ID: 945819878

View in Genome Browser
Species Human (GRCh38)
Location 2:214650945-214650967
Sequence ATAAATTAGCTAAAGCTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945819875_945819878 -10 Left 945819875 2:214650932-214650954 CCTTTGATCCAGAATAAATTAGC No data
Right 945819878 2:214650945-214650967 ATAAATTAGCTAAAGCTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945819878 Original CRISPR ATAAATTAGCTAAAGCTGGT TGG Intergenic
No off target data available for this crispr