ID: 945813261

View in Genome Browser
Species Human (GRCh38)
Location 2:214573567-214573589
Sequence TGTTTGGCCTAGAACTGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 122}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945813255_945813261 -9 Left 945813255 2:214573553-214573575 CCCTGGCAAGACCCTGTTTGGCC 0: 1
1: 0
2: 3
3: 7
4: 129
Right 945813261 2:214573567-214573589 TGTTTGGCCTAGAACTGGCTGGG 0: 1
1: 0
2: 0
3: 8
4: 122
945813256_945813261 -10 Left 945813256 2:214573554-214573576 CCTGGCAAGACCCTGTTTGGCCT 0: 1
1: 0
2: 0
3: 25
4: 179
Right 945813261 2:214573567-214573589 TGTTTGGCCTAGAACTGGCTGGG 0: 1
1: 0
2: 0
3: 8
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945813261 Original CRISPR TGTTTGGCCTAGAACTGGCT GGG Intronic
900546899 1:3234417-3234439 TGCTTGGCCTGGAAGTGGCCTGG - Intronic
902821332 1:18945167-18945189 TGACTGGCCCTGAACTGGCTTGG + Intronic
909215753 1:72886243-72886265 TGTTTGGCCTAAATCTGTTTTGG - Intergenic
911537110 1:99113616-99113638 TGTTTTGCTTAGAATTGTCTTGG + Intergenic
913535236 1:119765865-119765887 TATTTGGACTAGAACTGTGTTGG - Intronic
914290503 1:146269043-146269065 TGTGTGCCCTAGAAATGGCCAGG - Intergenic
914551547 1:148719826-148719848 TGTGTGCCCTAGAAATGGCCAGG - Intergenic
915323696 1:155069938-155069960 TGCCTGGCCTAGAACTGGGAAGG + Intergenic
916973878 1:170053519-170053541 TTTTTTGCTTAGAACTGTCTTGG - Intronic
921425164 1:214992975-214992997 TGTTTTGCTTACAACTGTCTAGG + Intergenic
923021013 1:230163907-230163929 TGTCTGTCCCAGAACTGGCCGGG + Intronic
1065142788 10:22735613-22735635 GGTTTAGTCTAGAACTGGCCAGG - Intergenic
1065461786 10:25974593-25974615 TGTTTCACATTGAACTGGCTGGG + Intronic
1066276067 10:33870157-33870179 TGTCTGGCTTAGAAGTGGTTCGG - Intergenic
1072907957 10:99472277-99472299 TGTTTGGTCTAGAATTAACTAGG - Intergenic
1075071176 10:119320853-119320875 TGTTAGGCCTACAAGGGGCTGGG - Intronic
1075208832 10:120473420-120473442 TGTATCTCCTAGCACTGGCTGGG + Intronic
1075382911 10:122033367-122033389 TGCCTGTCCAAGAACTGGCTTGG + Intronic
1076440792 10:130480259-130480281 GGTTTGGCCTTGGAGTGGCTTGG + Intergenic
1080565999 11:33510086-33510108 TGTGTGGCATGGGACTGGCTTGG + Intergenic
1085775081 11:79358378-79358400 TGTCTGGCCTAGAGCTCTCTGGG - Intronic
1086586551 11:88459304-88459326 TCTTTGGCTTAGGACTGACTTGG + Intergenic
1091725766 12:2845534-2845556 TTTTTGGCCCGGAAATGGCTGGG + Intronic
1093134439 12:15433476-15433498 TGTAAAGCCTAAAACTGGCTGGG - Intronic
1095059171 12:37662226-37662248 CTTTTGGCTTAGAATTGGCTGGG + Intergenic
1095060836 12:37686294-37686316 CTTTTGGCTTAGAATTGGCTTGG - Intergenic
1095065443 12:37766387-37766409 CTTTTGGCTTAGAACTGGCTTGG - Intergenic
1095783296 12:46084419-46084441 TGTTTTACCTACAACTGTCTTGG - Intergenic
1098570845 12:71985793-71985815 AGTTGGGCCGAGAACTGGATGGG - Intronic
1101417603 12:104521931-104521953 TGTTTGGCCTAGTTCCTGCTTGG + Intronic
1102567358 12:113805326-113805348 GGATTGGCCTTGAGCTGGCTGGG + Intergenic
1103341406 12:120223037-120223059 TTTCTGGCCTTGTACTGGCTTGG + Intronic
1107233439 13:38138896-38138918 CTTTTGGCTTAGAACTGTCTCGG + Intergenic
1107692710 13:42968027-42968049 TTTTAGGCCTAGAATTAGCTAGG + Intronic
1114034575 14:18610766-18610788 CTTTTGGCTTAGAACTGACTTGG - Intergenic
1114124070 14:19704243-19704265 CTTTTGGCTTAGAACTGACTTGG + Intergenic
1114279163 14:21175027-21175049 TTTTTTGCTTAGAACTGCCTTGG - Intergenic
1114587608 14:23828330-23828352 GTTTTGGGCTAGAACTGGGTGGG + Intergenic
1114645781 14:24255326-24255348 TGTGGGGCCCAGAGCTGGCTGGG + Intronic
1115430778 14:33315913-33315935 TTTTTGTGCCAGAACTGGCTAGG + Intronic
1116320701 14:43458752-43458774 TGTTTTGCTTAGGATTGGCTTGG - Intergenic
1116340276 14:43714094-43714116 TGACTGGCCTAGCACTGGCTGGG - Intergenic
1123698429 15:22896281-22896303 TGTTGGGCCTAGCACTGACCAGG - Intronic
1126096111 15:45091854-45091876 TGTTTGGGCAAGAGTTGGCTGGG + Intergenic
1127230615 15:56989862-56989884 TGTTTGGCCTTGAAATGTCAAGG + Intronic
1129007551 15:72386756-72386778 TGTGTGGCCTAGCACTAGCAAGG - Intergenic
1130141511 15:81229999-81230021 TGTTTGGCCCAGAAAAGACTGGG + Intronic
1131035170 15:89217317-89217339 TCCTTGGCCTAGAACAGGGTGGG + Exonic
1131466606 15:92660591-92660613 TGATTGGACTAGACCTGCCTTGG + Intronic
1136486039 16:30572185-30572207 TGATTGGCCTGGGACTGGCGGGG + Exonic
1144701935 17:17346058-17346080 TGATTGTTTTAGAACTGGCTTGG + Intronic
1151026826 17:70686714-70686736 TGTTTTGCCTAGTATTTGCTTGG + Intergenic
1151204755 17:72498100-72498122 GGTTTGGTCTAGGCCTGGCTGGG - Intergenic
1152030529 17:77839467-77839489 TGTGTGGCCGAGGACTGCCTTGG - Intergenic
1155630622 18:27887992-27888014 TGCCTGGCATAGAACTGGCTGGG - Intergenic
1156226066 18:35109409-35109431 CTTTTTGCCTAGAACTGTCTTGG + Intronic
1157244797 18:46043645-46043667 TTTCTTGCCTAGCACTGGCTAGG - Intronic
1158802845 18:60932911-60932933 TGGTTGTACTAAAACTGGCTGGG - Intergenic
1158885314 18:61821295-61821317 TGTAAGGCCTAGAACTTACTTGG - Intronic
1160046853 18:75394139-75394161 TATTTGGACTAGAAATGGTTTGG + Intergenic
1161616445 19:5273480-5273502 TGTGTGGCCCAGAACTCGGTTGG - Exonic
1165495268 19:36149028-36149050 TGTTAGGCTTAGAACTGGAGAGG + Intronic
927099095 2:19774102-19774124 TGTTGAGCTTAGCACTGGCTTGG - Intergenic
927351760 2:22124806-22124828 TGTTTGGCTTAAAAATGACTTGG + Intergenic
935414439 2:102800920-102800942 TGTTTGGCTGAGAACTGTGTAGG + Intronic
935598177 2:104896225-104896247 TGTTAGACCTAAACCTGGCTGGG + Intergenic
945813261 2:214573567-214573589 TGTTTGGCCTAGAACTGGCTGGG + Intronic
946119873 2:217500668-217500690 TGCTTGGTCTAGAAGTGGCAAGG + Intronic
947003272 2:225482781-225482803 TGTTTGGGGTAGGGCTGGCTGGG - Intronic
1169029185 20:2394982-2395004 TCCTTGGCCTGGAAGTGGCTGGG + Intronic
1172031528 20:31985308-31985330 TGTTTGGCCCAGAACTGTGAGGG + Intronic
1172765069 20:37346580-37346602 GATTTGGCCTAGACCTGGCCCGG - Intronic
1175194664 20:57234571-57234593 TGTTTTGCTCAGAACTGCCTTGG - Intronic
1179248365 21:39652292-39652314 TGTTTGTCATATAACTGGATGGG + Intronic
1180458693 22:15537813-15537835 CTTTTGGCTTAGAACTGACTTGG - Intergenic
1180676088 22:17587438-17587460 TGTTTTGTCTGGAACTGGCCAGG + Intronic
1184107850 22:42378895-42378917 TGTTTGGACTGGGAATGGCTGGG + Intergenic
949479218 3:4477372-4477394 TTTTTGGCCAGGAACTTGCTGGG - Intergenic
952511938 3:34067045-34067067 AGTTTGGCATAAAACTTGCTAGG + Intergenic
952572140 3:34730808-34730830 TGTTTGGCTTAGGATTGGCTTGG - Intergenic
953730983 3:45447872-45447894 AGTGTGGCCTAGAACTGTCCAGG + Intronic
954975568 3:54690971-54690993 TGTGTGGCCTACAAATGGCAAGG + Intronic
956030473 3:65031531-65031553 TGTTTGGGCTATAACTGGGAGGG - Intergenic
956245118 3:67174293-67174315 TCTTTAGCTTAGGACTGGCTGGG + Intergenic
959056709 3:101574399-101574421 TGTTGGGCCCAGACCTGCCTCGG + Intronic
959421776 3:106137148-106137170 TGTTTGGCTTAGGATTGACTTGG - Intergenic
961480266 3:127174968-127174990 AGTTTGGCCTTGAGCTGGCCTGG + Intergenic
961522329 3:127473861-127473883 TGTGTGGGCTAGAAATTGCTGGG - Intergenic
969086326 4:4659352-4659374 GGTGTGGCCCATAACTGGCTAGG + Intergenic
973235474 4:47898382-47898404 TGCTTGTCCTAGAATTGGCATGG - Intronic
973754561 4:54062394-54062416 TATTTGGCCTTCAACTGGCCTGG + Intronic
978956074 4:114615462-114615484 TGGTTTGCCTAGAACTGGGTGGG - Intronic
980500750 4:133649773-133649795 TGTTTTCCCTAGAAGTTGCTAGG - Intergenic
980859787 4:138485514-138485536 TATTTGGCATCGAACAGGCTTGG - Intergenic
983404057 4:167302643-167302665 TGTGTGGTCTTGCACTGGCTAGG - Intergenic
983855703 4:172641359-172641381 AGTTGGGCCCAGAACTGGCAGGG - Intronic
985468704 5:22984-23006 TGTTTGGCTTAGGATTGTCTTGG - Intergenic
990442762 5:55863030-55863052 TGTATGTACTAGAACTGCCTTGG - Intronic
991385152 5:66079550-66079572 TGTTTGGCCTTGCATTGCCTTGG + Intronic
995680289 5:114710063-114710085 TGATAGGTATAGAACTGGCTTGG - Intergenic
1001844418 5:174909074-174909096 CTTTTGGCTTAGAACTGTCTTGG - Intergenic
1005276982 6:24229954-24229976 TGTGTGGCCAAGAGCAGGCTGGG - Intronic
1007423608 6:41734094-41734116 TTTTTGGCTTAGAGCTCGCTGGG - Intronic
1008526757 6:52415047-52415069 TGTTTGGCCAACAACTGAATTGG - Intergenic
1009271155 6:61615798-61615820 TGCTTGGCCTAGAAGTGTTTTGG - Intergenic
1012034910 6:94122829-94122851 TGCTGGGACTAGAACTGGATAGG - Intergenic
1012312299 6:97740309-97740331 TATTTTGCCTAGATCTTGCTTGG - Intergenic
1014311290 6:119805385-119805407 TGTTAGGCCCAGAAATGGATGGG - Intergenic
1014755641 6:125299566-125299588 TGTTGGGCCTTGTACTGCCTTGG - Intronic
1024397237 7:48883792-48883814 TTTTTGGCCTAGGATTGTCTTGG + Intergenic
1025219533 7:57094454-57094476 TGTTTGGCTTAGAAAAGACTAGG + Intergenic
1025630322 7:63265993-63266015 TGTTTGGCTTAGAAAAGACTAGG + Intergenic
1025651943 7:63478014-63478036 TGTTTGGCTTAGAAAAGACTAGG - Intergenic
1029913439 7:104180583-104180605 TTTTTGACCTAGAACTAACTTGG + Intronic
1031994717 7:128222405-128222427 TGCTTGCCCTAGCACTGGGTGGG + Intergenic
1038517064 8:28196299-28196321 TGTTGTGCCAAGAAGTGGCTTGG - Intergenic
1039021364 8:33210396-33210418 TGTTTGGCCAAGAAAAAGCTTGG - Intergenic
1043554457 8:81414832-81414854 TTTTTGGCTTAGAATTGCCTTGG - Intergenic
1043746301 8:83877068-83877090 TGTTTGGCTTAGAATTGTCTTGG + Intergenic
1046915675 8:119675795-119675817 TGTCTGGCCTACCCCTGGCTGGG + Intergenic
1048456251 8:134581249-134581271 TGTTTTGCCTGGGACTGGCTTGG - Intronic
1050232783 9:3545887-3545909 TGTTTGGTCTATAAATGGATTGG + Intergenic
1187844368 X:23521602-23521624 TCTTTGGCTTAGGACTGACTTGG + Intergenic
1189998258 X:46659912-46659934 TGTTTGGCTTAGGATTGACTTGG - Intronic
1190330255 X:49231163-49231185 TATTTGGCTGGGAACTGGCTGGG + Intronic
1191048408 X:56164044-56164066 CTTTTTGCTTAGAACTGGCTTGG + Intergenic
1193071343 X:77309116-77309138 TTTTTGGCTTAGGACTGTCTTGG - Intergenic
1195671335 X:107472693-107472715 TGTTTTGCCTGGGGCTGGCTGGG - Intergenic
1197387377 X:125817837-125817859 TGTTTGCCCTAGAAATGGCATGG + Intergenic
1201439670 Y:13994160-13994182 TGCTTGGCCCAGAATTAGCTCGG + Intergenic
1201444901 Y:14048548-14048570 TGCTTGGCCCAGAATTAGCTCGG - Intergenic