ID: 945822299

View in Genome Browser
Species Human (GRCh38)
Location 2:214679640-214679662
Sequence AATACAAAAGAGAATTAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945822291_945822299 30 Left 945822291 2:214679587-214679609 CCTGGGATAATATATGTTCTAGG No data
Right 945822299 2:214679640-214679662 AATACAAAAGAGAATTAGGAGGG No data
945822296_945822299 5 Left 945822296 2:214679612-214679634 CCAGTCAGTAGCAAGACAGGGGT No data
Right 945822299 2:214679640-214679662 AATACAAAAGAGAATTAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945822299 Original CRISPR AATACAAAAGAGAATTAGGA GGG Intergenic
No off target data available for this crispr