ID: 945813273

View in Genome Browser
Species Human (GRCh38)
Location 2:214573672-214573694
Sequence TTGTTCTGGACTCAGAACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 277}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945813273_945813276 7 Left 945813273 2:214573672-214573694 CCTCAGTTCTGAGTCCAGAACAA 0: 1
1: 0
2: 2
3: 33
4: 277
Right 945813276 2:214573702-214573724 GTTTAGTGTTGAATTTTCCCAGG 0: 1
1: 0
2: 0
3: 11
4: 182
945813273_945813280 25 Left 945813273 2:214573672-214573694 CCTCAGTTCTGAGTCCAGAACAA 0: 1
1: 0
2: 2
3: 33
4: 277
Right 945813280 2:214573720-214573742 CCAGGGAGCTGTAGACCCAAAGG 0: 1
1: 0
2: 1
3: 15
4: 177
945813273_945813277 8 Left 945813273 2:214573672-214573694 CCTCAGTTCTGAGTCCAGAACAA 0: 1
1: 0
2: 2
3: 33
4: 277
Right 945813277 2:214573703-214573725 TTTAGTGTTGAATTTTCCCAGGG 0: 1
1: 0
2: 2
3: 28
4: 337

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945813273 Original CRISPR TTGTTCTGGACTCAGAACTG AGG (reversed) Intronic