ID: 945827173

View in Genome Browser
Species Human (GRCh38)
Location 2:214736398-214736420
Sequence ATTGGGAAGGAGATTTGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 922
Summary {0: 1, 1: 0, 2: 8, 3: 70, 4: 843}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945827173_945827180 21 Left 945827173 2:214736398-214736420 CCTTCCCAAATCTCCTTCCCAAT 0: 1
1: 0
2: 8
3: 70
4: 843
Right 945827180 2:214736442-214736464 ATTGTATCTTTAACTGCATATGG 0: 1
1: 0
2: 1
3: 20
4: 226
945827173_945827181 24 Left 945827173 2:214736398-214736420 CCTTCCCAAATCTCCTTCCCAAT 0: 1
1: 0
2: 8
3: 70
4: 843
Right 945827181 2:214736445-214736467 GTATCTTTAACTGCATATGGTGG 0: 1
1: 0
2: 0
3: 9
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945827173 Original CRISPR ATTGGGAAGGAGATTTGGGA AGG (reversed) Intronic
900558136 1:3290229-3290251 ATTTGGAAGTAGACATGGGAAGG + Intronic
900832775 1:4977145-4977167 ATTGGGAAGGAAATGTCGGGAGG - Intergenic
900877123 1:5350750-5350772 ATTTGAAATGAGATTTGGGTGGG - Intergenic
900895902 1:5482668-5482690 ATTAGAGAGGAGATTTGGGTTGG - Intergenic
901436221 1:9248856-9248878 ACTGGGAGGGAAATTTGGAAGGG - Intronic
901547724 1:9971637-9971659 ATTGGGAATGAGAATGTGGAAGG + Intronic
902796965 1:18806357-18806379 ATTGGGGAGGGAATTGGGGAGGG - Intergenic
902797279 1:18807885-18807907 ACCGGGAAGGAGAACTGGGAAGG - Intergenic
902801202 1:18831274-18831296 ATTCGACATGAGATTTGGGAGGG - Intergenic
904121231 1:28199278-28199300 ATTGGGCATGAGATTTGGGTGGG - Intergenic
904579229 1:31528106-31528128 ATTCAGGATGAGATTTGGGAGGG + Intergenic
905010419 1:34743226-34743248 ATTGGGAAGGAGGTTTGGCAGGG - Intronic
905240858 1:36580667-36580689 ATTGGGAAGGACAATGAGGAGGG + Intergenic
905464961 1:38146177-38146199 ATTGTGAAATAGATTTGTGAGGG + Intergenic
906280407 1:44549598-44549620 ATGGGGAAGCAGAACTGGGAGGG - Intronic
906680178 1:47720959-47720981 CTTGGGAAGGAGAGGTGGGTTGG + Intergenic
907875081 1:58478058-58478080 ATTTGAAATGAGATTTGGGTGGG - Intronic
908407629 1:63830628-63830650 ATTTGGGATGAGATTTGGGTGGG + Intronic
908948377 1:69527481-69527503 ATTGGAGATGAGATTTGGGTGGG - Intergenic
909024251 1:70464271-70464293 AAAGGGCATGAGATTTGGGAGGG - Intergenic
909042390 1:70669952-70669974 ATTTGGCAAGAGATTTGGGCAGG - Intergenic
909344062 1:74564820-74564842 ATTAGAGAGGAGATTTGGGTGGG + Intergenic
909361558 1:74765504-74765526 TCTGGGAAGGAAATTTGGGCAGG + Exonic
909422645 1:75484049-75484071 ATTCAAAATGAGATTTGGGAGGG + Intronic
909715454 1:78701966-78701988 ATTGGAAGGGGAATTTGGGAGGG + Intergenic
909918780 1:81354537-81354559 AGTGGGAAGGCATTTTGGGAGGG - Intronic
910075484 1:83272290-83272312 ATTTGGAAGGACTTTTGTGAAGG + Intergenic
911234130 1:95391536-95391558 GTGGGAAAGGAGATTTGGGTTGG + Intergenic
911875265 1:103154231-103154253 ATTAGAGATGAGATTTGGGAGGG + Intergenic
912039559 1:105370709-105370731 ATTTGAAATGAGATTTGGGTGGG + Intergenic
912217151 1:107627415-107627437 ACTGGGTATGAGAATTGGGAAGG + Intronic
912807390 1:112768072-112768094 AGGGGGAAGGAGGTTGGGGATGG + Intergenic
913052863 1:115132182-115132204 ATTGGACATGAGATTTGGGTGGG + Intergenic
913057896 1:115179117-115179139 TTGGGGGAGGAGAATTGGGAAGG + Intergenic
913111118 1:115658058-115658080 ATTGAGCATGAGATTTGGGTAGG + Intronic
913121058 1:115741184-115741206 ATTTGGAAACAGATTTTGGAGGG - Intronic
913526689 1:119700583-119700605 ATTTGAAACGAGATTTGGGTGGG - Intronic
915008624 1:152664141-152664163 ACTTGGGAGGACATTTGGGAGGG - Exonic
915365266 1:155311595-155311617 ATGGGGAAGGAAACTGGGGAGGG + Intronic
916240265 1:162632363-162632385 ATTAGGAAGGGGGTTGGGGAGGG - Intronic
916314625 1:163435759-163435781 ATTGGGAAGGAGGGGTAGGAAGG - Intergenic
916910680 1:169342117-169342139 ATTCGAAATGAGATTTGGGTGGG - Intronic
917726565 1:177833390-177833412 ATTGGAGATGAGATTTGGGTGGG + Intergenic
917959789 1:180132982-180133004 TTTGTGTAGGTGATTTGGGAAGG + Intergenic
918016842 1:180643026-180643048 GTTGGGAAGGTGAGCTGGGAGGG + Intronic
918114573 1:181485139-181485161 TTTGGGAGGGAGATTTGGGAGGG + Intronic
918664003 1:187125717-187125739 ATTTGACATGAGATTTGGGAGGG + Intergenic
918754662 1:188324231-188324253 ATAGTGAAGGAGATTGGGGCAGG + Intergenic
918806598 1:189055253-189055275 ATTAGGAATGAGATTTGGGTGGG - Intergenic
919007104 1:191911360-191911382 ATTGGAGATGAGATTTGGGTGGG + Intergenic
919028186 1:192203726-192203748 ATTTGAAACGAGATTTGGGTGGG + Intergenic
919073637 1:192788037-192788059 AGTGGGGAGGAGTTTTGGGTGGG + Intergenic
919557634 1:199079498-199079520 ATTGGGAAGTTGAAATGGGATGG - Intergenic
919616470 1:199814750-199814772 ATTTGACAAGAGATTTGGGAAGG - Intergenic
920090564 1:203450068-203450090 ATTAGGTAAAAGATTTGGGAGGG - Intergenic
920106423 1:203556500-203556522 AATGGGAAACAGATTTGAGAGGG + Intergenic
920197171 1:204236440-204236462 ATTGTGAAACAGATTTGTGAGGG + Intronic
920264916 1:204714663-204714685 ATTGGGAAGGGAGTTGGGGAGGG + Intergenic
920342521 1:205284454-205284476 GTTTGGAAGGAGGTTTAGGAAGG + Intergenic
920618970 1:207525225-207525247 ATTTGACATGAGATTTGGGAGGG + Intronic
920620750 1:207543781-207543803 ATTTGACATGAGATTTGGGAGGG + Intronic
920622532 1:207562338-207562360 ATTTGACATGAGATTTGGGAGGG + Intronic
920720982 1:208386585-208386607 ATTCAGCAGGATATTTGGGAGGG + Intergenic
921207870 1:212864498-212864520 GTTTGGAAGAAGCTTTGGGAAGG + Intronic
921438578 1:215157115-215157137 ATTGGAGATGAGATTTGGGTGGG + Intronic
921543636 1:216448956-216448978 ATAGGTTAGAAGATTTGGGAAGG - Intergenic
921699114 1:218247003-218247025 AATGGGATGAAGATTTGGAATGG + Intergenic
923565911 1:235075798-235075820 AGTGGGATGGGGGTTTGGGAAGG - Intergenic
923682816 1:236132638-236132660 ATTGGGCAGGAAGTGTGGGAGGG + Intergenic
923760979 1:236843823-236843845 ACTGAGAAGCAGGTTTGGGATGG + Intronic
924442244 1:244096091-244096113 ATTGGGAAGTAGGTTAGGGTTGG - Intergenic
924579037 1:245307667-245307689 AGGGGCAATGAGATTTGGGAAGG - Intronic
924701576 1:246459000-246459022 ATTGGATATGAGATTTGGGTGGG - Intronic
1063172036 10:3517650-3517672 ATTGGAGATGAGATTTGGGTGGG - Intergenic
1063303876 10:4878587-4878609 ATGGGGAAAGGGATTTGGAAAGG + Intergenic
1064229774 10:13519910-13519932 AATGGGAAGGTGCTTTAGGAGGG + Intronic
1064503901 10:16008732-16008754 ATGGGGTAGGAGGCTTGGGAAGG + Intergenic
1064785271 10:18887992-18888014 AGTGGGATGGAGAGCTGGGAAGG - Intergenic
1065355807 10:24840439-24840461 ATTCGACATGAGATTTGGGAGGG - Intergenic
1065728685 10:28691366-28691388 ATTTGACATGAGATTTGGGAGGG - Intergenic
1065815776 10:29481275-29481297 ATGGGGAAGGGGGTGTGGGAAGG + Intronic
1065957150 10:30703957-30703979 ATGGGGAAGGGGGTGTGGGAAGG - Intergenic
1067452126 10:46388275-46388297 AGAGGGAGGGAGATGTGGGAAGG - Intronic
1067585111 10:47471480-47471502 AGAGGGAGGGAGATGTGGGAAGG + Intronic
1067691306 10:48504047-48504069 ATGGGGAAGGAGGGATGGGAAGG + Intronic
1067701577 10:48576942-48576964 ATTACCATGGAGATTTGGGAAGG - Intronic
1067911289 10:50349552-50349574 ATTCAGAATGAGATTTGGGTGGG - Intronic
1068301191 10:55142916-55142938 ATTGGAAATGAGACTTGGGTAGG - Intronic
1068781969 10:60929164-60929186 ATTGGATATGAGATTTGGGTGGG + Intronic
1068874217 10:61979610-61979632 CTGGGGAAGGACATTTGGAAGGG - Intronic
1069009283 10:63353293-63353315 ATTGTGAATAAGATTTGGGAAGG + Intronic
1069085691 10:64137088-64137110 ATTGGGAGGGGGAGGTGGGAGGG + Intergenic
1069093762 10:64232989-64233011 ACTGGGAAGGATAGTTGGGAGGG + Intergenic
1069296478 10:66851435-66851457 ATTCGACATGAGATTTGGGAGGG - Intronic
1069854279 10:71431073-71431095 TCTGGGAAGGAGTTGTGGGATGG + Intronic
1070077077 10:73146993-73147015 TTTGGGAAGCAGAGGTGGGAGGG + Intronic
1070871619 10:79759002-79759024 ATTTGAAATGAGATTTGGGTGGG - Intergenic
1071191096 10:83102004-83102026 ACTGGAAATGAGATTTGGGTGGG - Intergenic
1071214297 10:83381021-83381043 AATGGGAAGGATATTTAGGAAGG - Intergenic
1071638543 10:87281165-87281187 ATTTGAAATGAGATTTGGGTGGG - Intergenic
1071656699 10:87456787-87456809 ATTTGAAATGAGATTTGGGTGGG + Intergenic
1071753942 10:88514395-88514417 ATTTGAAATGAGATTTGGGTGGG + Intronic
1072167328 10:92826785-92826807 ATTGAGAAGGTGATTTTTGAAGG + Intergenic
1072228858 10:93395835-93395857 ATTGGGAAAGAAGTTTTGGATGG + Intronic
1072403779 10:95130704-95130726 TTAGGACAGGAGATTTGGGAGGG + Intergenic
1072548694 10:96460458-96460480 ATTTGACATGAGATTTGGGAAGG - Intronic
1072603892 10:96961024-96961046 GTTAGGAAGGAGATTGGGGTGGG + Intronic
1072729902 10:97838837-97838859 AGTGGGAAGGAGGATTGGGAAGG + Intergenic
1072808804 10:98444236-98444258 GTGGGGAAGGAGATTTGGGAGGG - Intronic
1073133212 10:101204212-101204234 AAGGGGAAGGAAAGTTGGGAAGG + Intergenic
1073467453 10:103702516-103702538 AGCAGGAAGGAGATTTGGGGTGG + Intronic
1073829235 10:107362841-107362863 ATTGAAGAGGAGATTTGGGTGGG - Intergenic
1074207771 10:111299045-111299067 ATTGGAGATGAGATTTGGGTGGG - Intergenic
1074431028 10:113394892-113394914 ATTCAAAATGAGATTTGGGAGGG - Intergenic
1074476754 10:113781226-113781248 GTTGGGAAGGATGTTGGGGAAGG - Intronic
1074476844 10:113781524-113781546 GTTGGGAAGGATGTTGGGGAAGG - Intronic
1074876323 10:117616166-117616188 AGTGGGATGGAGGTTTGGGATGG + Intergenic
1075097621 10:119482994-119483016 ATTTGGGATGAGATTTGGGTGGG - Intergenic
1075532900 10:123245024-123245046 ATTGTGAAGGAAATATGGCAAGG + Intergenic
1075553518 10:123411986-123412008 ATTCGGCAGGAGATTTGAGAGGG - Intergenic
1075769833 10:124923865-124923887 GTTGGCAATGAGATTTGGGTGGG + Intergenic
1075938945 10:126371804-126371826 TTTGAGAAAGAGATGTGGGAGGG - Intronic
1076108224 10:127841482-127841504 AAGGGGGAGGTGATTTGGGAAGG + Intergenic
1076199803 10:128549031-128549053 AATGGGCAGGAGAGCTGGGATGG - Intergenic
1076660179 10:132050620-132050642 TTTAGGAAGGAGATTTGGGGGGG + Intergenic
1077485068 11:2834858-2834880 GTGGGGAGGGAGACTTGGGATGG - Intronic
1077580909 11:3416716-3416738 TTTGGAGGGGAGATTTGGGATGG + Intergenic
1077701201 11:4443900-4443922 GTTGGGAAAGAGAGTTGGAAAGG - Intergenic
1078519182 11:12049769-12049791 ATTGGGAAGGAGCAGTGGGTAGG + Intergenic
1078533363 11:12154016-12154038 TTTGGGTTGGAGATTTGGGTTGG + Intronic
1078554206 11:12305440-12305462 ATTGGAGATGAGATTTGGGTGGG + Intronic
1079476390 11:20834179-20834201 GCTGTGAAGGAGATTTGGAATGG + Intronic
1079677378 11:23246984-23247006 ATTTCGAATGAGATTTGGGTGGG + Intergenic
1079789793 11:24722534-24722556 ATTCAAAATGAGATTTGGGAGGG + Intronic
1080088026 11:28310011-28310033 AATGGGAAGAAGATATGGGTTGG - Intronic
1080192659 11:29570375-29570397 TTGGGGCATGAGATTTGGGAGGG - Intergenic
1080403019 11:31954693-31954715 ATTGGAAATGAGATTTGGGTTGG - Intronic
1080720331 11:34842194-34842216 CTTGGGAACCAGGTTTGGGAAGG - Intergenic
1080782221 11:35440241-35440263 ATTGGGAAAGTGAGATGGGAAGG - Intronic
1081043569 11:38242432-38242454 ATTTTGAAGGACCTTTGGGAAGG - Intergenic
1081334565 11:41848710-41848732 ATTTGAGAGGAGATTTGGGTGGG - Intergenic
1081373534 11:42333300-42333322 AATGGACATGAGATTTGGGAGGG - Intergenic
1081414770 11:42801077-42801099 ACTCGAAATGAGATTTGGGAGGG + Intergenic
1081452430 11:43184354-43184376 ATTGGAGATGAGATTTGGGTGGG + Intergenic
1082572185 11:54757067-54757089 ATTTGAAAGGATATTTGGGAGGG + Intergenic
1082835867 11:57649784-57649806 ATTGGGAAGGGGATGGGGGTGGG + Intronic
1082900594 11:58246466-58246488 ATTGGGAAGATGAGGTGGGAGGG - Intergenic
1082939674 11:58691153-58691175 GTTGGGGAGCAGCTTTGGGAGGG - Intronic
1082999367 11:59277601-59277623 CTTGTGAAGTAGATTTGTGAGGG + Intergenic
1083788557 11:64969147-64969169 CTAGGGAAAGAGATTTGGGGTGG + Intronic
1084005873 11:66323232-66323254 ATTGGGAATGAGACTTGGAGAGG + Intergenic
1084237837 11:67799550-67799572 TTTGGAGGGGAGATTTGGGATGG + Intergenic
1084468450 11:69341047-69341069 TTTGGGATGCAGATTTGGGATGG + Intronic
1084479397 11:69409989-69410011 CGTGGGAAGGAGAGTGGGGAGGG - Intergenic
1084734224 11:71094082-71094104 ATTCGAATTGAGATTTGGGAGGG - Intronic
1085039890 11:73320766-73320788 ATTGGGAAGTTGAGGTGGGAGGG - Intronic
1085119628 11:73958788-73958810 ACTGGGAAGGACCTCTGGGAGGG - Intronic
1085216462 11:74836973-74836995 ACTGGGAATGAGATTTGGAACGG + Exonic
1085498850 11:76998676-76998698 ATTGGGAAGGCTATTTTGGTAGG + Intronic
1086059399 11:82684877-82684899 ATTGGAGAGGAGATTTGGCTGGG - Intergenic
1087537397 11:99466313-99466335 ATTCGACATGAGATTTGGGAGGG + Intronic
1087818455 11:102684709-102684731 ATTGGAGATGAGATTTGGGTGGG + Intergenic
1088141212 11:106618666-106618688 ATTAGACAGGAGATTTGGGTGGG + Intergenic
1088199584 11:107317152-107317174 ATTAAAAAGGAGATTTGGGCCGG - Intergenic
1089019211 11:115194796-115194818 ATTGGGGAGGAGGGTGGGGAAGG + Intronic
1089138716 11:116269824-116269846 AGTGGGAAGGAGACTGGGGCAGG - Intergenic
1089651223 11:119914635-119914657 AGTGGGAGAGAGAGTTGGGAAGG - Intergenic
1090260861 11:125318726-125318748 ATTTGAAATGAGATTTGGGTAGG - Intronic
1090502992 11:127279923-127279945 ATTGGAAAGGATATATAGGAAGG + Intergenic
1091872738 12:3908473-3908495 GTGGGGAAGGAGATGGGGGAAGG - Intergenic
1092408511 12:8237147-8237169 TTTGGAGGGGAGATTTGGGATGG + Intergenic
1092479106 12:8844223-8844245 GTTGGGAGGGAGAGTGGGGAGGG + Intronic
1094241539 12:28231476-28231498 TTTGGGAAAGAGTTTTGAGATGG + Intronic
1094392989 12:29973457-29973479 ATTGGACATGAGATTTGGGCAGG - Intergenic
1094397221 12:30020782-30020804 ATTTGAAATGAGATTTGGGCAGG + Intergenic
1095310953 12:40695888-40695910 AATGGGAGGGAGATTAGGAATGG - Intronic
1095313308 12:40726631-40726653 ATTGGAAGTGAGATTTGGGTGGG + Intronic
1095395552 12:41758153-41758175 ATTGGAGATGAGATTTGGGTAGG + Intergenic
1095502719 12:42858193-42858215 AATTGGAAGGAGATTTTGGTAGG + Intergenic
1095599101 12:43994799-43994821 ACTGGGAAGAGGAATTGGGATGG + Intronic
1096541080 12:52307534-52307556 ATTGGGAGGGAAATGTGGGGTGG + Intronic
1097139395 12:56887206-56887228 ATTGGACATGAGATTTGGGCAGG - Intergenic
1097622759 12:61961292-61961314 TTTGGACATGAGATTTGGGAAGG + Intronic
1097652563 12:62319333-62319355 ATTTGGCATGAGATTTGGGTGGG + Intronic
1097653889 12:62337877-62337899 ATCAGGATGGAGATTTGGGTTGG + Intronic
1099199104 12:79654864-79654886 ATTCGAAATGAGATTTGGGTGGG + Intronic
1099247483 12:80211678-80211700 ATTAGGAAGGAACTTTGAGATGG - Intronic
1099255804 12:80309840-80309862 TTCAGGAAGGAGATGTGGGATGG + Intronic
1099397496 12:82159028-82159050 ATTGGAGAGGAGATTTGGGTGGG - Intergenic
1099526135 12:83721207-83721229 CTTGGGAAATAGATTTGTGAGGG + Intergenic
1099568039 12:84278037-84278059 ATTGGAAATGAGATTTGGGTGGG + Intergenic
1099820955 12:87709217-87709239 ATTGAAAATGAGATTTGGGTGGG + Intergenic
1099911336 12:88838260-88838282 AAAGGGCATGAGATTTGGGAGGG - Intergenic
1100159781 12:91844331-91844353 AAAGGGCATGAGATTTGGGAGGG + Intergenic
1100461001 12:94799121-94799143 ATTGGGAAGGAGACTTTGTGTGG + Intergenic
1100535002 12:95500004-95500026 ATTCGAGAGGAGATTTGGGTGGG + Intronic
1100598043 12:96088431-96088453 ATTGGAGACGAGATTTGGGAGGG - Intergenic
1100658529 12:96672436-96672458 ATTGGGTTGGAGATTTCAGAAGG + Intronic
1100690635 12:97035195-97035217 ATCAGGCAGGAGTTTTGGGAAGG + Intergenic
1100782702 12:98046502-98046524 TTTGGGAAGGAGAGGTGGGTGGG - Intergenic
1100806697 12:98292898-98292920 ACTGGAAAAGAGATTTGAGAGGG - Intergenic
1100810177 12:98329977-98329999 ATTGGAGATGAGATTTGGGTGGG + Intergenic
1101316982 12:103638294-103638316 ATTGAAAGGGAGAATTGGGATGG - Intronic
1101919570 12:108921447-108921469 GTGGGGAAGTAAATTTGGGAAGG + Intronic
1102164930 12:110798554-110798576 ATTGGAGATGAGATTTGGAAGGG + Intergenic
1102600087 12:114023000-114023022 ATTGAACATGAGATTTGGGAGGG + Intergenic
1102669059 12:114601684-114601706 ATTGGAGATGAGATTTGGGTGGG - Intergenic
1102671484 12:114623133-114623155 ATTGGAGATGAGATTTGGGTGGG - Intergenic
1102805662 12:115778033-115778055 TTTGGGAAGGAGAGTTGGGGAGG - Intergenic
1103272712 12:119687168-119687190 ATTTGGCAGGAGCTATGGGATGG + Exonic
1104115779 12:125747870-125747892 ATTGGAGATGAGATTTGGGTGGG - Intergenic
1104200137 12:126580636-126580658 ATTCGAAATGAGATTTGGGTGGG + Intergenic
1104210388 12:126683304-126683326 AAAGGACAGGAGATTTGGGAGGG - Intergenic
1104319397 12:127736028-127736050 ATTGAACAGGAGATTTGGGTGGG + Intergenic
1104617701 12:130284280-130284302 ATTCAGAATGAGATTTGGGTGGG - Intergenic
1105073764 12:133256134-133256156 ATTTGGCATGAGATTTGGGTGGG + Intergenic
1106894148 13:34279899-34279921 ATTGGACATGAGATTTGGGTGGG + Intergenic
1107153687 13:37141745-37141767 ATTGGAGATGAGATTTGGGTGGG - Intergenic
1107245167 13:38285532-38285554 ACTGGGAAGGAGATATGCTATGG + Intergenic
1107278452 13:38705004-38705026 ATTCGAAATGAGATTTGGGTGGG + Intronic
1107330554 13:39295448-39295470 ATTGGAGATGAGATTTGGGTGGG - Intergenic
1107436612 13:40385987-40386009 AAGGGGAAGGAGACCTGGGAAGG - Intergenic
1108196128 13:47997345-47997367 ATTGGGAAGGATTTTTGGTTTGG - Intronic
1108219389 13:48217475-48217497 TTTGGAAATGAGATTTGGGCAGG + Intergenic
1108331955 13:49395814-49395836 AATGGAAAGGAGAGTTGGCAGGG + Intronic
1108503533 13:51089364-51089386 ATTCAGAATGAGATTTGGGTAGG - Intergenic
1108623046 13:52202766-52202788 AATGGGAAGGAGACTAGCGAAGG - Intergenic
1108663679 13:52608276-52608298 AATGGGAAGGAGACTAGCGAAGG + Intergenic
1108981947 13:56524834-56524856 ATTGGATATGAGATTTGGGTGGG + Intergenic
1109337281 13:61008809-61008831 ATTGAAAATGAGATTTGGGTGGG - Intergenic
1109342886 13:61084240-61084262 ATTTGGCATGAGATTTGGGCAGG + Intergenic
1109525543 13:63569556-63569578 ATTGGGAAGGTGCTTTGACATGG - Intergenic
1109875939 13:68404808-68404830 TTTGGATATGAGATTTGGGAGGG - Intergenic
1109962280 13:69645908-69645930 ATTTGAAATGAGATTTGGGCAGG - Intergenic
1109991208 13:70059980-70060002 ATTTGGCATGAGATTTGGGCAGG + Intronic
1110395770 13:75028163-75028185 ACTGGGAAGGTGATTTGGTTTGG + Intergenic
1110743341 13:79023282-79023304 ATTGGGAAGAAAAAATGGGATGG + Intergenic
1110765978 13:79279839-79279861 ATTTGGCATGAGATTTGGGTCGG - Intergenic
1110973671 13:81801177-81801199 ATTGTGATGGAGATATGTGAAGG + Intergenic
1111050762 13:82881302-82881324 ATTTGAAATGAGATTTGGGTGGG - Intergenic
1111050999 13:82883212-82883234 ATAGGTCATGAGATTTGGGAGGG + Intergenic
1111083608 13:83343743-83343765 ATTGAAAATGAGATTTGGGTGGG - Intergenic
1111410349 13:87868046-87868068 ATTCAGAATGAGATTTGGGTGGG + Intergenic
1111553576 13:89849584-89849606 ATTGGAGATGAGATTTGGGTGGG + Intergenic
1111980240 13:95007662-95007684 ATTGGAGATGAGATTTGGGTGGG + Intergenic
1112025034 13:95403965-95403987 ATTCGACAGGAGATTTGGGCGGG + Intergenic
1112105122 13:96231654-96231676 ATTGGACATGAGATTTGGGCAGG + Intronic
1112743118 13:102496790-102496812 ATTTGATATGAGATTTGGGAGGG + Intergenic
1112917977 13:104574343-104574365 ATTGAGCATGAGATTTGGGTGGG - Intergenic
1113060878 13:106321751-106321773 ATTATGCATGAGATTTGGGAGGG - Intergenic
1113221934 13:108114715-108114737 ATTTGAAATGAGATTTGGGTGGG - Intergenic
1113496818 13:110737560-110737582 ATTGGAGAAGAGATTTGGGTGGG - Intergenic
1114282976 14:21211668-21211690 ATTGGGAAGGGTATTTGTGTGGG - Intronic
1114367996 14:22050758-22050780 ATTTGAAATGAGATTTGGGTGGG + Intergenic
1114616484 14:24071450-24071472 ATTGGGAGGGAGAAGAGGGAAGG - Intronic
1114625333 14:24125296-24125318 ATGGGAAAGGAGATCTGGCACGG - Intronic
1115034923 14:28845713-28845735 AGTGGGAAGGGGGTCTGGGATGG - Intergenic
1115217933 14:31030962-31030984 ATTGGAGATGAGATTTGGGTCGG - Intronic
1115471376 14:33772031-33772053 ATTTGGAAGAAAATTTGGGAGGG - Intronic
1115710629 14:36046933-36046955 ATGGGGAAGCATAATTGGGAGGG - Intergenic
1115962625 14:38852717-38852739 GTTGGAAAAGAGATTTGGGCTGG + Intergenic
1116054401 14:39845192-39845214 ATTAGGAAGGAGTTCTGGGGAGG + Intergenic
1116235230 14:42271606-42271628 ATTCGAAATGAGATTTGGGTGGG - Intergenic
1116590010 14:46760575-46760597 ATTTGGGAGGACAGTTGGGAAGG - Intergenic
1116811259 14:49541914-49541936 ATTTGATAGGAGATTTGGGCAGG - Intergenic
1116909171 14:50439842-50439864 AATGGGAAGAAACTTTGGGAAGG - Intronic
1117004215 14:51402334-51402356 CGTGGGAATGAGATTTGGGTGGG - Intergenic
1117297121 14:54390827-54390849 ATTGGGATGGAGACAAGGGATGG - Intergenic
1117455406 14:55892044-55892066 AGTGAGGAGGAAATTTGGGATGG + Intergenic
1117506260 14:56406015-56406037 ATTTGAAATGAGATTTGGGTGGG + Intergenic
1118519913 14:66571357-66571379 ATTCGAAATGAGATTTGGGTGGG + Intronic
1118524439 14:66623337-66623359 ATTGAGGATGAGATTTGGGTGGG + Intronic
1118965897 14:70584965-70584987 TTTGGGAGGGAGATATGGGTGGG + Intronic
1118981209 14:70718495-70718517 ATTGTGATGGGCATTTGGGAAGG + Intergenic
1119429647 14:74558024-74558046 ACTGGGGTGGAGATTTGGGGAGG - Intronic
1120146325 14:80982507-80982529 ATTGGGAACTGGTTTTGGGAAGG + Intronic
1120352989 14:83386883-83386905 ATTGGGTATGAGATTTAGGTGGG + Intergenic
1120388486 14:83876097-83876119 ATTTGACATGAGATTTGGGATGG - Intergenic
1120556247 14:85932379-85932401 CTTGGGAAATAGATTTGTGAGGG - Intergenic
1120568028 14:86083237-86083259 ATTTGAGAGGAGATTTGGGTGGG + Intergenic
1120707760 14:87762034-87762056 ATTTGAAATGAGATTTGGGTGGG - Intergenic
1120983376 14:90311015-90311037 ATTGGGAAGGAAATTTTAGTTGG + Intronic
1121238103 14:92407778-92407800 ATTCGGCATGAGATTTGGGCAGG + Intronic
1121478550 14:94238509-94238531 ATTGGGGGAGAAATTTGGGATGG + Intronic
1121502244 14:94447492-94447514 ATTTGGAAGGTGGTTTGGAAGGG - Intronic
1121517995 14:94566389-94566411 AGTGGGGAGGACATTTGAGAAGG - Intronic
1122086343 14:99309325-99309347 ATTCAGCAGGAGATTTGGGCTGG - Intergenic
1124171245 15:27375781-27375803 ATTCAGAATGAGATTTGGGTGGG + Intronic
1124793577 15:32753688-32753710 TTTTAGAAGGTGATTTGGGAGGG + Intergenic
1125281613 15:38047703-38047725 ATTGGACATGAGATTTGGGTGGG + Intergenic
1125426739 15:39556452-39556474 AAAGGGAAGGAGATGTGGGGTGG + Intergenic
1125919977 15:43519573-43519595 ATTGGAAAGGGGATTTGGCAAGG + Intronic
1126815374 15:52448608-52448630 ATTTGGCATGAGATTTGGGTTGG - Intronic
1127044675 15:55013108-55013130 ATTGGAGATGAGATTTGGGTAGG - Intergenic
1127602257 15:60549742-60549764 ATTGGGAAGGAGATGGGAGGGGG - Intronic
1128290518 15:66475062-66475084 TTGGGGAAGGAAATTTGGGTGGG + Intronic
1128709975 15:69864409-69864431 ATCGGGAATTAGGTTTGGGAGGG + Intergenic
1128795754 15:70465388-70465410 AATGGGAAGCAGGTTTGGGCAGG - Intergenic
1128985450 15:72217247-72217269 AGAGGGAAGGAGAGTAGGGATGG + Intronic
1130625949 15:85514989-85515011 ACTGGGAAATAAATTTGGGAAGG + Intronic
1131653414 15:94427639-94427661 ATTGGAGATGAGATTTGGGTGGG + Intronic
1132230800 15:100182384-100182406 ATTTGAAATGAGATTTGGGTGGG + Intronic
1133050055 16:3112534-3112556 ATGGGGAATGGGATCTGGGAGGG + Intergenic
1133336606 16:5010739-5010761 ATTAGGAAAGGGATTTGGGCCGG - Intronic
1133755242 16:8757679-8757701 AGAGGGAAGGAGAGGTGGGAGGG + Intronic
1134038103 16:11047463-11047485 ATGGGGAAGCAGATTTAGAATGG + Intronic
1134243404 16:12522476-12522498 ATTCGACAGGAGATTTGGGTAGG - Intronic
1134303165 16:13009336-13009358 ATTGGGAAGGACATTCAGGAAGG + Intronic
1134336307 16:13302745-13302767 ATTCAGGAGGAGATTTGGGTGGG - Intergenic
1134527869 16:14958198-14958220 ATTCGGCATGAGATTTGGGCAGG - Intergenic
1134657781 16:15960186-15960208 CTTGGGAGGGTGAGTTGGGAGGG - Intronic
1134801643 16:17090255-17090277 ATTGGAGATGAGATTTGGGTGGG - Intergenic
1135686350 16:24501143-24501165 ATTTGGCATGAGATTTGGGTGGG - Intergenic
1135732186 16:24904212-24904234 ATTGGAGATGAGATTTGGGTGGG + Intronic
1136023526 16:27455398-27455420 TCTGGGAAGGAGATTGGGAAGGG - Intergenic
1136076234 16:27819374-27819396 ATGGGGATGGGGTTTTGGGATGG - Intronic
1136930253 16:34411808-34411830 ATGGGAAAGGAGAGATGGGAGGG + Intergenic
1136974321 16:34999997-35000019 ATGGGAAAGGAGAGATGGGAGGG - Intergenic
1137313096 16:47286085-47286107 CCTGGGAAGGAGATCTGAGATGG + Intronic
1137544656 16:49393186-49393208 AATGGGAGGGAGATGTGGGTTGG - Intronic
1137905267 16:52315188-52315210 AGACGGAAGGAGATTGGGGATGG - Intergenic
1137932448 16:52601985-52602007 ATTGGAGATGAGATTTGGGTGGG - Intergenic
1138149264 16:54640899-54640921 ATTTAGCAGGAGATTTGGGTGGG - Intergenic
1138579313 16:57929815-57929837 ATTCGAGAGGAGATTTGGGTGGG + Intronic
1139041171 16:63000987-63001009 ATTGGAGATGAGATTTGGGTGGG - Intergenic
1139333384 16:66211735-66211757 AATGGGAAGGGGCTTTGGAAAGG + Intergenic
1139363267 16:66416783-66416805 CATGGGAAGTGGATTTGGGAAGG - Intergenic
1139425420 16:66876796-66876818 ATTTGAAATGAGATTTGGGTGGG + Intergenic
1140331174 16:74058510-74058532 ATTTGAAATGAGATTTGGGTGGG - Intergenic
1140344014 16:74194735-74194757 ATTGAGGAGGACATTTGAGATGG - Intergenic
1140491258 16:75337820-75337842 ATTGGACAAGAGATTTGGGCGGG + Intronic
1140956966 16:79874933-79874955 ATTGGGATTGGGAATTGGGATGG + Intergenic
1141047998 16:80734542-80734564 ATAGGGAAGCAGGTTTGGGAAGG + Intronic
1141108139 16:81250316-81250338 ATTGGGATGGAGAGATGGGGAGG - Intronic
1141264885 16:82487914-82487936 ATTGGCAAGGATGTTTTGGATGG + Intergenic
1142938880 17:3364010-3364032 ATTCGACATGAGATTTGGGAGGG + Intergenic
1143434894 17:6916069-6916091 ATTCAGAAGGAGATTCAGGAGGG + Intronic
1143737915 17:8926725-8926747 ATTGGAGATGAGATTTGGGTGGG + Intronic
1144225540 17:13141497-13141519 AGAGGGAAGGAGAGATGGGAAGG - Intergenic
1144498095 17:15762913-15762935 AAAGGGCATGAGATTTGGGAGGG + Intergenic
1144831306 17:18132666-18132688 AAGGTGAAGGAGATTTGGGGAGG + Intronic
1145018011 17:19411482-19411504 ATCGGGAAGGAGAGTGGGGTGGG + Intronic
1145161469 17:20577954-20577976 AAAGGGCATGAGATTTGGGAGGG + Intergenic
1145831120 17:27917065-27917087 ATTAGAGAGGAGATTTGGGTGGG + Intergenic
1146001119 17:29131087-29131109 ATTGGGGAGGAGGTTAGGGGAGG + Intronic
1146412994 17:32604688-32604710 ATTAGAAGGCAGATTTGGGATGG - Intronic
1146471479 17:33128435-33128457 ACTGGGAAGCAGAATGGGGATGG + Intronic
1146717792 17:35100891-35100913 ACTGGGAAGAAAAGTTGGGAGGG + Exonic
1147035768 17:37679368-37679390 ATTTGACAGGAGATTTGGGCGGG - Intergenic
1147550794 17:41440107-41440129 ATTGGGATGGAGGGTGGGGAAGG + Intronic
1148628477 17:49088536-49088558 ATTCGGCATGAGATTTGGGTGGG + Intergenic
1148879030 17:50711353-50711375 TTTAGGAAGGAGATCTGGGCTGG + Intergenic
1149222549 17:54432072-54432094 ATTCGAAATGAGATTTGGGTGGG + Intergenic
1149513161 17:57258829-57258851 ATTTGGAATGTGCTTTGGGAAGG + Intronic
1149718685 17:58820212-58820234 ATTGGACATGAGATTTGGGTGGG + Intronic
1149862095 17:60127672-60127694 AGTGGAAGGGAGATTGGGGAAGG + Intergenic
1150516094 17:65810907-65810929 ATTGCAGAGTAGATTTGGGATGG + Intronic
1151041162 17:70862055-70862077 ATTAGAGATGAGATTTGGGAGGG - Intergenic
1151124137 17:71826793-71826815 ATTCGAAATGAGATTTGGGTGGG + Intergenic
1151426377 17:74033485-74033507 CTTGGGCACTAGATTTGGGAGGG - Intergenic
1152331722 17:79677485-79677507 ATTTGACAGGAGATTTGGGTGGG + Intergenic
1152958292 18:59128-59150 ATTGGGAATTACATTTGGGAGGG + Intronic
1153601596 18:6786064-6786086 ATTGGGAGGAACAATTGGGAGGG + Intronic
1154005572 18:10524808-10524830 ATTGTGTAGGAGTTTTGAGAAGG + Intergenic
1154239372 18:12638633-12638655 ATTGAACAGGAGATTTGGGTGGG - Intronic
1155088737 18:22485224-22485246 ATTGTGTAGGTGATTTGGGCAGG + Intergenic
1155567120 18:27147529-27147551 AGTGGGAAGGAGATAGAGGATGG - Intronic
1156090794 18:33466456-33466478 ATTGAACATGAGATTTGGGAGGG - Intergenic
1156122827 18:33865036-33865058 ATTTGAAATGAGATTTGGGTGGG + Intronic
1156303618 18:35856797-35856819 CTTGTGAAGTAGATTTGTGAGGG + Intergenic
1156329242 18:36103932-36103954 ATTTGACATGAGATTTGGGAGGG - Intergenic
1156700428 18:39818381-39818403 GTTGAGAAGCAGATTTTGGAGGG + Intergenic
1157261870 18:46182499-46182521 CTTGGGAGGCAGAGTTGGGAGGG + Intronic
1157423820 18:47568274-47568296 ATTGGGAAGCAGAGAGGGGATGG + Intergenic
1158449072 18:57547330-57547352 ATTTGAAATGAGATTTGGGTGGG - Intergenic
1158871669 18:61694094-61694116 ATAGGGAAGGGCATGTGGGAAGG + Intergenic
1158879165 18:61760220-61760242 ATTGGAGATGAGATTTGGGTGGG - Intergenic
1159400985 18:67933965-67933987 ATTGGAGAGCAGATTTGGGTGGG - Intergenic
1159803193 18:72925201-72925223 ATTGGAGATGAGATTTGGGTGGG + Intergenic
1160042295 18:75356935-75356957 ATTTGGCAGGAGATTTGGGTGGG - Intergenic
1160390411 18:78527237-78527259 ATTTGCCAGGAGATTTGGGGTGG - Intergenic
1160426066 18:78780095-78780117 GTTGGGAAGGAGACCTGGAAGGG - Intergenic
1160951276 19:1668816-1668838 ATGGGGAAGGAGAATTTCGAAGG + Intergenic
1161313642 19:3607909-3607931 AATGGGATAGAGCTTTGGGAGGG - Intergenic
1161674275 19:5635177-5635199 ATTGGCAAGGGTATTGGGGAAGG + Intronic
1162129941 19:8520240-8520262 TTTGGGATGCAGATTTTGGAAGG + Intergenic
1162219592 19:9164844-9164866 ATTTGAAAGGGGATTTGGGGAGG + Intergenic
1163385673 19:16998555-16998577 ACTGAGAAGGAGCTTTGGGTGGG + Intronic
1163517259 19:17772547-17772569 ATTGGGCAGGTGAGTTGGGCAGG + Exonic
1164004051 19:21133043-21133065 CTTGCCAAGGAGATCTGGGAAGG + Intergenic
1166459573 19:42974373-42974395 ATGGGGATGGAGAATTGGAATGG - Intronic
1167772385 19:51529521-51529543 CTTGGGGAGGAGATTCTGGAGGG - Intronic
1167805796 19:51783952-51783974 ATTATGATGGAGATTTGGGAGGG - Intronic
1168651907 19:58097355-58097377 ATGGGGAAGGAGTGATGGGAGGG + Intronic
925435649 2:3835319-3835341 ATTGCTAAGGAGATTTGAGGTGG + Intronic
925847956 2:8050834-8050856 ATTTGACAGGAGATTTGGGTGGG - Intergenic
925990578 2:9251151-9251173 ATCGCGAAGGAGATTTTGAAAGG + Intronic
926606152 2:14900540-14900562 ATAGGTGCGGAGATTTGGGAAGG - Intergenic
926892676 2:17651329-17651351 TTTGGGAGGGTGATTTGGGGAGG + Intronic
927303063 2:21537864-21537886 ATTGAGCATGAGATTTGGGTGGG + Intergenic
927389182 2:22573846-22573868 ATTGGGAAGGGAAGTAGGGAGGG + Intergenic
928239115 2:29571291-29571313 ATTGGAGATGAGATTTGGGTGGG - Intronic
930672681 2:54167992-54168014 ATTGGGATGGAGAAATGGGATGG - Intronic
930934305 2:56929103-56929125 ATTCGGCATGAGATTTGGGTGGG - Intergenic
930969263 2:57374797-57374819 ATTGGGAGGGAATTCTGGGAAGG - Intergenic
931240919 2:60452011-60452033 AATGGGCAGGAGATGTAGGAGGG - Intronic
931582517 2:63792460-63792482 ATTTGGGATGAGATTTGGGTGGG + Intronic
931942847 2:67272023-67272045 ATGGGGAGGGAGCTTTGGAATGG - Intergenic
932080229 2:68707500-68707522 ATTTGACAGGAGATTTGGGTGGG + Intronic
932617721 2:73245740-73245762 AGTGGGAATGCAATTTGGGAGGG - Intronic
932737459 2:74264269-74264291 ATTGAGAAGCAGATTGAGGATGG - Exonic
932757720 2:74420399-74420421 ATTTGGAAGTACATTTTGGAAGG - Intronic
933776467 2:85774125-85774147 CTTGGGCAGGAGACATGGGAGGG - Intronic
934098959 2:88633563-88633585 ATTTGAAATGAGATTTGGGTGGG - Intergenic
934164132 2:89278964-89278986 TTTGGGGAGGAGATTTGGCAAGG - Intergenic
934203142 2:89903560-89903582 TTTGGGGAGGAGATTTGGCAAGG + Intergenic
935690521 2:105727260-105727282 ATTCGAGATGAGATTTGGGAGGG + Intergenic
935810211 2:106790253-106790275 AGTGGAAAGGAGCTCTGGGAAGG - Intergenic
936727329 2:115335266-115335288 ATTGAAAATGAGATTTGGGTAGG + Intronic
936736355 2:115447439-115447461 AAAGGGCATGAGATTTGGGAGGG + Intronic
936768304 2:115880289-115880311 GTTGGAAAGGAGATTTGGGTGGG + Intergenic
936839538 2:116753533-116753555 ATGGGGAAGGAAGGTTGGGAGGG - Intergenic
937666628 2:124495393-124495415 ATTAAAAAGTAGATTTGGGAGGG + Intronic
937679922 2:124633062-124633084 ATTGAACAGGAGATTTGGGCAGG + Intronic
937923377 2:127147841-127147863 ATTGGGAGGGGTATTGGGGATGG - Intergenic
938150698 2:128879961-128879983 AGTGGGAAGGGGAGTTGGAAAGG + Intergenic
938218703 2:129546410-129546432 ATTGGACATGAGATTTGGGTGGG + Intergenic
938775613 2:134538823-134538845 ATGGGGAAGGAGACCTGGGAGGG + Intronic
939078437 2:137630425-137630447 ATGGGGAAGAAGTTTGGGGATGG - Intronic
939237016 2:139507716-139507738 AATGGGAAGGGGATATGGGTCGG + Intergenic
939256363 2:139749172-139749194 AGAGGGAAGGGGATTTGGGAAGG - Intergenic
939826522 2:147022566-147022588 ATTTGAAATGAGATTTGGGTGGG + Intergenic
939935474 2:148287405-148287427 GTAGGGAAGGATATTTGAGAAGG + Intronic
940359320 2:152780585-152780607 ATCGGGTATGAGATTTGGGTGGG + Intergenic
940402767 2:153266741-153266763 ATTGGAGATGAGATTTGGGTGGG + Intergenic
940505810 2:154551689-154551711 ATTTGACATGAGATTTGGGAGGG - Intergenic
941734319 2:168956296-168956318 ATTTGGCATGAGATTTGGGTGGG + Intronic
942203129 2:173592328-173592350 ATTTGACAGGAGATTTGGGTGGG + Intergenic
942442252 2:176048853-176048875 ATTCGAAATGAGATTTGGGTGGG - Intergenic
943474785 2:188340806-188340828 AGTGGGAAGGGGAGTTGGAAAGG + Intronic
943833107 2:192487224-192487246 ATTCGGGATGAGATTTGGGTTGG - Intergenic
944530114 2:200659384-200659406 ATGGGGAAGGAGATATGAGTTGG - Intronic
944545000 2:200790407-200790429 ATAGGGAAGGCCCTTTGGGAAGG + Intergenic
945724703 2:213462487-213462509 ATTCGGGATGAGATTTGGGTAGG - Intronic
945799216 2:214404820-214404842 ATTTGGCTGGAGATATGGGAAGG + Intronic
945827173 2:214736398-214736420 ATTGGGAAGGAGATTTGGGAAGG - Intronic
945993529 2:216416429-216416451 AGTGGGAAGGAGTGTTGGGGGGG - Intronic
946632279 2:221683237-221683259 ATTGAGAATGAGATTTGGGTGGG + Intergenic
947972983 2:234339536-234339558 ATTTGAGATGAGATTTGGGAGGG + Intergenic
948095338 2:235328994-235329016 ATTGAGAAGGGGATTGAGGAGGG + Intergenic
1169489857 20:6062224-6062246 ATTGGAAAGGAGAGTGGAGATGG + Intergenic
1169846748 20:10002069-10002091 TTTGGGAAGGAAACTTGGCAGGG + Intronic
1170010127 20:11713838-11713860 ATTGGGAAGCAGATGTGGGAGGG + Intergenic
1170363465 20:15573717-15573739 ATAGGGAAGGAGATTCAGAAGGG - Intronic
1171293347 20:23995012-23995034 ATGGGGAAGGAGGTTGGGGAGGG + Intergenic
1171993129 20:31712104-31712126 ATAGGCACTGAGATTTGGGAGGG - Intronic
1172416300 20:34771225-34771247 CTTGGGAAGCTGATGTGGGAAGG - Intronic
1172429113 20:34875853-34875875 ATCTGGATGGAGATTTGTGAAGG + Intronic
1173038963 20:39442134-39442156 ATTCAGTAGGAGATTTGGGTGGG + Intergenic
1173073632 20:39794905-39794927 ATTGTGACTGAGATTTGGCAGGG - Intergenic
1173239992 20:41286752-41286774 ATTTGAGAGGAGATTTGGGTGGG - Intronic
1173329226 20:42060449-42060471 ATTCAGGAGGAGATTTGGGTGGG - Intergenic
1173610136 20:44361110-44361132 GATGGGAAGGTGATGTGGGAGGG - Intronic
1173799730 20:45887379-45887401 ATTGGCAAGGATGTTTGGAATGG + Intronic
1173962613 20:47086701-47086723 ATTTGACAGGAGATTTGGGCGGG + Intronic
1174564079 20:51452268-51452290 CAGGGGAAGGAGACTTGGGAAGG - Intronic
1174680224 20:52399399-52399421 ATTTGAGAGGGGATTTGGGAAGG + Intergenic
1174855627 20:54042618-54042640 CTAAGGAAGGAAATTTGGGATGG + Intronic
1174925150 20:54750946-54750968 ATTCGACACGAGATTTGGGAGGG + Intergenic
1175172729 20:57091570-57091592 ATGGGGAAAGAGATGAGGGAAGG - Intergenic
1175255757 20:57646033-57646055 AATGGATATGAGATTTGGGAGGG + Intergenic
1175652426 20:60737193-60737215 ATTTGACATGAGATTTGGGAGGG - Intergenic
1177233307 21:18351387-18351409 ATTGGAGATGAGATTTGGGTGGG - Intronic
1177275658 21:18910084-18910106 ATTGGAGATGAGATTTGGGTGGG - Intergenic
1177641811 21:23853459-23853481 CCTGGGCTGGAGATTTGGGAAGG + Intergenic
1177649016 21:23936866-23936888 ATTGGAGATGAGATTTGGGTGGG - Intergenic
1177895135 21:26847676-26847698 TTTGAGATGGAGATTTGAGATGG + Intergenic
1178468370 21:32869720-32869742 ATTTGAGATGAGATTTGGGAGGG - Intergenic
1179193424 21:39142884-39142906 ATTGGAGATGAGATTTGGGTGGG - Intergenic
1179285119 21:39970674-39970696 ACAGGGAAAGAAATTTGGGATGG - Intergenic
1179318812 21:40270603-40270625 ATTGAGCATGAGATTTGGGTAGG - Intronic
1179328006 21:40368805-40368827 TTTGAGATGGATATTTGGGATGG + Intronic
1180614458 22:17118845-17118867 AATGGGTAGGAGATCTGGGGAGG - Exonic
1180824408 22:18852727-18852749 ATGGGGAAGGAGGTTGGGGAGGG + Intronic
1181124833 22:20695881-20695903 ATGGGGAAGGAGGTTGGGGAGGG + Intergenic
1181188326 22:21121821-21121843 ATGGGGAAGGAGGTTGGGGAGGG - Intergenic
1181210872 22:21288672-21288694 ATGGGGAAGGAGGTTGGGGAGGG + Intergenic
1181398636 22:22638216-22638238 ATGGGGAAGGAGGTTGGGGAGGG - Intergenic
1181501369 22:23317572-23317594 ATGGGGAAGGAGGTTGGGGAGGG - Exonic
1181650784 22:24257843-24257865 ATGGGGAAGGAGGTTGGGGAGGG + Intergenic
1181706598 22:24652896-24652918 ATGGGGAAGGAGGTTGGGGAGGG - Intergenic
1182292223 22:29289075-29289097 TGTGGGTAGTAGATTTGGGATGG + Intronic
1182515274 22:30855101-30855123 ATTCAGAATGAGATTTGGGTGGG + Intronic
1182868052 22:33622138-33622160 ATTCGAAATGAGATTTGGGTGGG - Intronic
1183003492 22:34880758-34880780 TTTGTAAAGGAGATTTTGGAGGG + Intergenic
1183312506 22:37118312-37118334 ATTTGAAATGAGATTTGGGTGGG + Intergenic
1184071160 22:42148223-42148245 ATTAGGAAGGAAATTTGGCTGGG + Intergenic
1184133946 22:42535030-42535052 GTTGGGAAGGAGAGATGAGAGGG + Intergenic
1185194498 22:49460615-49460637 ATGGGGAAGGAATTGTGGGATGG - Intronic
1203216075 22_KI270731v1_random:6758-6780 ATGGGGAAGGAGGTTGGGGAGGG - Intergenic
1203274546 22_KI270734v1_random:78631-78653 ATGGGGAAGGAGGTTGGGGAGGG + Intergenic
949239988 3:1859513-1859535 ATTTGGGATGAGATTTGGGTGGG - Intergenic
949323442 3:2837856-2837878 AGTGGGAAGCAAATTTGGTATGG - Intronic
950766215 3:15274998-15275020 ATTCGACAGGAGATTTGGGAGGG + Intronic
951106521 3:18750222-18750244 GTTGGGAGGCAGAATTGGGAGGG + Intergenic
951177459 3:19618488-19618510 AATGGACAGGAGATTTGGGAGGG - Intergenic
951317680 3:21205999-21206021 ATTGGTTTTGAGATTTGGGAGGG + Intergenic
951430265 3:22598063-22598085 ATTTGACATGAGATTTGGGAAGG - Intergenic
951781952 3:26373725-26373747 ATTTGGAATGAGATGTGGGTGGG - Intergenic
951788487 3:26452208-26452230 ATCTGGAAAGAGCTTTGGGAAGG + Intergenic
951799199 3:26576258-26576280 ATTTGGTATGAGATTTGGGTGGG + Intergenic
951937132 3:28034070-28034092 ATTTGACATGAGATTTGGGAGGG - Intergenic
952674146 3:36006832-36006854 ATTGGCAAGGAGAATGGGAATGG + Intergenic
953181001 3:40595383-40595405 ATTCGGGATGAGATTTGGGTGGG - Intergenic
953185086 3:40630136-40630158 ATTGGAGATGAGATTTGGGTTGG - Intergenic
953552416 3:43913901-43913923 ATTTGGCATGAGATTTGGGTGGG - Intergenic
955210147 3:56933799-56933821 ATTTGAGAGGAGATTTGGGTGGG - Intronic
955493210 3:59503847-59503869 CTCAGGAAGGAGATTTGGGCTGG - Intergenic
956153444 3:66267929-66267951 ACTGGGAAGGAGACTTTGGAGGG - Intronic
956474804 3:69608863-69608885 ATTGAAGAGGAGATTTGGGTGGG - Intergenic
956539476 3:70319778-70319800 AGTGGGAAGGAAATTTGGAAGGG + Intergenic
956634495 3:71350364-71350386 ATTGGGGAGGGGATTGGAGAAGG - Intronic
956912120 3:73828826-73828848 CTTGGGAAGGGGACATGGGAAGG + Intergenic
957026692 3:75190414-75190436 ATTTGGCATGAGATTTGGGTGGG + Intergenic
957053782 3:75429312-75429334 TTTGGAGGGGAGATTTGGGATGG + Intergenic
957326575 3:78703506-78703528 ATGGGGAAAGAGATTTGTTATGG - Intronic
957416980 3:79917601-79917623 AGTGGGAAGGGGAGTTGGGAGGG + Intergenic
958085137 3:88796737-88796759 ATTTGAGAGGAGATTTGGGTGGG + Intergenic
958429559 3:94021979-94022001 ATTGGAAAGGGGATGTGGTACGG - Intronic
958583764 3:96060425-96060447 ATTCGAAATGAGATTTGGGTGGG - Intergenic
959105142 3:102057159-102057181 ATTTGACATGAGATTTGGGAGGG + Intergenic
959234016 3:103694370-103694392 ATTGAGCAGGAGAATTAGGAAGG + Intergenic
959261413 3:104086232-104086254 ATTGTGAATGAGATTTGGAACGG - Intergenic
959450685 3:106496065-106496087 AAGGGGAAGGAGATCTGGGTAGG - Intergenic
959696473 3:109254064-109254086 ATTCGGCAGGAGATTTGGGTGGG - Intergenic
960865404 3:122194534-122194556 ACAGGGAAGGAGATTAGGAAGGG - Intronic
961301065 3:125922367-125922389 TTTGGAGGGGAGATTTGGGATGG - Intergenic
961398962 3:126620785-126620807 ATAGGGAAGTACAATTGGGAAGG - Intronic
961887459 3:130105706-130105728 TTTGGAGGGGAGATTTGGGATGG + Intronic
962152201 3:132904701-132904723 ATTGGACATGAGATTTGGGCAGG - Intergenic
962161828 3:133009204-133009226 ATTTGACAGGAGATTTGGGCAGG - Intergenic
962394379 3:135002179-135002201 ATTTGAGAGGAGATTTGGGTGGG - Intronic
963522913 3:146378719-146378741 ATTCGGGATGAGATTTGGGTGGG - Intergenic
964036751 3:152208442-152208464 ATTGGAGATGAGATTTGGGTGGG - Intergenic
964847484 3:161059660-161059682 ATTTGACATGAGATTTGGGAAGG - Intronic
966875171 3:184317444-184317466 GCTGGGTAGGAGATCTGGGAAGG - Exonic
967396693 3:189016579-189016601 ATTTGAAATGAGATTTGGGTGGG - Intronic
968483207 4:846051-846073 GTTTGGCAGGAGATTTGGGTGGG - Intergenic
968996585 4:3949624-3949646 TTTGGAGGGGAGATTTGGGATGG + Intergenic
969694405 4:8726422-8726444 GGTGGGAAGGAGAATTGAGAGGG + Intergenic
969757416 4:9159058-9159080 TTTGGAGGGGAGATTTGGGATGG - Intergenic
969817372 4:9696594-9696616 CTTGGAGGGGAGATTTGGGATGG - Intergenic
969976912 4:11112668-11112690 TTTGGGAAGGGGAGTTGGGAAGG - Intergenic
970537291 4:17042384-17042406 ATTTGAAATGAGATTTGGGTGGG + Intergenic
970770091 4:19601849-19601871 ATTTGGCATGAGTTTTGGGAGGG + Intergenic
970788964 4:19833774-19833796 AATGGGAAGAATACTTGGGAGGG - Intergenic
971111716 4:23592560-23592582 TTAGGATAGGAGATTTGGGAAGG + Intergenic
971498432 4:27292565-27292587 TTTGGGAAGGAGACTTGAGGAGG + Intergenic
971538124 4:27780324-27780346 ATTCAAAATGAGATTTGGGAGGG - Intergenic
971562293 4:28095358-28095380 ATTGGAGATGAGATTTGGGTGGG + Intergenic
971670149 4:29545965-29545987 ATTGGAGATGAGATTTGGGTGGG + Intergenic
972050501 4:34726518-34726540 CCTGGCAAGGATATTTGGGAGGG - Intergenic
972073400 4:35052984-35053006 ATTGGAGATGAGATTTGGGTGGG + Intergenic
972107855 4:35514081-35514103 ATTTGACATGAGATTTGGGAAGG - Intergenic
972268170 4:37482996-37483018 ATTCGGGATGAGATTTGGGTGGG - Intronic
973811277 4:54572521-54572543 ACTGGGAAAGAGACATGGGAAGG - Intergenic
974125782 4:57693707-57693729 AAAGGGCATGAGATTTGGGAGGG + Intergenic
974138532 4:57851404-57851426 ATTGGGAAATATATTTGTGAGGG + Intergenic
974155784 4:58070378-58070400 ATTGGGGAGGTGATTCAGGAAGG + Intergenic
974989272 4:69064285-69064307 ATGTTGAAGGAGTTTTGGGAGGG - Intronic
975093246 4:70427381-70427403 ATTCGAAATGAGATTTGGGTGGG - Intergenic
975982869 4:80179217-80179239 CTTGTGAAAGAGATTTGTGAGGG - Intergenic
976177689 4:82372025-82372047 ATTTGGAGGGAAAGTTGGGAGGG - Intronic
976457221 4:85262183-85262205 ATTTGAAATGAGATTTGGGTGGG + Intergenic
976820173 4:89197663-89197685 ACTGGGCATGAGATTTGGGAAGG - Intergenic
977030579 4:91877237-91877259 ATTCAGAATGAGATTTGGGTGGG - Intergenic
977200846 4:94113872-94113894 AGTGGAAAGGAGTTTTGGGAGGG - Intergenic
977268613 4:94886613-94886635 ATTGGGGAGGAGATTTGAAGAGG - Intronic
977989097 4:103419842-103419864 ATTCGAAATGAGATTTGGGTGGG + Intergenic
978340511 4:107717732-107717754 ATTGGGAAGTAGGTTGGGCACGG - Intronic
979357983 4:119728440-119728462 ATTTGGAAGTATATATGGGATGG + Intergenic
979734826 4:124070315-124070337 ATTGGACATGAGATTTGGGCAGG + Intergenic
980084613 4:128378344-128378366 ATTGGAGATGAGATTTGGGTAGG + Intergenic
980707500 4:136519306-136519328 ATTCGTGATGAGATTTGGGATGG + Intergenic
981523400 4:145688394-145688416 ATTGGATATGAGATTTGGGTGGG - Intronic
981646227 4:147001677-147001699 ATTGGAGATGAGATTTGGGTGGG + Intergenic
981696762 4:147566724-147566746 TTTGGGAAGCAGAGGTGGGAGGG - Intergenic
982354763 4:154453754-154453776 ATTGGGAGGGAAGTTTGTGAAGG - Intronic
982389529 4:154849161-154849183 ATTTGGGATGAGATTTGGGTGGG - Intergenic
982671047 4:158320409-158320431 AGTGGGAAGGGGAGCTGGGAAGG + Intronic
982723905 4:158885273-158885295 ATTGGAGATGAGATTTGGGTGGG + Intronic
983751444 4:171277714-171277736 ATTGTGAGGGAGATCGGGGAGGG - Intergenic
984080720 4:175246079-175246101 ATTTGACATGAGATTTGGGATGG + Intergenic
984339027 4:178429974-178429996 AGTGGGAAGGGGACTTGGGGTGG + Intergenic
984368422 4:178828846-178828868 AGTTGTGAGGAGATTTGGGAAGG + Intergenic
984484636 4:180352574-180352596 ATTTGACAGGAGATTTGGGTGGG + Intergenic
985007663 4:185550099-185550121 ATTGGACATGAGATTTGGGTAGG + Intergenic
986023854 5:3831421-3831443 ATTGGATATGAGATTTGGGTGGG - Intergenic
986145497 5:5073598-5073620 ATTGGACATGAGATTTGGGCAGG - Intergenic
986211695 5:5679455-5679477 ATTTGAGAGGAGATTTGGGTGGG + Intergenic
986250488 5:6053443-6053465 ATTAGACATGAGATTTGGGAGGG + Intergenic
986448635 5:7845262-7845284 ATTGGAGATGAGATTTGGGTGGG + Intronic
986692037 5:10321042-10321064 ATTTGACAGGAGATTTGGGTGGG + Intergenic
986779573 5:11052298-11052320 ATTGGGCAGAAGTTTTAGGAGGG - Intronic
986992185 5:13567322-13567344 AATGGGACAGAGAATTGGGATGG + Intergenic
987179815 5:15355806-15355828 ATTAGGGATGAGATTTGGGTGGG + Intergenic
987201615 5:15583329-15583351 TGTTGGAAAGAGATTTGGGAGGG - Intronic
987337647 5:16911224-16911246 ATTGTGAAGTAGTTTTGAGAGGG - Intronic
987433408 5:17864220-17864242 ATTCAGAATGAGATTTGGGTGGG - Intergenic
987751502 5:22044581-22044603 ATTTGTAATGAGATTTGGGTGGG + Intronic
987860301 5:23477781-23477803 ATTTGAAATGAGATTTGGGTGGG - Intergenic
987924561 5:24323725-24323747 ATTTGGGATGAGATTTGGGTGGG - Intergenic
988111663 5:26830645-26830667 ATTGGAGATGAGATTTGGGTGGG - Intergenic
988136403 5:27176447-27176469 ATTGGAGATGAGATTTGGGTGGG + Intergenic
988221048 5:28347844-28347866 ATTTGAGAGGAGATTTGGGTGGG - Intergenic
988227192 5:28427249-28427271 ATTTGAGATGAGATTTGGGAGGG - Intergenic
988870130 5:35380367-35380389 ATTGAAAATGAGATTTGGGTGGG - Intergenic
988944296 5:36180059-36180081 ATTGGGAAAGAGATTTGGTGAGG - Intronic
989191450 5:38673618-38673640 CATGGGGAGGACATTTGGGAGGG - Intergenic
989495133 5:42102799-42102821 ATTCAGAATGAGATTTGGGTGGG - Intergenic
989767571 5:45104690-45104712 ATTGGAGATGAGATTTGGGTGGG - Intergenic
990999926 5:61772438-61772460 ATTGGAAATGAGATTTTGGTGGG - Intergenic
991033296 5:62103957-62103979 CTTGTGAAGTAGATTTGTGAGGG + Intergenic
991122646 5:63033468-63033490 ATTCGGGATGAGATTTGGGTGGG - Intergenic
991293598 5:65058353-65058375 ATTGAAAATGAGATTTAGGAGGG - Intergenic
991340169 5:65600231-65600253 ACTGGAAATGAGATTTGGGCAGG + Intronic
991349342 5:65704749-65704771 ATTGAGATGGTGATTAGGGAGGG - Intronic
991350726 5:65718110-65718132 TTTGGGATAGAGATTAGGGAAGG + Intronic
991447875 5:66719311-66719333 ATTGGGAAGAAGATTCGTAAGGG - Intronic
991498569 5:67252819-67252841 ATTGGAGATGAGATTTGGGTGGG - Intergenic
991653646 5:68881848-68881870 ATGAGGAATAAGATTTGGGAGGG - Intergenic
991746434 5:69747169-69747191 ATTCGGCATGAGATTTGGTAAGG - Intergenic
991751271 5:69808072-69808094 ATTCGGCATGAGATTTGGTAAGG + Intergenic
991798035 5:70327114-70327136 ATTCGGCATGAGATTTGGTAAGG - Intergenic
991825812 5:70622483-70622505 ATTCGGCATGAGATTTGGTAAGG - Intergenic
991830559 5:70682966-70682988 ATTCGGCATGAGATTTGGTAAGG + Intergenic
992242624 5:74787503-74787525 TTTGCGAAAGAGATTTGTGAGGG + Intronic
992376728 5:76195187-76195209 ATATGGAAGGAGATGTGTGAAGG - Intronic
992529801 5:77643228-77643250 AGTAGGAAGGAGACCTGGGAGGG + Intergenic
992669087 5:79040925-79040947 AGTCAGATGGAGATTTGGGATGG - Intronic
993011458 5:82488211-82488233 CCTGGGGAGGAGATTTGAGAAGG + Intergenic
993176674 5:84495029-84495051 ATTGGAGATGAGATTTGGGTGGG + Intergenic
993559174 5:89382644-89382666 ATTGGACATGAGATTTGGGCAGG - Intergenic
994464499 5:100109525-100109547 TGTGGAAATGAGATTTGGGAGGG + Intergenic
994814654 5:104569718-104569740 AGTGCCAAGGAGATTTGGGCGGG - Intergenic
995492338 5:112706566-112706588 AGTGGGAAGGAGATGTGGTCGGG - Intergenic
996033326 5:118731184-118731206 ATTTGGGATGAGATTTGGGTGGG - Intergenic
997987142 5:138510974-138510996 CCTGGGGTGGAGATTTGGGAGGG - Intronic
998219237 5:140262719-140262741 AATGGGAATGAGACTGGGGAAGG + Intronic
998365833 5:141630173-141630195 ATGGGGAGGGAGATATGGGAAGG - Intronic
998588599 5:143453973-143453995 ATTCAACAGGAGATTTGGGAGGG + Intergenic
999868263 5:155725735-155725757 ATTCGAAATGAGATTTGGGTGGG - Intergenic
1000113862 5:158135190-158135212 ATAGGGAAGGAGAGAGGGGATGG + Intergenic
1000394143 5:160755330-160755352 ATTCGGCATGAGATTTGGGCAGG + Intronic
1000548738 5:162633409-162633431 ATTTGAAATGAGATTTGGGTGGG + Intergenic
1001195043 5:169664792-169664814 ATTTGGTATGAGATTTGGGTGGG + Intronic
1001202963 5:169736136-169736158 ATTTGACAGGAGATTTGGGCGGG + Intronic
1001823856 5:174730469-174730491 ATTGCAAAGGTGATTTGGGTGGG + Exonic
1002918256 6:1546323-1546345 ATTGAGCATGAGATTTGGGTGGG + Intergenic
1003259674 6:4505975-4505997 ATTAGGGATGAGATTTGGGTGGG + Intergenic
1003352077 6:5327377-5327399 ATTAGGGATGAGATTTGGGTGGG - Intronic
1003585274 6:7382978-7383000 ATTGGAGATGAGATTTGGGTGGG - Intronic
1003757268 6:9135719-9135741 ATTGGAGATGAGATTTGGGTGGG + Intergenic
1003982781 6:11405075-11405097 ATGGGGAAGGGGATAGGGGAAGG + Intergenic
1004092584 6:12519246-12519268 TCTGGGAAGCAAATTTGGGATGG + Intergenic
1004226737 6:13792047-13792069 GTTGGGAAGGAGCTATAGGATGG - Intronic
1004322189 6:14640644-14640666 TTTGGGCAGGAGAAGTGGGAGGG - Intergenic
1004343966 6:14831281-14831303 ATTGGAGATGAGATTTGGGTGGG + Intergenic
1005004077 6:21270533-21270555 TTTGGGAGGGAGAGTTGGGGGGG - Intergenic
1005911973 6:30318578-30318600 ATTCGACATGAGATTTGGGAAGG + Intergenic
1006302152 6:33199373-33199395 CTGGGGAAGGGGATTTGGGGAGG + Exonic
1006605875 6:35257632-35257654 ATTGGTGAGGATATTTTGGAGGG - Intergenic
1006614758 6:35318636-35318658 TTTGAAAAAGAGATTTGGGATGG + Intronic
1006725034 6:36193195-36193217 ATTGGGTAGGAGGTATGGCAAGG - Intergenic
1007942891 6:45798818-45798840 ATACGGAAGTAGATTTGGGCAGG - Intergenic
1008048815 6:46879311-46879333 ATTCGACATGAGATTTGGGAGGG - Intronic
1008579490 6:52893907-52893929 AATGGGAAGGAGCTATGGAAAGG - Intronic
1008871085 6:56272612-56272634 ATTGGAGATGAGATTTGGGTGGG - Intronic
1009400008 6:63243500-63243522 ATATGGCAGGAGATTTGTGATGG - Intergenic
1009631608 6:66208092-66208114 ATTTGAAATGAGATTTGGGTGGG + Intergenic
1010248241 6:73682086-73682108 TTTTGAAATGAGATTTGGGAGGG - Intergenic
1011039606 6:83015203-83015225 TTTGTGAAGTAGATTTGTGAAGG - Intronic
1011041375 6:83033416-83033438 ATTCAGCAGGAGATTTGGGTGGG - Intronic
1012021176 6:93921618-93921640 GTTGGGAGGTAGATGTGGGAGGG + Intergenic
1012034263 6:94111516-94111538 ATTGGAAATGAGATTTGGGAGGG - Intergenic
1012927454 6:105282031-105282053 ATTGGGCAGGTGATTTCTGATGG - Intronic
1013478516 6:110531519-110531541 CTTGGGAAGCTGATGTGGGAGGG + Intergenic
1013812368 6:114059495-114059517 ATTCGGGATGAGATTTGGGTGGG - Intronic
1014668813 6:124273196-124273218 ATTGGAGATGAGATTTGGGTGGG - Intronic
1014883841 6:126756057-126756079 AAAGGAAATGAGATTTGGGAGGG - Intergenic
1015476249 6:133661665-133661687 ATTCGAAATGAGATTTGGGTAGG - Intergenic
1016082713 6:139875815-139875837 ATTAGACAGGAGATTTGGGCAGG - Intergenic
1016399261 6:143660502-143660524 ATTGGAGATGAGATTTGGGTGGG + Intronic
1016487347 6:144555804-144555826 ATTGGACATGAGATTTGGGTGGG + Intronic
1016613851 6:146024769-146024791 ATGGGGCATGAAATTTGGGAGGG + Intergenic
1017228074 6:152043034-152043056 ATTGTGAAATAGATTTGTGAGGG - Intronic
1017387828 6:153906842-153906864 ATTCAAAAGGAGATTTGGGTGGG - Intergenic
1017420691 6:154269252-154269274 ATTGGGAAGGAGCTTTCTAATGG - Intronic
1017777695 6:157692353-157692375 AGTGGGAAGGACAGATGGGACGG - Intergenic
1018229186 6:161659589-161659611 ACTGGGAAGGGGCTATGGGAAGG + Intronic
1018240565 6:161770194-161770216 ATGGGGAAGGGCTTTTGGGAAGG + Intronic
1018351644 6:162965912-162965934 ATTGTGCAGAAGGTTTGGGATGG + Intronic
1018492357 6:164307063-164307085 AGTGGGAAGGAAAGGTGGGATGG + Intergenic
1019002722 6:168768971-168768993 CTTGAGAAGCAGATTTGTGAGGG + Intergenic
1019149978 6:169998745-169998767 CATGGGATGGAGATTTGCGAGGG + Intergenic
1019522735 7:1468021-1468043 ATGGGGAAGGAGGATGGGGAGGG - Intergenic
1020320869 7:6938038-6938060 TTTGGAGGGGAGATTTGGGATGG + Intergenic
1020571042 7:9861794-9861816 ATTGGGAAGGGTAGTGGGGAGGG + Intergenic
1020814030 7:12882280-12882302 TTTGGGAAGGAGGTTGAGGAAGG + Intergenic
1020941302 7:14541922-14541944 ATTGGGTAGGATAACTGGGATGG - Intronic
1020989854 7:15183063-15183085 ATTTGACATGAGATTTGGGAGGG + Intergenic
1021071169 7:16243024-16243046 ATTTGAAATGAGATTTGGGTGGG - Intronic
1021079216 7:16343505-16343527 ATTGGGAAATAGATTTTGCAGGG - Intronic
1021767644 7:23965711-23965733 TTTGAGAAGGTGATTTTGGAAGG + Intergenic
1021856051 7:24857370-24857392 CTTGGTGAGGAGATTTAGGATGG - Intronic
1021951645 7:25780677-25780699 TTGGGGAAAGATATTTGGGAAGG + Intergenic
1022016904 7:26357922-26357944 ACTGGGATGGAGCTTTGGGTGGG + Intronic
1022113476 7:27244948-27244970 GGTGGGAGGGTGATTTGGGAAGG - Intronic
1022218342 7:28287427-28287449 ATTGGAGATGAGATTTGGGTGGG + Intergenic
1022416627 7:30183531-30183553 ATTCAGCAGGAGATTTGGGTGGG + Intergenic
1023026705 7:36057449-36057471 CTTGGGAAAGAGGTTTGGGCTGG - Intergenic
1023784503 7:43692813-43692835 ATAGGGAAAGGGGTTTGGGAGGG - Intronic
1024222986 7:47302987-47303009 GTCGGGAAGGACATTTGGGAAGG + Exonic
1024289992 7:47795864-47795886 CTTTGCAAGGAGATTTGGCATGG + Intronic
1024318762 7:48045053-48045075 ATTGGTAAGGACATATGGGGTGG - Intronic
1024417135 7:49120263-49120285 ATTCGACAGGAGATTTGGGCAGG - Intergenic
1024575618 7:50761715-50761737 ATTTGAAATGAGATTTGGTAGGG - Intronic
1024959919 7:54963264-54963286 ATTGGGCAGCAGTTTTGGCAGGG + Intergenic
1025954622 7:66173071-66173093 ATTCGGGACGAGATTTGGGTAGG - Intergenic
1026125817 7:67578729-67578751 ACTGGGCATGAGATTTGGGCAGG - Intergenic
1026145372 7:67741933-67741955 ATTGGACATGAGATTTGGGCAGG - Intergenic
1026954579 7:74368967-74368989 CTTGGGAGGGAGAGGTGGGAGGG + Intronic
1027293204 7:76737167-76737189 ATTTGGAAGGACTTTTGTGAAGG + Intergenic
1028271904 7:88801944-88801966 ATTCGAAATGAGATTTGGGTGGG - Intronic
1028283770 7:88968275-88968297 AGTGGCAAGGAGGTTTCGGATGG + Intronic
1028668526 7:93373749-93373771 AGTGGGAAGGAGGATAGGGATGG + Intergenic
1028775578 7:94672310-94672332 CTTGGGAAGTCAATTTGGGAGGG - Intergenic
1029254330 7:99259128-99259150 ATTGGAGATGAGATTTGGGTGGG + Intergenic
1029310958 7:99663804-99663826 ATAAAGAAGGAGATTGGGGAAGG - Intronic
1029526472 7:101097645-101097667 ATTAGGAAGGAGGTTTGGGAGGG + Intergenic
1029925012 7:104306221-104306243 ATTGGAAGGGATATGTGGGAGGG + Intergenic
1030314478 7:108100117-108100139 TTTGGGAAAGAGATGTGGGAAGG + Intronic
1030513084 7:110508911-110508933 ATTGGGAAGGAACACTGGGAAGG - Intergenic
1030532615 7:110729508-110729530 ATTGGAGATGAGATTTGGGTGGG + Intronic
1031114927 7:117657103-117657125 AATGGGAGGGAAACTTGGGAGGG + Intronic
1031178443 7:118383314-118383336 ATTTGAAATGAGATTTGGGTGGG - Intergenic
1031182036 7:118431738-118431760 ATTTGACATGAGATTTGGGAGGG - Intergenic
1031405427 7:121379960-121379982 AATAGGAAGCAGATTTTGGAGGG - Intronic
1031800793 7:126242358-126242380 ATTGGAGATGAGATTTGGGTGGG - Intergenic
1031914304 7:127547908-127547930 AATGGAGATGAGATTTGGGAGGG - Intergenic
1032534673 7:132652897-132652919 ATTCAGAATGAGATTTGGGTTGG - Intronic
1032834292 7:135659247-135659269 ATTGGAGATGAGATTTGGGAGGG - Intergenic
1032873385 7:136010847-136010869 CTTTGGAAGCAGGTTTGGGAAGG + Intergenic
1032982991 7:137306355-137306377 AATGAGAATGAGAGTTGGGAGGG + Intronic
1033411975 7:141126326-141126348 ATTGGGCAGGAGAGGTGGGCTGG + Intronic
1034524596 7:151649523-151649545 ATTGGGCATGAGATTTGGGTGGG - Intronic
1034573215 7:151973758-151973780 ATGTGAAATGAGATTTGGGAGGG + Intronic
1034909914 7:154987462-154987484 ATTGGTAGAGAGATTTGGGGAGG - Intronic
1035180059 7:157082883-157082905 ATTTGGCATGAGATTTGGGAAGG - Intergenic
1035417598 7:158703770-158703792 ATGAGGAAGGAGTTTGGGGACGG - Intronic
1035494334 7:159309561-159309583 ATTTGGCATGAGATTTGGGTGGG + Intergenic
1036288204 8:7462963-7462985 ATTGGGTGGGGGAGTTGGGAGGG + Intronic
1036333271 8:7848565-7848587 ATTGGGTGGGGGAGTTGGGAGGG - Intronic
1036407453 8:8467986-8468008 GAGGGGAAGGAGATATGGGAAGG + Intergenic
1036446867 8:8829195-8829217 ATGGGGAAGGGGTTCTGGGAGGG - Intronic
1036731042 8:11265135-11265157 ATTCGACAGGAGATTTGGTAGGG - Intergenic
1036821961 8:11948045-11948067 CTTGACAAGGAGATTTGGGATGG + Intergenic
1036848914 8:12188248-12188270 TTTGGAGGGGAGATTTGGGATGG + Intronic
1036870275 8:12430526-12430548 TTTGGAGGGGAGATTTGGGATGG + Intronic
1036921698 8:12861857-12861879 ATTCGAAATGAGATTTGGGTGGG + Intergenic
1037117943 8:15248043-15248065 ATTCGAAATGAGATTTGGGTAGG - Intergenic
1037364148 8:18104506-18104528 TGTGAGAAGGACATTTGGGAGGG + Intergenic
1037643021 8:20765475-20765497 ATTGGGAAGGGGTTGTGGGGAGG + Intergenic
1037771180 8:21801010-21801032 ACAGGGAAGGAGATTTGTGGAGG + Intronic
1037912023 8:22749136-22749158 AGTAGGAAGGAGAGTGGGGATGG + Intronic
1038431062 8:27500091-27500113 ACTGGACAGGAGATTTGGGTGGG - Intronic
1038716898 8:29999181-29999203 AATGAGAAGGATATTTGGGTTGG + Intergenic
1038733264 8:30146453-30146475 ACTGGGGATGAGATTTGGGTGGG + Intronic
1038848510 8:31251906-31251928 ATTGGGGATGAGATTTGGGTGGG + Intergenic
1039616251 8:38957035-38957057 ATTAGGCAGGAGGTTTTGGAGGG + Intronic
1039720552 8:40159866-40159888 ATTCAAGAGGAGATTTGGGAGGG - Intergenic
1039850677 8:41362444-41362466 TTTGGGAAGGAGGGTTGGGGTGG - Intergenic
1040611316 8:48984973-48984995 CTTGGGAAGGAGAGTGGGGAAGG + Intergenic
1040713553 8:50219763-50219785 ATTTGGCATGAGATTTGGGTGGG + Intronic
1041388740 8:57330502-57330524 ATTGTGAAGGAGAGTTGGGAAGG - Intergenic
1042395074 8:68282611-68282633 ATTTGGCATGAGATTTGGGAGGG - Intergenic
1042852790 8:73233561-73233583 ATTGGGAAGCAGGAATGGGAAGG - Intergenic
1043237170 8:77882181-77882203 ATTGGAGATGAGATTTGGGTGGG + Intergenic
1043509037 8:80931722-80931744 ATTGGGAAGGAAATTATGAAGGG - Intergenic
1043509039 8:80931735-80931757 ATAGGGAAGGAAGATTGGGAAGG - Intergenic
1044045840 8:87430965-87430987 ATTGAGGATGAGATTTGGGTGGG - Intronic
1044157228 8:88862503-88862525 ATTTGACAGGAGATTTGGGCAGG + Intergenic
1044612117 8:94102134-94102156 ATTGGGAATGGGTGTTGGGAAGG + Intergenic
1044810003 8:96050515-96050537 ACTGGGAAGGACATATGGGTGGG + Intergenic
1045258178 8:100547208-100547230 ATTTGGGATGAGATTTGGGTGGG - Intronic
1045349134 8:101322387-101322409 ATTGGAGATGAGATTTGGGTGGG + Intergenic
1045629523 8:104102109-104102131 ATTAGGAGGGAGATCTGGGCTGG - Intronic
1045906583 8:107353409-107353431 ATTGGGAAAGAAATGTGGGGTGG - Intronic
1046046070 8:108966474-108966496 ATTGAGCATGAGATTTGGGTGGG - Intergenic
1046405431 8:113766525-113766547 ATTGGGAGGGAGATATAGAAGGG + Intergenic
1047507354 8:125490350-125490372 ATTGGGATGGGGAAGTGGGAGGG - Intergenic
1047568838 8:126075454-126075476 TTTGAGATGGAGATTTGGGTGGG - Intergenic
1048420994 8:134278162-134278184 AGTGGGGAGCAGATTTGGAAAGG + Intergenic
1048654599 8:136522176-136522198 CTTGTGAAGTAGATTTGTGAGGG - Intergenic
1048758471 8:137765814-137765836 ATTTGAGAGGAGATTTGGGTGGG - Intergenic
1048895662 8:138990125-138990147 ATTGAAAATGAGATTTGGGTGGG + Intergenic
1049173474 8:141176714-141176736 ATGGTGAAGGAGATGTGGGCTGG + Exonic
1049960309 9:731941-731963 AATGGCCAGGAGATTTTGGAGGG + Intronic
1050613445 9:7377090-7377112 GTTGGGAAGGAGATTTGGGTAGG - Intergenic
1050987667 9:12103344-12103366 ATTGGAGATGAGATTTGGGTGGG + Intergenic
1051570830 9:18557012-18557034 AGTTGGAAAGAGATTAGGGAAGG + Intronic
1052571830 9:30235281-30235303 ATTGGAGATGAGATTTGGGTGGG + Intergenic
1052662756 9:31457094-31457116 ATTCGAGATGAGATTTGGGAAGG - Intergenic
1053185710 9:36014459-36014481 ATTCGACAGGAGATTTGGGCAGG - Intergenic
1053245614 9:36532403-36532425 ATTGGGAAACAGATGTGGCAAGG - Intergenic
1053259372 9:36648598-36648620 ATAGGGAAGGGAATTTGAGATGG - Intronic
1053264425 9:36700233-36700255 ATTTGGGATGAGATTTGGGTGGG + Intergenic
1053519568 9:38764189-38764211 ATTCGGCATGAGATTTGGGTGGG - Intergenic
1054896054 9:70312434-70312456 CTTTGGAATGAGATTTGGGTGGG + Intronic
1055064370 9:72103838-72103860 ATTGAACAGGAGATTTGGGCAGG - Intergenic
1056360810 9:85855749-85855771 ATTGGAGATGAGATTTGGGTGGG - Intergenic
1056497102 9:87168424-87168446 ATTGAGCAGAAGATTTGAGAGGG - Intergenic
1056947319 9:91009812-91009834 ATTGAAAATGAGATTTGGGTGGG - Intergenic
1057506005 9:95634137-95634159 ATTTGACAGGAGATTTGGGCTGG - Intergenic
1057601838 9:96464826-96464848 TTTAGGAGGGAGATTTGGAAAGG + Intronic
1058220598 9:102295705-102295727 CTAGGGAAGGTAATTTGGGAGGG + Intergenic
1058324755 9:103681493-103681515 ATTGGAGATGAGATTTGGGTGGG - Intergenic
1058833863 9:108843268-108843290 ATTCGAGATGAGATTTGGGAGGG + Intergenic
1059382999 9:113943065-113943087 ACTGGGAAGGAGATAGGGTAGGG + Intronic
1059568018 9:115403029-115403051 ATTTGAGATGAGATTTGGGAGGG - Intergenic
1060327862 9:122634672-122634694 ATTGGAGATGAGATTTGGGTGGG + Intergenic
1060628336 9:125133775-125133797 ATTGGTGAGGACATTTGGAAGGG + Intronic
1060674322 9:125498817-125498839 AAAGGGAAGGAGAGTGGGGAGGG - Intronic
1060809082 9:126599439-126599461 ACTGGAGATGAGATTTGGGAGGG + Intergenic
1060816712 9:126638994-126639016 ATTGGGAAGGAGAATTGGAGAGG + Intronic
1060816729 9:126639048-126639070 AGGGGAAAGGAGAGTTGGGAAGG + Intronic
1060816731 9:126639061-126639083 GTTGGGAAGGAGAATTGGAGAGG + Intronic
1061008604 9:127942441-127942463 CTTGGGAAGGAGCTCAGGGAAGG + Exonic
1061279257 9:129587668-129587690 ATTGGGAAGGAGTTGGGGAAGGG + Intergenic
1062166675 9:135111288-135111310 GTTGGGGAGGGGATTTGGGCAGG + Intronic
1062182064 9:135196220-135196242 AATGGGAAGGGGAACTGGGAAGG - Intergenic
1062182079 9:135196259-135196281 AATGGGAAGGGGAAATGGGAAGG - Intergenic
1062182162 9:135196496-135196518 AATGGGAAGGAGAAATGGGAAGG - Intergenic
1062182175 9:135196533-135196555 AATGGGAAGGGGAAATGGGAAGG - Intergenic
1062182210 9:135196620-135196642 AATGGGAAGGGGAAATGGGAAGG - Intergenic
1062182234 9:135196683-135196705 AATGGGAAGGGGAAATGGGAAGG - Intergenic
1062182239 9:135196696-135196718 AACGGGAAGGAGAAATGGGAAGG - Intergenic
1062182274 9:135196796-135196818 AATGGGAAAGGGATATGGGAAGG - Intergenic
1062575654 9:137206035-137206057 TTAGGGAAGGAGGTTTGGGAAGG + Intronic
1185797860 X:2982112-2982134 ATTCAGAATGAGATTTGGGTGGG - Intergenic
1185829799 X:3289851-3289873 GATGGGAGGGAGATCTGGGATGG - Intergenic
1186186946 X:7030011-7030033 ATGGGGATGGAGAATTGGAATGG - Intergenic
1186196752 X:7116734-7116756 ATTCAGCATGAGATTTGGGAGGG - Intronic
1186208556 X:7225713-7225735 ATTGGGAATTAGATTTGGGGAGG - Intronic
1186233723 X:7484436-7484458 ATTCGGGACGAGATTTGGGTAGG + Intergenic
1186977594 X:14924645-14924667 ATTTGGCATGAGATTTGGGTGGG + Intergenic
1187406869 X:19012356-19012378 ACTGGGAATTAGCTTTGGGAAGG + Intronic
1187757032 X:22539415-22539437 ATTCGACATGAGATTTGGGAAGG - Intergenic
1188624434 X:32266054-32266076 ATTCAGAATGAGATTTGGGTGGG - Intronic
1188732299 X:33664888-33664910 ATTTTCAAGGAGATTTGTGAAGG + Intergenic
1188737048 X:33729901-33729923 AATGGGATGGAGAGTGGGGATGG - Intergenic
1189512684 X:41679244-41679266 AATGGGAAGGGGATGAGGGAGGG - Intronic
1189746977 X:44178983-44179005 ATTAGAAAGGTGTTTTGGGATGG + Intronic
1189777647 X:44484643-44484665 GTTAGGAAGGATACTTGGGAAGG - Intergenic
1189790232 X:44596925-44596947 ATTCGAAATGAGATTTGGGCTGG - Intergenic
1190049953 X:47142175-47142197 GTTGTGAAGGGGATATGGGATGG - Intergenic
1190362392 X:49661573-49661595 ATTGGGAAGTAGAGGAGGGAGGG + Intergenic
1190656962 X:52621072-52621094 ATTGGAGATGAGATTTGGGTGGG + Intergenic
1190935426 X:54995003-54995025 ATTAGGATGGAGATTTAGGAGGG + Intronic
1191113414 X:56826689-56826711 TTTGGGAAATAGATTTGTGAGGG - Intergenic
1192070983 X:67941098-67941120 ATTTGACAGGAGATTTGGGTGGG + Intergenic
1192805573 X:74505718-74505740 ATTAGGAAGGAAACCTGGGATGG - Intronic
1193090822 X:77492507-77492529 ATTGGACATGAGATTTGGGCAGG - Intergenic
1193292762 X:79795567-79795589 ATTTGGCATGAGATTTGGGCAGG - Intergenic
1193558307 X:82984507-82984529 AAAGGGCATGAGATTTGGGAGGG - Intergenic
1193634403 X:83930417-83930439 ATTGAAAATGAGATTTGGGTGGG + Intergenic
1193795417 X:85867120-85867142 ATTGCAAATGAGATTTGGGTAGG - Intronic
1193814655 X:86090334-86090356 ATTTGAAATGAGATTTGGGTGGG + Intergenic
1193827403 X:86242687-86242709 ATTTGACATGAGATTTGGGAGGG - Intronic
1193988533 X:88276294-88276316 ATTGGAAATGAGATTTGGGTGGG - Intergenic
1194073067 X:89351102-89351124 TTTGGGAAAGAGATGAGGGAGGG - Intergenic
1194107936 X:89794120-89794142 ATTGGAGATGAGATTTGGGTGGG + Intergenic
1194144280 X:90244246-90244268 AAAGGGCATGAGATTTGGGAGGG - Intergenic
1194578355 X:95641207-95641229 ATTGGAGATGAGATTTGGGTGGG + Intergenic
1195007833 X:100703924-100703946 CTTGGGGAGTAGAATTGGGAAGG + Intronic
1195127571 X:101823105-101823127 ATTGAAAATGAGATTTGGGTGGG + Intergenic
1195221639 X:102749515-102749537 ATTGGGAACTGGTTTTGGGAAGG + Exonic
1195477855 X:105307193-105307215 ATTGTCAATGAGATTTGGGTCGG + Intronic
1196083717 X:111661270-111661292 ATTGGACATGAGATTTGGGCAGG - Intergenic
1196114218 X:111981873-111981895 ATTCGGCATGAGATTTGGGCTGG - Intronic
1196546845 X:116973409-116973431 ATTCGAAATGAGATTTGGGGGGG - Intergenic
1196702728 X:118688960-118688982 ATTCGGACTGAGATTTTGGAAGG + Intergenic
1197012277 X:121580418-121580440 ATTGGGAGAGAGATTTGGACAGG - Intergenic
1197053971 X:122094546-122094568 AAGGGGAAGGAGAAATGGGAAGG + Intergenic
1197097222 X:122610890-122610912 TTTGGGAAAGTGATTTGTGAGGG + Intergenic
1197303459 X:124810015-124810037 ATTCGAAATGAGATTTGGGTGGG + Intronic
1197387060 X:125814623-125814645 CTTGTGAAAGAGATTTGCGAAGG - Intergenic
1197465323 X:126798170-126798192 ATTCAGAATGAGATTTGGGTGGG + Intergenic
1197908817 X:131457956-131457978 ATTCAGAATGAGATTTGGGTGGG - Intergenic
1198298532 X:135310614-135310636 ATTGGGAAGGAGAGGTGGAGGGG - Intronic
1198301558 X:135338848-135338870 ATTAGGAGGGAGAGTAGGGAAGG - Intronic
1198941884 X:141965194-141965216 ATTCAGGAGGAGATTTGGGTGGG + Intergenic
1199080645 X:143572977-143572999 ATTTTGAAGGGGTTTTGGGATGG - Intergenic
1199117279 X:144007900-144007922 ATTTGACATGAGATTTGGGAGGG + Intergenic
1199118186 X:144017686-144017708 ATTGGGAAGGGGATGTGGGTGGG - Intergenic
1199306304 X:146270626-146270648 ATTTGGCAAGAGATTTGGGTGGG - Intergenic
1199363874 X:146955436-146955458 ACTGTGAAGGAGAGTTGGGGAGG - Intergenic
1199620934 X:149700107-149700129 ATTCGAAATGAGATTTGGGTGGG + Intronic
1199621444 X:149705193-149705215 ATTCAGAAGGAGATTTGTGTGGG - Intronic
1200009454 X:153110164-153110186 ATTCAATAGGAGATTTGGGAGGG - Intergenic
1200030146 X:153289758-153289780 ATTCAATAGGAGATTTGGGAGGG + Intergenic
1200395207 X:155982173-155982195 ATTGGACATGAGATTTGGGTGGG - Intergenic
1200459888 Y:3441905-3441927 ATTGGAGATGAGATTTGGGTGGG + Intergenic
1200490043 Y:3813549-3813571 AAAGGGCATGAGATTTGGGAGGG - Intergenic
1200727302 Y:6686842-6686864 TTTGGGAAAGAGATGAGGGAGGG - Intergenic
1200728454 Y:6702617-6702639 TTTGGGAAAGAGATGAGGGAGGG - Intergenic
1200777965 Y:7186674-7186696 ATTGGAGATGAGATTTGGGTGGG + Intergenic
1201039122 Y:9811418-9811440 ATTGGGAAGAGGATTCTGGAAGG - Intergenic
1201464317 Y:14263723-14263745 TCTAGGAAGTAGATTTGGGATGG + Intergenic
1201593641 Y:15641935-15641957 ATTGAGATGGAGAGTGGGGAGGG + Intergenic
1201675627 Y:16580644-16580666 ATTGGACATGAGATTTGGGTGGG - Intergenic
1201689112 Y:16743440-16743462 ACTGGGAAGGGTATTGGGGAGGG - Intergenic