ID: 945825475

View in Genome Browser
Species Human (GRCh38)
Location 2:214716287-214716309
Sequence AGAATCCTATTTCCCTAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945825471_945825475 18 Left 945825471 2:214716246-214716268 CCTATATAGGTGTGCTTAAATAG No data
Right 945825475 2:214716287-214716309 AGAATCCTATTTCCCTAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945825475 Original CRISPR AGAATCCTATTTCCCTAAAA AGG Intergenic
No off target data available for this crispr