ID: 945811826

View in Genome Browser
Species Human (GRCh38)
Location 2:214558266-214558288
Sequence ATGTCCTGCAAGAAGAAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 419
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 382}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945811826_945811833 27 Left 945811826 2:214558266-214558288 CCCTCTTTCTTCTTGCAGGACAT 0: 1
1: 0
2: 3
3: 33
4: 382
Right 945811833 2:214558316-214558338 AATTACCATTCATTTTCCAGGGG 0: 1
1: 0
2: 2
3: 22
4: 281
945811826_945811831 25 Left 945811826 2:214558266-214558288 CCCTCTTTCTTCTTGCAGGACAT 0: 1
1: 0
2: 3
3: 33
4: 382
Right 945811831 2:214558314-214558336 TCAATTACCATTCATTTTCCAGG 0: 1
1: 1
2: 0
3: 22
4: 275
945811826_945811832 26 Left 945811826 2:214558266-214558288 CCCTCTTTCTTCTTGCAGGACAT 0: 1
1: 0
2: 3
3: 33
4: 382
Right 945811832 2:214558315-214558337 CAATTACCATTCATTTTCCAGGG 0: 1
1: 0
2: 3
3: 22
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945811826 Original CRISPR ATGTCCTGCAAGAAGAAAGA GGG (reversed) Intronic
900202144 1:1413456-1413478 ATGGGCAGTAAGAAGAAAGATGG + Intergenic
901472586 1:9468007-9468029 ATATCCTGCAAGAATAGAGAGGG + Intergenic
901537333 1:9891105-9891127 AAGTACTTCAAGAAGAAAGGGGG + Intronic
902283084 1:15388511-15388533 AGGTCCTAAGAGAAGAAAGAAGG + Intronic
903768734 1:25750853-25750875 ATGGCCTGCAGGAAGGAAGAGGG + Intronic
904005555 1:27361391-27361413 ATGTCCTGCAAGAAGAAATGGGG + Exonic
904170408 1:28588279-28588301 ATGGGCAGTAAGAAGAAAGATGG + Intergenic
904943846 1:34184594-34184616 ATTTGTTGCAAGAAGGAAGAAGG + Intronic
905322970 1:37130773-37130795 ATTTCCATCAAGCAGAAAGATGG - Intergenic
905495265 1:38380044-38380066 GTGTCCTGTATGAAGAAAGAGGG - Intergenic
905543887 1:38782310-38782332 GTGTCCTGCAATAAACAAGAGGG - Intergenic
905721410 1:40205790-40205812 ATGTCTTGAAAGAAGAAAAATGG - Intronic
907211830 1:52830334-52830356 ATGTCCTGGTAGAAGAGTGAAGG + Intergenic
907511267 1:54962469-54962491 ATGCCCTTCTAGAAGAATGAAGG - Intergenic
907714434 1:56914276-56914298 ATGTACTGCAGCAAGAATGAGGG + Intronic
908458367 1:64326091-64326113 ATGTCCAAGAAAAAGAAAGAGGG + Intergenic
908614832 1:65908198-65908220 TTCTCCTGGAAGAATAAAGAGGG + Intronic
908732635 1:67242150-67242172 ATGCCCTGCTAGAAGAGTGAAGG + Intronic
908873813 1:68646638-68646660 TTCTCCTGCCAGAAGAAAAAGGG + Intergenic
909209977 1:72810700-72810722 ATGTCCTTCTAGAAGACTGAAGG + Intergenic
909437148 1:75655399-75655421 ATGTCTAGCAAGAGGAAAGTGGG + Intergenic
909936005 1:81551400-81551422 AAGTCCTCCAAGATCAAAGATGG + Intronic
910105011 1:83622869-83622891 CTGTCCTGCAAGCAGAAAGCAGG - Intergenic
911471837 1:98328577-98328599 ATGTGATGCAAAAAGTAAGATGG - Intergenic
911820658 1:102415680-102415702 TTGTCTTACAAGAGGAAAGAAGG + Intergenic
911911972 1:103648798-103648820 ATGGGCAGTAAGAAGAAAGATGG + Intergenic
911916482 1:103703150-103703172 ATGGGCAGTAAGAAGAAAGATGG - Intronic
911919387 1:103742936-103742958 ATGGGCAGTAAGAAGAAAGATGG + Intronic
912943344 1:114064570-114064592 ATGTTTTGGAAGGAGAAAGATGG + Intergenic
913135350 1:115883265-115883287 AAGTCCTTCAAGAAGAAACCAGG - Intergenic
913463107 1:119110530-119110552 AAGTCCTGAAAGAAGCCAGAGGG - Intronic
915444506 1:155967053-155967075 ATTTCCTGCTTGAAGGAAGAGGG - Intronic
915643202 1:157245973-157245995 ACTTCCTGGAAGAAGAAACAAGG - Intergenic
916011559 1:160710984-160711006 AGGTACTGGATGAAGAAAGAGGG + Intronic
916843180 1:168621394-168621416 GTGTGCTGCAAGAAAAAATAAGG - Intergenic
917116134 1:171605604-171605626 ATGGGCAGTAAGAAGAAAGATGG - Intergenic
917667748 1:177241574-177241596 ATTTTCTTCATGAAGAAAGATGG - Intronic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
919067081 1:192706097-192706119 ATGCCTTGCAAGATGAAGGAAGG + Intergenic
923588820 1:235300673-235300695 ATGCCTTGCAAGGAGAAAAAAGG + Intronic
924072984 1:240301602-240301624 ATGTCCTTCAAAAAAAAGGAAGG - Intronic
1062860466 10:805877-805899 GTTTCCTGCAGGAAGAAATAAGG - Intergenic
1063053328 10:2476631-2476653 ATGTCCTGCAAAAAAAACGACGG - Intergenic
1063446160 10:6118877-6118899 AAATCCTGAAAGATGAAAGATGG + Intergenic
1063744724 10:8867658-8867680 ATGTCCTTAAAGAATAAATAAGG - Intergenic
1063806465 10:9649060-9649082 ATGACCTGCTTTAAGAAAGAAGG - Intergenic
1064427918 10:15246199-15246221 ATATCCTGCAGTAAGCAAGACGG - Intronic
1065319732 10:24498188-24498210 ATGTCCAGCAAGAAGAGAAGTGG + Intronic
1065802084 10:29361663-29361685 ATGGGCAGTAAGAAGAAAGATGG + Intergenic
1067777000 10:49171095-49171117 ATCTCATGCAAGAAGGAGGAGGG + Intronic
1069103347 10:64351719-64351741 ATTTCCAGCAAGAAGAAAGGGGG - Intergenic
1070951481 10:80434910-80434932 ATGTCCTCTAAGAAGAGGGAGGG + Exonic
1071408466 10:85362382-85362404 GTGCCCTACAAGTAGAAAGATGG - Intergenic
1071898516 10:90092074-90092096 ATGTCCTACAAAAAGAAAATAGG - Intergenic
1073630861 10:105147599-105147621 ATGTCCTGAAAGAAGATGGAAGG - Exonic
1074001693 10:109379937-109379959 AAGTTCTGCAAGAACAGAGATGG + Intergenic
1074654788 10:115572817-115572839 ATGTCCTGCAAGGGGAATCAGGG - Intronic
1074712529 10:116189155-116189177 ATTACCTGCAAGCAGAAAAATGG + Intronic
1075074629 10:119342703-119342725 CTGGCCTGGAAGAAGGAAGAGGG - Intronic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1078673659 11:13389030-13389052 ATGTCCTGGGAGAAGGAAGAAGG - Exonic
1079164297 11:18024411-18024433 ATGTCTGGCTAGAAGACAGATGG + Intronic
1081292792 11:41347460-41347482 ATGTGCTTCAAAAAGAAAGAAGG + Intronic
1081531760 11:43966001-43966023 AACTCCTGCAAGAAGACATAAGG + Intergenic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1082719955 11:56661918-56661940 AATTCCTGCATGAAGAAACAAGG + Intergenic
1083081884 11:60102574-60102596 ATGGGCAGTAAGAAGAAAGATGG + Intergenic
1083090806 11:60198147-60198169 ATTTCCTGCAAGAAATAAAATGG + Intergenic
1083397500 11:62401718-62401740 AGGGCCTGCAGGAAGAGAGAGGG + Intergenic
1084290931 11:68166643-68166665 AAGTCCTGCAAGAAGACAAAAGG - Intronic
1085537949 11:77236856-77236878 AGTTGCTGCCAGAAGAAAGAAGG + Intronic
1085731974 11:79007724-79007746 CTATCCTTCAAGAAGAAAAAGGG - Intronic
1085758284 11:79219726-79219748 ATGCACTGGGAGAAGAAAGACGG - Intronic
1086294067 11:85345698-85345720 ATTTCAGGCAAGTAGAAAGAGGG - Intronic
1086656050 11:89356719-89356741 ATCTACTAGAAGAAGAAAGAGGG - Intronic
1087130596 11:94666408-94666430 ATTCCCTGCAAGATTAAAGATGG - Intergenic
1087163201 11:94971585-94971607 TTGTCCTTCAAGCAGAAAAAAGG + Intronic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1087524702 11:99295517-99295539 ATGTCCTTCTAGAAGACTGAAGG + Intronic
1087670615 11:101102088-101102110 ATGTCCTGAAAGACAAAAAAAGG + Intronic
1088465843 11:110137560-110137582 GTGCCCTGAAAGAAGAGAGACGG - Intronic
1088913532 11:114209874-114209896 ATATCCTTCATGAAGAAATATGG - Intronic
1089925231 11:122250093-122250115 AAGTCCTGCGAGAAGGAAGGGGG - Intergenic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1091169855 11:133510285-133510307 ACTTCCTGCAAGATGGAAGAGGG + Intronic
1092570304 12:9714337-9714359 ATGGGCAGTAAGAAGAAAGATGG + Intergenic
1092924134 12:13258435-13258457 ATGTGCTACAAGAGGAAGGAGGG - Intergenic
1093401241 12:18749226-18749248 GTATACTGCTAGAAGAAAGAAGG - Intergenic
1093943775 12:25084905-25084927 ATGTCCTGCAAGGGGAATCAGGG - Intronic
1094034553 12:26053726-26053748 ATCCCCTGTATGAAGAAAGAAGG - Intronic
1096603783 12:52749901-52749923 ATGTCCTGGGAGAAGGAGGAAGG + Intergenic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1097633293 12:62090678-62090700 ATGTTCAGCAAGAACAAAAAGGG - Intronic
1098395102 12:70008682-70008704 AAGTGCTGAAAGAAGAAAAACGG + Intergenic
1099395940 12:82138901-82138923 GGGTACTGGAAGAAGAAAGATGG + Intergenic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1101526221 12:105533617-105533639 ATGTGCTGTAAGAAGAAAGTGGG - Intergenic
1102130961 12:110528457-110528479 CTGTCCTGCAGGGAGGAAGATGG - Intronic
1102580602 12:113884388-113884410 ATGTCCTGCAGGAATAGAGGTGG - Intronic
1102729364 12:115094457-115094479 GTGACCTTCAAGAGGAAAGAGGG + Intergenic
1104190860 12:126480655-126480677 GTCTCTTGCAACAAGAAAGAGGG + Intergenic
1104630485 12:130397413-130397435 ATGTCCTCGAAAAAGAAAAAGGG - Exonic
1108181182 13:47841469-47841491 GTGTCATAGAAGAAGAAAGAAGG - Intergenic
1108709024 13:53015407-53015429 AGGGCCTGGAAGAGGAAAGAAGG - Intergenic
1109803348 13:67404698-67404720 ATGGGCAGTAAGAAGAAAGATGG - Intergenic
1111070731 13:83163118-83163140 ATGGTCTGCAAGAGAAAAGAAGG - Intergenic
1111073467 13:83200448-83200470 ATGTCCTCCAAGAAGGATCAGGG + Intergenic
1111427803 13:88111381-88111403 ATGTCCTGAAGGAAGTAACATGG + Intergenic
1111689316 13:91542140-91542162 ATTTCATGCAAGAATATAGATGG - Intronic
1111792843 13:92880468-92880490 ATTTTCTGCAAGAAAAAAAAAGG - Intergenic
1112218941 13:97468361-97468383 ATGACCTGAAAACAGAAAGACGG - Exonic
1115814235 14:37145631-37145653 ATGTGGGGCAAGTAGAAAGATGG + Intronic
1116234380 14:42259271-42259293 ATGTACTGAATGAATAAAGAAGG - Intergenic
1117058697 14:51938947-51938969 ATTTCCTGCAAGGAGGCAGAAGG + Intronic
1117291458 14:54337882-54337904 ATGAACTGAAGGAAGAAAGATGG + Intergenic
1118914496 14:70091180-70091202 ATGTCCTGCAGAAAGGAAGATGG - Intronic
1120078130 14:80183422-80183444 ATGTTTTTCAAGAAGAAAAAAGG + Intergenic
1120194916 14:81470683-81470705 ATGCACTGAAAGAAGTAAGATGG + Intergenic
1121347126 14:93144405-93144427 GTGTCCTGCCTGTAGAAAGAAGG - Intergenic
1121440978 14:93949121-93949143 ATGTCCTTCCAGAACAAGGAAGG - Intronic
1121525305 14:94615355-94615377 TTGTCCGGCAAACAGAAAGAAGG + Intronic
1121566191 14:94911214-94911236 ATATGTTGCAAGAGGAAAGATGG + Intergenic
1123166610 14:106331046-106331068 ATTTCCTGCAAAAAGAAGAAAGG - Intergenic
1123169294 14:106356085-106356107 ATTTCCTGCAAAAAGAAGAAAGG - Intergenic
1125872693 15:43116610-43116632 ATCTCGCACAAGAAGAAAGATGG - Intronic
1127730689 15:61799283-61799305 ATTTCTAGAAAGAAGAAAGAAGG + Intergenic
1130966861 15:88704367-88704389 ATGTCCATCAACAAGAAAAAGGG - Intergenic
1132417541 15:101633553-101633575 CAGTCCTTGAAGAAGAAAGATGG - Intronic
1133070956 16:3246543-3246565 ATGTCCTAGGAGAAAAAAGAAGG + Exonic
1133647785 16:7780634-7780656 ATGTCCTTAAAAAAGGAAGAAGG - Intergenic
1134053409 16:11153622-11153644 ATGTGCGTCAAGAAGAAAGGAGG - Intronic
1134755863 16:16666738-16666760 ATGTCCTGAAAGAAAAATGCAGG + Intergenic
1134990203 16:18692427-18692449 ATGTCCTGAAAGAAAAATGCAGG - Intergenic
1135886896 16:26318386-26318408 ATGTTCAGGAAGAAGAAGGAAGG + Intergenic
1136138777 16:28275574-28275596 AAGTCCTGGAAAAAGAATGAGGG + Intergenic
1138515632 16:57534218-57534240 CTGTACTGCCAGAAGAGAGATGG - Intronic
1139115168 16:63942404-63942426 ATATCCTTCAAGAATGAAGAGGG - Intergenic
1140675289 16:77322388-77322410 ATGTCCGGCAAAGTGAAAGATGG - Exonic
1145405222 17:22584380-22584402 ATGTCTTGCAAGATGTTAGAAGG - Intergenic
1146670526 17:34734354-34734376 AAGGCCTGGAAGAGGAAAGAAGG + Intergenic
1147207750 17:38850471-38850493 ATGTACTGAGAGAAGAAAAAAGG + Exonic
1149392530 17:56206468-56206490 ATTTCCTACCAGCAGAAAGAGGG - Intronic
1149422352 17:56522812-56522834 ATGTTCTGTGAGATGAAAGAAGG - Intergenic
1151241087 17:72758469-72758491 ACCTCCTGCCACAAGAAAGATGG - Intronic
1151849060 17:76678992-76679014 CCCTCCTGTAAGAAGAAAGAGGG + Intronic
1152080604 17:78185161-78185183 CTGTGCTGCAAGAGGAGAGAGGG + Exonic
1152429093 17:80237504-80237526 ATGTCCTGAGAGAGGAGAGAGGG - Exonic
1153017135 18:594045-594067 ATGTCCTCCAGGAACAAAGAGGG - Intergenic
1153474981 18:5489190-5489212 TTGTTCTGCAAGCAGAAAAAAGG + Exonic
1154490455 18:14918046-14918068 AAGCCCAGCAAGAAGAAAGCGGG + Intergenic
1155341573 18:24819057-24819079 ATGTCCTGCAAGCAGAATAAGGG - Intergenic
1157002302 18:43541936-43541958 ATGCCCTGCAAGGAGGATGAGGG - Intergenic
1157434516 18:47657252-47657274 ATATCCTTCAAAAACAAAGATGG + Intergenic
1157647149 18:49286433-49286455 ATGTCCTTCAAGAACACACAAGG - Exonic
1158407277 18:57171307-57171329 ATGTTCTGAAACAAGAATGAAGG + Intergenic
1158707496 18:59805964-59805986 AGGGCCTGAAAGAGGAAAGAAGG + Intergenic
1160286297 18:77546812-77546834 ATGACCCGCATGAAGAAGGAGGG - Intergenic
1163290171 19:16374189-16374211 ATTTCCTGGAAGAGGAAAGGCGG - Intronic
1163833371 19:19558575-19558597 ATGTCATAGAAGCAGAAAGAAGG - Intergenic
1163918790 19:20268249-20268271 ATGAGCTTCAGGAAGAAAGAAGG + Intergenic
1166561246 19:43733718-43733740 TTGTTCTGCAAGAAGACTGAGGG + Exonic
1167581709 19:50348216-50348238 ATGGGCAGCAGGAAGAAAGATGG + Intronic
1168465500 19:56598137-56598159 TTGTACTGCAAGAAAATAGAGGG + Intronic
925099656 2:1234628-1234650 GTGTCCTGCAATAAAAAGGAAGG - Intronic
925244066 2:2363958-2363980 CTGCACTCCAAGAAGAAAGAGGG - Intergenic
925859459 2:8160743-8160765 ATTTCCTGCAATGAGAAAGAAGG - Intergenic
926156197 2:10455228-10455250 CTGTCCTACAAGAAGGCAGAAGG - Intergenic
928382638 2:30832928-30832950 ATGCCCTTCTAGAAGAATGAAGG - Intergenic
929504324 2:42516567-42516589 ATATCCTGCACTAGGAAAGAAGG + Intronic
929543900 2:42843333-42843355 TTGAACTGCAAGAAGGAAGATGG - Intergenic
929780180 2:44952340-44952362 GCGGCCTGAAAGAAGAAAGACGG - Intergenic
929823293 2:45290492-45290514 ATGACCTGCTAGATGAGAGAGGG + Intergenic
930342078 2:50129703-50129725 ATGCCCAGCAAAAAGAAAGGAGG + Intronic
930901230 2:56509704-56509726 ATGTCTTAAAAGAAAAAAGAAGG + Intergenic
931289127 2:60856916-60856938 ACCACCTGCAAGGAGAAAGAAGG + Intergenic
932080233 2:68707545-68707567 ATGTGCTCCAGGAAGAGAGAAGG - Intronic
932752627 2:74380947-74380969 TTGTGCTACAAGAAGAAAGAAGG - Intronic
933459147 2:82557574-82557596 ATGTTCAACAAGAAAAAAGATGG + Intergenic
934076695 2:88434489-88434511 AAGTAATGCAAGCAGAAAGATGG - Intergenic
934944745 2:98531727-98531749 ATTTCCTTCAAGAAGTAAGGTGG + Intronic
935886288 2:107623319-107623341 ATGTGGTGGAAGAAGAAAGCAGG + Intergenic
936419204 2:112347327-112347349 ATGGGCAGTAAGAAGAAAGATGG + Intergenic
937187464 2:120058094-120058116 ATTTACTCCAAGAAGAAATATGG + Intronic
937372509 2:121310144-121310166 AAGTCCTGCAACAAGATAGCAGG + Intergenic
937683234 2:124667003-124667025 ATGTGCTTTAAGAAGAACGATGG + Intronic
940405976 2:153302986-153303008 ATCTTCTGCAAGAACAAAGCTGG - Intergenic
941743638 2:169063292-169063314 ATGACCTGCTTCAAGAAAGAAGG + Intergenic
942772758 2:179542260-179542282 ATTTCCTGCAAGATGATAGAGGG + Intronic
943969135 2:194380814-194380836 ATGCCCTTCTAGAAGAATGAAGG + Intergenic
944013859 2:195008349-195008371 ATGTCCTGCAAGAATAGGAAAGG - Intergenic
944268805 2:197758974-197758996 ATGTCATACAAGAAGATGGATGG - Intronic
944591828 2:201225097-201225119 AGGTCCTAGAAGAAGCAAGATGG - Intronic
944606331 2:201354818-201354840 CTGGCCTTCAAGAAGAGAGAAGG - Intronic
945026407 2:205623943-205623965 AAGTCCTGCTACAAGAAAGCAGG - Intergenic
945377635 2:209097427-209097449 ATGTCCTGCAAGGAGGATGAGGG + Intergenic
945811826 2:214558266-214558288 ATGTCCTGCAAGAAGAAAGAGGG - Intronic
945814055 2:214582322-214582344 AAGTCCAGGAAGAAGAATGAGGG + Intergenic
946036183 2:216744180-216744202 ATGGCCTGCCAGAAGTAACATGG - Intergenic
946057711 2:216916404-216916426 ACCTCAGGCAAGAAGAAAGAAGG - Intergenic
946072993 2:217050382-217050404 AGGTCATGCAAGAAGAAAGAGGG - Intergenic
946564705 2:220950986-220951008 ATTTCCTGTAAGCAGAAAAATGG - Intergenic
947067428 2:226244205-226244227 ATATCCTCCATGAAGAAGGAGGG + Intergenic
947477798 2:230466835-230466857 ATGTGGTGTAAGAAGACAGAGGG + Intronic
948574451 2:238940807-238940829 ATGAGCTTCAAGGAGAAAGAAGG - Intergenic
1168824597 20:801348-801370 ATGTCCTGCAAGGAGAATCAGGG + Intergenic
1169055889 20:2620712-2620734 CTATCCTTCAAGAAGAAGGAAGG + Intronic
1169402541 20:5295266-5295288 ATGAGCTGAATGAAGAAAGAGGG - Intergenic
1169578585 20:6993660-6993682 TTGGCCTGCAAACAGAAAGACGG - Intergenic
1171177539 20:23064113-23064135 ATGACCTGGAAGATGAAAGGTGG - Intergenic
1174462654 20:50693732-50693754 ATGTCCCCAAAGAAGATAGATGG - Intergenic
1174647611 20:52099437-52099459 ATAACTTGAAAGAAGAAAGATGG + Intronic
1174929417 20:54795982-54796004 ATGTTCTGAAATAAAAAAGACGG - Intergenic
1175769933 20:61617165-61617187 ATGTTCTGAAAGAACAAAGCAGG - Intronic
1176274006 20:64253440-64253462 ATGACCTCCAAGAAGAAAAGTGG - Intergenic
1176964824 21:15200434-15200456 ATTTCAGGCAAGAAGGAAGAGGG + Intergenic
1180705436 22:17807202-17807224 ATCTTCTGCAAGAAGAGAAATGG + Intronic
1181433146 22:22894981-22895003 AGGTCCTGGAAGAATAAAGTGGG + Intronic
1182668284 22:31974666-31974688 TTGTACTGGAAGAAGACAGAAGG + Intergenic
1184077144 22:42188554-42188576 ATGTCCAGAAAGTAGAAACATGG + Intronic
1184851458 22:47123721-47123743 ATGTCTTGAAACAATAAAGACGG - Intronic
949282140 3:2358863-2358885 ATGTCATGAATGAAGAAATATGG + Intronic
949669614 3:6383776-6383798 ATGTCATGGAAGAAAAACGAAGG + Intergenic
950059798 3:10061043-10061065 ATGTCCTGCACCATGAAAAAAGG - Intronic
950465882 3:13153393-13153415 AGGTCCTGGAAGAGGAGAGAAGG + Intergenic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
951990236 3:28668439-28668461 ATCTTCTGGAAGAAGAGAGATGG - Intergenic
952937824 3:38413830-38413852 GTGGACTGCAAGAAGAGAGAGGG - Exonic
955143847 3:56296431-56296453 AGGTGCTGCAATGAGAAAGATGG + Exonic
955231455 3:57102478-57102500 ATGTGCCGCAAGAAGCAACAAGG - Exonic
956391164 3:68774020-68774042 ATCTCCTGGATGAAGAAGGAAGG - Intronic
956996328 3:74830134-74830156 ATGAGCAGTAAGAAGAAAGATGG - Intergenic
958463791 3:94432753-94432775 ATGAGCTACAAGAAGACAGAAGG - Intergenic
958622660 3:96581684-96581706 ATTTCCTGACAGAAGGAAGAAGG - Intergenic
959962871 3:112320392-112320414 TTTTCCTGCGATAAGAAAGAAGG - Intergenic
960338450 3:116445989-116446011 ATGTCCTGAAAGATGGGAGAAGG + Intronic
962840047 3:139225106-139225128 ATGTTCTTCAAGAAAAAAAAAGG - Intronic
962983152 3:140508836-140508858 ATGTCCTGCAAGCAAAAACCTGG + Intronic
963395724 3:144730961-144730983 ATGGCCTGAAAGAACAAAAAGGG + Intergenic
965176022 3:165333688-165333710 ATGTTCTGCAAGTGGAAAGGTGG - Intergenic
965177927 3:165360209-165360231 AAGGCATGGAAGAAGAAAGATGG - Intergenic
966393599 3:179478084-179478106 ATTTTCTGGAAGAAGACAGAAGG + Intergenic
966419306 3:179721673-179721695 ATGTCCTGAAGCAATAAAGATGG - Intronic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
966624314 3:182000171-182000193 ACCTCCTGCAAGAGGAATGAGGG - Intergenic
967031181 3:185608652-185608674 ATGTAGTGCAAGAAGAGATACGG + Intronic
967475671 3:189914133-189914155 ATGTCCTGCAAGGTCAGAGATGG - Intergenic
967508344 3:190279857-190279879 ATGTCATGCAGCAGGAAAGAGGG + Intergenic
971027634 4:22604203-22604225 ATGGACAGTAAGAAGAAAGATGG - Intergenic
972709088 4:41575932-41575954 TTGTTCTCCAAGAAGAAAAAAGG + Intronic
972819190 4:42680004-42680026 ATGTCCTGCTAGAAGAGTGAAGG - Intergenic
974529024 4:63082714-63082736 ATGTCCAACATGAAGAAAGAAGG + Intergenic
974949534 4:68571287-68571309 ATGGGCAGTAAGAAGAAAGAAGG + Intronic
974988259 4:69056097-69056119 ATGGGCAGTAAGAAGAAAGAAGG - Intronic
976009536 4:80470750-80470772 ATGTTCTGCTGGATGAAAGATGG - Intronic
976117097 4:81739396-81739418 CTTTGCTCCAAGAAGAAAGAGGG - Intronic
977003634 4:91536542-91536564 ATTTCCACTAAGAAGAAAGAGGG + Intronic
977271247 4:94919668-94919690 CTGGCATGCAGGAAGAAAGAAGG - Intronic
978524521 4:109652094-109652116 ATGTACACCCAGAAGAAAGACGG - Intronic
980685610 4:136223851-136223873 TTGTTCTGCAGGAAGTAAGAAGG + Intergenic
981431090 4:144661556-144661578 ATGACCTGCTTGAAGTAAGAAGG - Intronic
982881099 4:160717342-160717364 TTGGTCTGAAAGAAGAAAGATGG - Intergenic
983163093 4:164441532-164441554 ATGACCTGCCAGAAAAAATATGG + Intergenic
985419564 4:189770659-189770681 AAATACTGCAAGAACAAAGATGG + Intergenic
985425952 4:189830081-189830103 ATGTACTGGAGGAAGAAAAAAGG + Intergenic
985662641 5:1164985-1165007 GTGTCCTGCAGGGAGAAAAAGGG - Intergenic
986159884 5:5218317-5218339 ATGTCCTGCAAGGGGGAAAATGG - Intronic
986668138 5:10120784-10120806 ACATCCTCCAAGAAGCAAGAGGG + Intergenic
986677698 5:10201372-10201394 AAGCCCTGGAAGAAGAAAGGAGG + Intergenic
989029972 5:37108935-37108957 ATATGCAGTAAGAAGAAAGAGGG - Intronic
989332932 5:40281069-40281091 ATGTCTTTGAAGAAGAAAGCGGG + Intergenic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
989557921 5:42818565-42818587 ATGGGCAGTAAGAAGAAAGATGG - Intronic
989701577 5:44272162-44272184 ATGTCTTGAAAGAAGCCAGAGGG + Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
991114011 5:62932984-62933006 ATGTCCTTCAAAAAGAGACAAGG + Intergenic
992075526 5:73189593-73189615 ATGTCCTTCAAGTAGGAAGATGG - Intergenic
992203835 5:74410407-74410429 AGGTTCTGCAATAAGAAAGAAGG + Intergenic
992227787 5:74635577-74635599 CTGTCCTCCCAGAAGGAAGAGGG + Exonic
992413946 5:76535009-76535031 ATGTTCTAGAAGCAGAAAGAAGG + Intronic
992578502 5:78145870-78145892 CTCTCCTTCCAGAAGAAAGATGG + Intronic
993468312 5:88274725-88274747 ATGTCCTTCAAGAAGAAATAAGG - Intergenic
995727279 5:115194412-115194434 ATGTCCTGCTACAATAAAGTTGG + Intergenic
996927407 5:128844563-128844585 ATGTTCTACAAAAAGAAAAAGGG + Intronic
996960691 5:129245324-129245346 ATGTGGAGCAAGTAGAAAGAGGG + Intergenic
997203004 5:132024073-132024095 ATGGCCTGGAAGAAGAGAGCAGG - Intergenic
998115034 5:139530325-139530347 ATGGGCAGTAAGAAGAAAGATGG - Intronic
999067263 5:148701873-148701895 ATATACTGGAGGAAGAAAGAGGG + Intergenic
999283565 5:150380592-150380614 ATCTTCTGCAAGCAGACAGAGGG - Intronic
1000379337 5:160614862-160614884 CTGTCCACCAAGAATAAAGAAGG + Intronic
1000561275 5:162792207-162792229 ATGGGCTGCATGAAGATAGAAGG - Intergenic
1000648984 5:163792444-163792466 ATGACTAGCTAGAAGAAAGATGG - Intergenic
1000974672 5:167751783-167751805 TTGTCAGGCAAGAAGAAAGCAGG + Intronic
1001829206 5:174771436-174771458 ATCTTCTTCAAGAAGAAAAAAGG + Intergenic
1002550148 5:179982398-179982420 AAATACTGCAAGTAGAAAGATGG + Intronic
1003373446 6:5551103-5551125 TTCTCCTGCAAGAATAAAGCAGG + Intronic
1004215579 6:13701104-13701126 CTGTCCTGGAAGAGGAAAAAGGG - Intronic
1005199081 6:23322785-23322807 ATGGCATGGAAGAACAAAGAAGG + Intergenic
1005346829 6:24898748-24898770 AGTTCCTGCTAGCAGAAAGATGG - Intronic
1006031886 6:31182178-31182200 ATGGGCAGTAAGAAGAAAGATGG + Intergenic
1007647012 6:43390774-43390796 ATTTCCTTCAAGAGGAAAGCAGG - Intergenic
1008155892 6:48013516-48013538 ATGAGCTGCAAGTAGAAAGGTGG + Intronic
1009467017 6:63983873-63983895 ATCTGCTTCAAGAAGAAAAAAGG + Intronic
1010189828 6:73183718-73183740 CTGTCCTGAAAGAAGTGAGAGGG + Intronic
1010318084 6:74473374-74473396 ATGGGCAGTAAGAAGAAAGATGG - Intergenic
1012348535 6:98222493-98222515 ATGTCCTTGATGAAGACAGATGG + Intergenic
1012714236 6:102648609-102648631 TTCTCTTCCAAGAAGAAAGAAGG - Intergenic
1012795053 6:103748992-103749014 ATGTCCTGCAAGGGGAATCATGG + Intergenic
1013280288 6:108629966-108629988 ATGACCTGGAAGTAGTAAGAAGG - Intronic
1013558958 6:111285390-111285412 ATGGGCAGTAAGAAGAAAGATGG + Intergenic
1013970351 6:116010596-116010618 ATGTCCTGCAACATGTCAGAAGG + Intronic
1013987599 6:116214450-116214472 ATGTTCTGCTAGGAGAAAAAAGG + Intronic
1014323868 6:119966747-119966769 ATGCCCTGCAAGAAGGACAAGGG + Intergenic
1014529973 6:122547168-122547190 GTGTTCTGAAAGAAGAAACAAGG + Intronic
1015086970 6:129306914-129306936 TAGTCCTGCAATAAAAAAGATGG - Intronic
1015437041 6:133201537-133201559 ATGTCTTGAATGCAGAAAGAAGG - Intergenic
1015726553 6:136305497-136305519 CTCTCCTGGAAGAAGGAAGAAGG - Intergenic
1016084246 6:139893554-139893576 ATGTTCTGAAGGGAGAAAGATGG + Intergenic
1016914258 6:149230096-149230118 TTGGCCTGGAAGAAGAGAGAGGG - Intronic
1017028933 6:150204049-150204071 AGGTGCTGCACGGAGAAAGAAGG + Intronic
1019020474 6:168913685-168913707 CTGTGCTGCAGGAAGACAGAGGG + Intergenic
1019842103 7:3457333-3457355 TCTTCCTGCAAGAAGAAAGGTGG - Intronic
1020188135 7:5974272-5974294 GGGTGCTGCAGGAAGAAAGAAGG - Intronic
1020294783 7:6750497-6750519 GGGTGCTGCAGGAAGAAAGAAGG + Intergenic
1020631140 7:10640990-10641012 ATTTCTAGCCAGAAGAAAGAGGG + Intergenic
1020665274 7:11033321-11033343 AGGTGAAGCAAGAAGAAAGAAGG - Intronic
1020940777 7:14533891-14533913 ATATCCTGCAAGAAGTACTAAGG + Intronic
1020962801 7:14827077-14827099 ATGGTCTACAAGAAGAAAGAAGG + Intronic
1021325573 7:19262962-19262984 CTCTCCTTCAAGATGAAAGATGG - Intergenic
1022439725 7:30423790-30423812 ATGCCCAGAAAGAAGAAAGAAGG - Intergenic
1023372689 7:39528120-39528142 ATGTTCTGAAAGAAGAGAAAAGG + Intergenic
1023613285 7:41993138-41993160 GTGTCCGGCAAGAAAAAAGGTGG + Intronic
1024466389 7:49715791-49715813 ATGCCCTGCAAGAAGAAGCCAGG - Intergenic
1025717093 7:63969474-63969496 ATTTCAGGCAAGAAGAAAGTTGG + Intergenic
1026114109 7:67481754-67481776 ATGTGCTGCAAACAGAAAGAAGG - Intergenic
1026514963 7:71060902-71060924 AAGACCTGCAGGAAGAGAGAGGG + Intergenic
1026725858 7:72869434-72869456 TTGTCCTTCAAGAAGAGACAGGG + Intergenic
1027538679 7:79439828-79439850 TTGTTCTGTAAGAAGAAACATGG - Intronic
1028326413 7:89532050-89532072 ATGTCCTCCAAGGAGATACAAGG - Intergenic
1028363577 7:89998545-89998567 ATATCCTGCTAGAAGAAAAGTGG - Intergenic
1028641383 7:93045548-93045570 AAGTTCTTCAAGAAGCAAGATGG + Intergenic
1029473945 7:100771826-100771848 GGGTCCTGCAGGAAGAGAGAAGG - Exonic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1030348708 7:108459590-108459612 ATGTTCTACAATTAGAAAGATGG + Intergenic
1030375560 7:108749446-108749468 ATGACCTCCAAGAGGAAACAAGG - Intergenic
1031305387 7:120119664-120119686 ATGTCCTTCTAAAAGAATGAAGG - Intergenic
1031570783 7:123356610-123356632 ATGTCATTAAAGAAGAAAGCAGG - Intergenic
1033842307 7:145389524-145389546 ATGTCCTTCAAAAAGATAAAGGG + Intergenic
1034232751 7:149545490-149545512 ATCTCCTCCAGCAAGAAAGATGG + Intergenic
1034980974 7:155476104-155476126 CTGTCCTGAGAGAAGAGAGATGG + Intronic
1035884885 8:3281132-3281154 ATGTCCTTCAATAAGAAAATGGG + Intronic
1036015967 8:4785100-4785122 TTCTCCTGAAAGAAGAAAGAAGG - Intronic
1036173742 8:6515913-6515935 ATTTCCTACATGAGGAAAGAGGG + Intronic
1036382918 8:8250345-8250367 ATGTGCTGAAAGAAGATAGTTGG - Intergenic
1036798487 8:11772548-11772570 ATGTCCTGGAAGCACAGAGATGG - Intronic
1037076614 8:14728094-14728116 GTGTCCAGAAAGAAGCAAGATGG + Intronic
1037228403 8:16623540-16623562 AAATCCTGCAACAAAAAAGAAGG + Intergenic
1037402141 8:18503974-18503996 ATGCCCAGCAACAAGAAAGTGGG + Intergenic
1038079775 8:24120971-24120993 ATTTCCTTCAAGAGGAAAGTAGG + Intergenic
1039833994 8:41241401-41241423 ATATCCTGAAAGAAGACAGAAGG - Intergenic
1040419795 8:47228061-47228083 AAGTCCTGAAAGAAGCCAGAGGG + Intergenic
1040714779 8:50237138-50237160 ATGAACTGCAAGAAAAAAAAAGG - Intronic
1041227476 8:55714835-55714857 ATGGGCAGTAAGAAGAAAGATGG - Intronic
1042226951 8:66521605-66521627 ATGTCCTCCATGAAGAAGAAGGG + Intergenic
1042337681 8:67645812-67645834 ATGTCCCTCAAGAAGAAATCTGG - Intronic
1042392258 8:68249406-68249428 ATTTGCTGTAAGAAGAAACAGGG - Intergenic
1043325970 8:79051542-79051564 ATGTGTTGGAAGGAGAAAGAAGG + Intergenic
1043664124 8:82786767-82786789 AAATCATGCAACAAGAAAGAAGG - Intergenic
1044305397 8:90634482-90634504 ATGATCTGCAAGAATAAATATGG - Intronic
1044613702 8:94118932-94118954 GTGTCCTGTAAGAAGTCAGAAGG + Intergenic
1045019444 8:98028933-98028955 AAGTCCTGTAAGAGGAAATAAGG + Intronic
1045482001 8:102600345-102600367 ATGTACTAGAAGAAGAAAGCTGG - Intergenic
1046035139 8:108831621-108831643 ATGTCCTGGCAGGAGAAAAAAGG - Intergenic
1047790920 8:128202904-128202926 ATGTCCGACAAGAAGAAAGGGGG + Intergenic
1047952512 8:129946804-129946826 GTGACCTGCAGGAAGAAAAAAGG + Intronic
1049945354 9:589724-589746 GTGGCCTGAATGAAGAAAGAAGG + Intronic
1049958080 9:711641-711663 CTGTCTTGCAAGAAGAGAAAAGG + Exonic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1051756733 9:20408881-20408903 ATTTCTTTCAAAAAGAAAGAAGG - Intronic
1052160553 9:25253480-25253502 ATTTACTGCAAGAAATAAGAAGG + Intergenic
1052508434 9:29383464-29383486 ATGGGCAGTAAGAAGAAAGATGG - Intergenic
1053149893 9:35736691-35736713 CTGTCCTGCAAAATGACAGAGGG - Exonic
1055465517 9:76561618-76561640 ATGACCTCCAGGAAGAGAGATGG + Intergenic
1055881187 9:81005810-81005832 ATGTCTTGAAAGAAGTAAGAAGG + Intergenic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1057738733 9:97691981-97692003 ATTTCCAACAAGAAGAAAAAAGG + Intronic
1059037550 9:110773210-110773232 ATGTCATGGAAAAAGAAAAAAGG + Intronic
1059139916 9:111843300-111843322 ATGTGCAGTAAGAATAAAGATGG + Intergenic
1059940790 9:119357714-119357736 ATCTCCTGGAATATGAAAGATGG + Intronic
1060460017 9:123843114-123843136 AAGTTCTCCAAGAAGAATGATGG - Intronic
1060572223 9:124652582-124652604 TTATCCTCCAAGAAGAAAAAGGG + Intronic
1060663171 9:125416175-125416197 ATGAGCTGGAACAAGAAAGATGG - Intergenic
1060677673 9:125530234-125530256 ATGGCCTGACCGAAGAAAGAGGG + Intronic
1061927982 9:133815688-133815710 ATGTCCATAAAGAAGGAAGATGG - Intronic
1185484145 X:469395-469417 ATGTTCTGGAAGTAGACAGAGGG + Intergenic
1185882682 X:3755412-3755434 TTGTCTTTCAAAAAGAAAGAAGG - Intergenic
1186113683 X:6282668-6282690 ATGACCTTAATGAAGAAAGAAGG - Intergenic
1186380900 X:9057826-9057848 ATCTTCTGTAAGGAGAAAGAAGG + Intronic
1187834873 X:23422008-23422030 ATGTCCTGCAGGACAAAACAAGG - Intergenic
1192568888 X:72186052-72186074 ATTTCCTGTTTGAAGAAAGATGG + Intronic
1193069955 X:77296811-77296833 CTGTCCCCCAAGAAGAAAAATGG + Intergenic
1193810410 X:86044047-86044069 ATGGTCTTCAAAAAGAAAGAAGG + Intronic
1194804595 X:98311754-98311776 ATGTCCTGTAAAATGGAAGAGGG + Intergenic
1196236969 X:113293334-113293356 ATGTCTTCCAACAAGAAAAAAGG + Intergenic
1196397322 X:115278731-115278753 ATTTTCTGCAAGAAAAAATATGG - Intergenic
1196472180 X:116040936-116040958 ATGTCTTGCAAAAACAAAAAGGG + Intergenic
1197657479 X:129132794-129132816 ATGTCCTGGAAGACAAAGGAAGG + Intergenic
1198252035 X:134889188-134889210 AAGACCTGAAAGAAGAAAAATGG + Exonic
1198531892 X:137556004-137556026 ACCTCCTTCTAGAAGAAAGAAGG - Intergenic
1199309323 X:146304591-146304613 GTGTATTGCAAGAAGAAAGAAGG + Intergenic
1199566802 X:149223934-149223956 ATGTCCTGTAGCAAGGAAGACGG - Intergenic
1199841501 X:151653972-151653994 CTGTCTTGAAAGAAGAAAGGAGG - Intronic
1199887817 X:152039657-152039679 GTGTGGTGCAAGGAGAAAGACGG - Intergenic
1200782292 Y:7227722-7227744 TTGTCTTTCAAAAAGAAAGAAGG + Intergenic
1200782314 Y:7227902-7227924 TTGTCTTTCAAAAAGAAAGAAGG + Intergenic
1201016458 Y:9607605-9607627 AGGACCTCCAAGATGAAAGAGGG - Intergenic
1201062655 Y:10061244-10061266 ATCTGCTGCAATAACAAAGAAGG + Intergenic
1201680194 Y:16637285-16637307 ATGGGCAGTAAGAAGAAAGATGG + Intergenic
1201697191 Y:16839016-16839038 ATGGGCAGTAAGAAGAAAGATGG - Intergenic
1201713125 Y:17013858-17013880 ATATCCTCCAAGAAGAGAGAAGG + Intergenic