ID: 945822297

View in Genome Browser
Species Human (GRCh38)
Location 2:214679636-214679658
Sequence GTGTAATACAAAAGAGAATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945822290_945822297 27 Left 945822290 2:214679586-214679608 CCCTGGGATAATATATGTTCTAG No data
Right 945822297 2:214679636-214679658 GTGTAATACAAAAGAGAATTAGG No data
945822296_945822297 1 Left 945822296 2:214679612-214679634 CCAGTCAGTAGCAAGACAGGGGT No data
Right 945822297 2:214679636-214679658 GTGTAATACAAAAGAGAATTAGG No data
945822291_945822297 26 Left 945822291 2:214679587-214679609 CCTGGGATAATATATGTTCTAGG No data
Right 945822297 2:214679636-214679658 GTGTAATACAAAAGAGAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945822297 Original CRISPR GTGTAATACAAAAGAGAATT AGG Intergenic
No off target data available for this crispr