ID: 945821122

View in Genome Browser
Species Human (GRCh38)
Location 2:214666871-214666893
Sequence TTAAAGAAGTGGTAGTTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945821122_945821127 23 Left 945821122 2:214666871-214666893 CCAACCAACTACCACTTCTTTAA No data
Right 945821127 2:214666917-214666939 AAAATGCTCCCACAACCAGCAGG No data
945821122_945821125 -2 Left 945821122 2:214666871-214666893 CCAACCAACTACCACTTCTTTAA No data
Right 945821125 2:214666892-214666914 AAGCACCTGAACACTTTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945821122 Original CRISPR TTAAAGAAGTGGTAGTTGGT TGG (reversed) Intergenic
No off target data available for this crispr