ID: 945822296

View in Genome Browser
Species Human (GRCh38)
Location 2:214679612-214679634
Sequence ACCCCTGTCTTGCTACTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945822296_945822299 5 Left 945822296 2:214679612-214679634 CCAGTCAGTAGCAAGACAGGGGT No data
Right 945822299 2:214679640-214679662 AATACAAAAGAGAATTAGGAGGG No data
945822296_945822298 4 Left 945822296 2:214679612-214679634 CCAGTCAGTAGCAAGACAGGGGT No data
Right 945822298 2:214679639-214679661 TAATACAAAAGAGAATTAGGAGG No data
945822296_945822297 1 Left 945822296 2:214679612-214679634 CCAGTCAGTAGCAAGACAGGGGT No data
Right 945822297 2:214679636-214679658 GTGTAATACAAAAGAGAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945822296 Original CRISPR ACCCCTGTCTTGCTACTGAC TGG (reversed) Intergenic
No off target data available for this crispr