTCTGCTTCTGCCCGG - Intronic
1001482648 5:172099214-172099236 CTGCTGCTCCTGCTGCTGACGGG - Intronic
1002551403 5:179995494-179995516 CTGCTTCTGCTGCTGCTGCTAGG + Intronic
1002927154 6:1611223-1611245 AGGCTGCTGCTGCTGCTGTCGGG - Exonic
1002960535 6:1910609-1910631 AGCCTCTTCCTGCTGCTGCCTGG - Intronic
1004265260 6:14143862-14143884 CTGCTGCTGCTGCTGCTGCCAGG - Intergenic
1004493894 6:16145181-16145203 TAGCTTCTCCTGCAGCACCCGGG - Exonic
1005944687 6:30586676-30586698 ACGCTACTCCTGCTGCTGACTGG + Exonic
1006421495 6:33936826-33936848 CAGCTTCCCTTGCTGCTGCTAGG + Intergenic
1007827766 6:44613991-44614013 AAGATTTTCCTGCTGCTGGGTGG + Intergenic
1007919826 6:45596660-45596682 AATCATCTCCAGCTGCTGCCGGG + Intronic
1008127695 6:47687560-47687582 GAGCTGCTGCTACTGCTGCCTGG + Intronic
1009242192 6:61196856-61196878 AAGCTACTGCTGCAACTGCCTGG + Intergenic
1011530207 6:88312794-88312816 AAGTGCCTCCTCCTGCTGCCTGG - Intergenic
1012909335 6:105101788-105101810 CCTTTTCTCCTGCTGCTGCCTGG - Intronic
1015200525 6:130574900-130574922 ACCCTTCTCCTTCTTCTGCCTGG + Intergenic
1015384842 6:132610243-132610265 AAGCTTCTCTTGAGGCTGCTAGG - Intergenic
1016026443 6:139292198-139292220 AAGCTTCCCTAGCTGTTGCCAGG + Intergenic
1016714134 6:147204215-147204237 CTGCTGCTGCTGCTGCTGCCGGG + Intergenic
1017012579 6:150072487-150072509 CAGCCTCTGCTCCTGCTGCCAGG + Intergenic
1017118996 6:151006229-151006251 AAGCTTGTCCTGATGCTTTCGGG - Intronic
1017408859 6:154148404-154148426 AAGCTACTGCTGCTGCTGGATGG - Intronic
1017652463 6:156595966-156595988 GGCCTCCTCCTGCTGCTGCCGGG - Intergenic
1018045540 6:159962849-159962871 GAGATTCTCCTGCTGTTCCCAGG - Intergenic
1018556402 6:165055526-165055548 AATCTTCTTATGCTGCTGGCAGG + Intergenic
1019151136 6:170006722-170006744 AAGCAGTTCCTGCAGCTGCCTGG - Intergenic
1019283113 7:210460-210482 CAGCTTCCCCTGGTGCTGCGTGG + Intronic
1019588694 7:1818158-1818180 CTGATTCTCCTGCAGCTGCCGGG + Intronic
1020213419 7:6171620-6171642 CACCATCTCCTGCTGCTGCCAGG + Intronic
1020438355 7:8189803-8189825 AGGCTCCTGCAGCTGCTGCCTGG - Intronic
1021621232 7:22552750-22552772 AAGTTTCCCCTGCTGCATCCAGG - Intronic
1023183953 7:37514239-37514261 ATGCTGCTTCTGCTGCTGCTGGG + Intergenic
1023418186 7:39950973-39950995 ACGCTTCTCCGCCTCCTGCCCGG - Exonic
1023806231 7:43874980-43875002 ATGCTCCACCTGCTGCTCCCGGG - Intronic
1023982430 7:45077864-45077886 CAGCCTCTCCTGATGCTTCCAGG - Intergenic
1028384388 7:90238256-90238278 TGGCTTCCCCAGCTGCTGCCTGG + Intergenic
1030321350 7:108171605-108171627 AAGCTTTTCCTGATCCTGCTTGG + Intronic
1031452333 7:121937384-121937406 AACCTGCTCCTCCTGGTGCCAGG - Intronic
1031497525 7:122469162-122469184 AAGGAGCTACTGCTGCTGCCTGG - Intronic
1034088095 7:148338619-148338641 AGGCTTCAGCTGCTACTGCCTGG + Intronic
1035165489 7:156987115-156987137 AAGCTCCTCCTGCTGGAGCAGGG + Intergenic
1035200897 7:157265155-157265177 AAGCCCCTGCTCCTGCTGCCAGG + Intronic
1035620238 8:1031075-1031097 AAGCTTCTCCCGCAGACGCCAGG - Intergenic
1035662769 8:1360168-1360190 TAGCGACTCCTGCTGCTTCCCGG + Intergenic
1036579687 8:10062225-10062247 CAGCTGCTGCTGCTGCTGCATGG - Intronic
1036600240 8:10254080-10254102 AAGCTTCTCCCGCAGCTGAGGGG - Intronic
1037992583 8:23331262-23331284 CAGCCTCTGCTGCTCCTGCCTGG + Intronic
1039800655 8:40951844-40951866 CAGCATCTTCTGCTGCTGCCTGG - Intergenic
1040883303 8:52231833-52231855 CAGGTTCTCCTGCTGCTCCATGG + Intronic
1044525042 8:93241978-93242000 AAGTTCCTGCTCCTGCTGCCAGG - Intergenic
1045472637 8:102526037-102526059 GTGATTCTCCTGCTGCAGCCTGG + Intergenic
1045733549 8:105268320-105268342 CAGATTCTCTTTCTGCTGCCAGG + Intronic
1047371098 8:124256731-124256753 GAGCTTCTGCTGCTGTTGCTAGG - Intergenic
1047408512 8:124605217-124605239 AAGATGCTCCTGCTGAAGCCAGG + Intronic
1048448522 8:134511127-134511149 CAGCTTCTCTGGCTCCTGCCTGG - Intronic
1049106388 8:140616203-140616225 AAGTTTGTGCTGGTGCTGCCTGG - Intronic
1049655372 8:143794746-143794768 GAGCTTCACCTGCTGCTGCTGGG - Intronic
1049719768 8:144110408-144110430 CACCTTCTCCTGCTGCTACCCGG + Exonic
1049782730 8:144436202-144436224 GAGCTGCTGCTGCTGCTGGCTGG + Exonic
1050182251 9:2934097-2934119 AAGTTCCTGCTGCTGCTGCCTGG + Intergenic
1050536353 9:6634123-6634145 AAGATTCTCCCGCCTCTGCCGGG - Intronic
1053444988 9:38145976-38145998 AAGTTACTGCTCCTGCTGCCTGG + Intergenic
1055326684 9:75137554-75137576 CAGCTTTGCATGCTGCTGCCTGG + Exonic
1058090944 9:100804684-100804706 AAACTTTTCCTGCTGTGGCCAGG + Intergenic
1059389959 9:113992812-113992834 CAGCTTCTCCTGCTGGAGTCAGG + Intronic
1059517214 9:114907202-114907224 AAACTGCCCCTGCTTCTGCCCGG - Intronic
1060152936 9:121300129-121300151 AAGTATCTCTTGCTGCTTCCGGG + Intronic
1060993346 9:127861591-127861613 AAGCTTCTTCAGCACCTGCCAGG - Intergenic
1061146766 9:128804223-128804245 TAGCTGCTGCTGCTGCTGCCCGG + Intronic
1061256416 9:129456196-129456218 CAGCTTGTCCTGCTAGTGCCTGG + Intergenic
1062011910 9:134271938-134271960 AGGCGGTTCCTGCTGCTGCCTGG + Intergenic
1062507917 9:136887227-136887249 AAACATCCCCTGCTACTGCCAGG - Intronic
1186487675 X:9946189-9946211 GGGCTTCTCCTCCTCCTGCCAGG + Intronic
1188328479 X:28837594-28837616 AAGCCTCTCCTGCTTCTCCTGGG - Intronic
1188501709 X:30834048-30834070 AACCATCTGCAGCTGCTGCCTGG + Exonic
1189023833 X:37370769-37370791 AAGTATCTGCTCCTGCTGCCTGG + Intronic
1190677071 X:52791531-52791553 CAGCTCCTCCTGCACCTGCCAGG - Intergenic
1192034130 X:67545397-67545419 CTGCTGCTGCTGCTGCTGCCTGG - Exonic
1192232825 X:69277832-69277854 AAGTTGCTGCTGCTGCTGCCTGG - Intergenic
1192413225 X:70953630-70953652 TAGCTTCTCCTGCTGGAGCTGGG - Intergenic
1194183091 X:90737550-90737572 ACTATTCTCCTGCTGGTGCCAGG + Intergenic
1194945909 X:100066874-100066896 AAGCTTCACCTGCTTATTCCAGG - Intergenic
1196099429 X:111832096-111832118 CAGCTTCACCTGCTGATGCTGGG + Intronic
1196811080 X:119629494-119629516 AAACTTCTCGTGCAGCTGGCAGG + Exonic
1197033369 X:121845971-121845993 AAGCTTCTGCTGCTGCTGTCTGG - Intergenic
1197035562 X:121870085-121870107 AAGGGCCTCCTCCTGCTGCCTGG + Intergenic
1198645961 X:138806847-138806869 AAGTTTCTCCTCCAGCTGTCTGG - Intronic
1199861154 X:151801397-151801419 AAGCACCTGCTCCTGCTGCCTGG - Intergenic
1201591924 Y:15625102-15625124 ACGCTGCTCCCTCTGCTGCCTGG - Intergenic
1202150017 Y:21836132-21836154 CAGCATCTCCTGAGGCTGCCTGG + Intergenic