ID: 945814366

View in Genome Browser
Species Human (GRCh38)
Location 2:214585902-214585924
Sequence TTTCACTTGCAGAAAATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945814362_945814366 -10 Left 945814362 2:214585889-214585911 CCATCCCATTGATTTTCACTTGC No data
Right 945814366 2:214585902-214585924 TTTCACTTGCAGAAAATGGAAGG No data
945814361_945814366 18 Left 945814361 2:214585861-214585883 CCAGAACATATATCTGTAATCAC No data
Right 945814366 2:214585902-214585924 TTTCACTTGCAGAAAATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945814366 Original CRISPR TTTCACTTGCAGAAAATGGA AGG Intergenic
No off target data available for this crispr