ID: 945822298

View in Genome Browser
Species Human (GRCh38)
Location 2:214679639-214679661
Sequence TAATACAAAAGAGAATTAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945822291_945822298 29 Left 945822291 2:214679587-214679609 CCTGGGATAATATATGTTCTAGG No data
Right 945822298 2:214679639-214679661 TAATACAAAAGAGAATTAGGAGG No data
945822296_945822298 4 Left 945822296 2:214679612-214679634 CCAGTCAGTAGCAAGACAGGGGT No data
Right 945822298 2:214679639-214679661 TAATACAAAAGAGAATTAGGAGG No data
945822290_945822298 30 Left 945822290 2:214679586-214679608 CCCTGGGATAATATATGTTCTAG No data
Right 945822298 2:214679639-214679661 TAATACAAAAGAGAATTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945822298 Original CRISPR TAATACAAAAGAGAATTAGG AGG Intergenic
No off target data available for this crispr