ID: 945825675

View in Genome Browser
Species Human (GRCh38)
Location 2:214717317-214717339
Sequence TTACCACAGCTGATGCTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945825667_945825675 5 Left 945825667 2:214717289-214717311 CCCCGCCCACCACTGTTTCACCC No data
Right 945825675 2:214717317-214717339 TTACCACAGCTGATGCTCTCTGG No data
945825669_945825675 3 Left 945825669 2:214717291-214717313 CCGCCCACCACTGTTTCACCCAC No data
Right 945825675 2:214717317-214717339 TTACCACAGCTGATGCTCTCTGG No data
945825670_945825675 0 Left 945825670 2:214717294-214717316 CCCACCACTGTTTCACCCACACA No data
Right 945825675 2:214717317-214717339 TTACCACAGCTGATGCTCTCTGG No data
945825672_945825675 -4 Left 945825672 2:214717298-214717320 CCACTGTTTCACCCACACATTAC No data
Right 945825675 2:214717317-214717339 TTACCACAGCTGATGCTCTCTGG No data
945825671_945825675 -1 Left 945825671 2:214717295-214717317 CCACCACTGTTTCACCCACACAT No data
Right 945825675 2:214717317-214717339 TTACCACAGCTGATGCTCTCTGG No data
945825668_945825675 4 Left 945825668 2:214717290-214717312 CCCGCCCACCACTGTTTCACCCA No data
Right 945825675 2:214717317-214717339 TTACCACAGCTGATGCTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945825675 Original CRISPR TTACCACAGCTGATGCTCTC TGG Intergenic
No off target data available for this crispr