ID: 945831342

View in Genome Browser
Species Human (GRCh38)
Location 2:214790108-214790130
Sequence ACTAGCTAGAATAAAATTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 210}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945831341_945831342 4 Left 945831341 2:214790081-214790103 CCTCAAAATATAAATGATTCAAA 0: 1
1: 0
2: 8
3: 163
4: 1242
Right 945831342 2:214790108-214790130 ACTAGCTAGAATAAAATTTCTGG 0: 1
1: 0
2: 2
3: 16
4: 210
945831340_945831342 11 Left 945831340 2:214790074-214790096 CCATAGTCCTCAAAATATAAATG 0: 1
1: 0
2: 0
3: 23
4: 262
Right 945831342 2:214790108-214790130 ACTAGCTAGAATAAAATTTCTGG 0: 1
1: 0
2: 2
3: 16
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945831342 Original CRISPR ACTAGCTAGAATAAAATTTC TGG Intronic
904879874 1:33688036-33688058 AATATCTAGAAGAAAATTTGAGG + Intronic
906757938 1:48338566-48338588 ACTAGCTAGGATAAAAAATTGGG + Intronic
908116143 1:60942275-60942297 ACTAGCTAAATCAGAATTTCTGG - Intronic
910239682 1:85073036-85073058 ACTAGCTAGAATATAATAAAAGG - Exonic
911273820 1:95836907-95836929 ACTAGCTAGAATAAAAGAGAAGG - Intergenic
911465166 1:98242820-98242842 ACTAAGTAGAATATAATTTGGGG + Intergenic
911764721 1:101660319-101660341 AATTGCTAGAATAAAATATAGGG - Intergenic
913256957 1:116962455-116962477 ACCAACTAAAATAGAATTTCTGG - Intronic
916627678 1:166576090-166576112 AATAGAAAGAAGAAAATTTCAGG + Intergenic
917156909 1:172012364-172012386 ACTAGCTAGAATTCAATCACAGG + Intronic
918245983 1:182659767-182659789 ACTAACTAGACCAATATTTCTGG - Intronic
918668915 1:187188105-187188127 ACTTGCTGACATAAAATTTCTGG - Intergenic
919185776 1:194147047-194147069 ACTTACTAGAAAAAAATCTCAGG - Intergenic
919280038 1:195478007-195478029 TCAATCTAGAATATAATTTCAGG - Intergenic
919287256 1:195579464-195579486 CCTAGCTAAAATAAAAGTTCTGG - Intergenic
920737199 1:208543453-208543475 ACCAGGTAGAAGAAAATTTTTGG - Intergenic
924657947 1:245990466-245990488 TCGACCTTGAATAAAATTTCTGG + Intronic
1063740431 10:8812481-8812503 AATAGCTGGTATAAAATTGCAGG + Intergenic
1063876140 10:10480858-10480880 ACCAACTAAAATAAAATTTATGG - Intergenic
1065665306 10:28053231-28053253 ACCAGCTAAAATAACATTTTGGG + Exonic
1067917080 10:50411653-50411675 ACTAGGCAGTTTAAAATTTCAGG - Intronic
1068304869 10:55195321-55195343 ATAAGCTAAAATGAAATTTCTGG - Intronic
1070434073 10:76371471-76371493 ACTAGCTAGGATATGATTCCAGG - Intronic
1071719120 10:88125068-88125090 TATAGCTAGGATGAAATTTCTGG - Intergenic
1072986171 10:100142942-100142964 TTTATCCAGAATAAAATTTCAGG + Intergenic
1074919797 10:117995664-117995686 AATTCCTAGAATAAAATTGCTGG + Intergenic
1075239430 10:120764663-120764685 GCAAGTTAGAATAAAATGTCTGG + Intergenic
1075562428 10:123478006-123478028 TCATGCTAGATTAAAATTTCTGG + Intergenic
1076341169 10:129745896-129745918 ACTAGCTAGGAGAAAATATTTGG - Intronic
1079557827 11:21782767-21782789 GCCAGCGAGAATAAACTTTCTGG - Intergenic
1079792950 11:24761745-24761767 ACTAGCTACAATAAATTAACTGG + Intronic
1079962969 11:26946590-26946612 ACCAGCTAGGAAAAAATTGCTGG + Intergenic
1080205101 11:29719429-29719451 ACAAGTTAAAATAAAATTCCAGG - Intergenic
1080954409 11:37076413-37076435 ACTAGCTATGATGAAATCTCTGG - Intergenic
1082631212 11:55544449-55544471 ACTATCTAAAATATTATTTCTGG - Intergenic
1087395933 11:97598412-97598434 AGTAGCTAGAATTCAAATTCTGG + Intergenic
1088183654 11:107139858-107139880 ACAAGCTAGAATGAAAGTTCTGG + Intergenic
1088687083 11:112293612-112293634 ACTAACTAGAATACAGTCTCAGG - Intergenic
1088942029 11:114468933-114468955 ACTAGCCTAAATAAAATTTAAGG + Intergenic
1089901597 11:121992371-121992393 ACAAGCCAGAATACAAGTTCTGG - Intergenic
1091676463 12:2494362-2494384 ACTATGAAGAATAAATTTTCTGG - Intronic
1092577052 12:9796724-9796746 ACCAGAGAGTATAAAATTTCAGG - Intergenic
1092734025 12:11562410-11562432 TCTATTTAAAATAAAATTTCAGG - Intergenic
1092926093 12:13273883-13273905 ACTAGGTAAAATAAAAATTTGGG + Intergenic
1093947656 12:25128857-25128879 AGTAGCCAGAATAACCTTTCAGG + Intronic
1094346769 12:29478747-29478769 AGGATCTAAAATAAAATTTCTGG - Intronic
1096346691 12:50854016-50854038 ACAATCTAAAAGAAAATTTCAGG + Intronic
1099112071 12:78574113-78574135 AGTAGCATGAATAAAATGTCTGG + Intergenic
1106387277 13:29300132-29300154 AATAGCAAGAATAATATTTTAGG + Intronic
1107595411 13:41958867-41958889 ACTGGCTATAACAAAATTTGAGG + Intronic
1109037446 13:57284342-57284364 ACTAGCTTGTATATAATTTCAGG + Intergenic
1109153400 13:58873337-58873359 ACTAGCTACCATAAACTTTGTGG + Intergenic
1109430701 13:62230207-62230229 ATTAGCTAGAATCTAATCTCAGG - Intergenic
1109433290 13:62264845-62264867 AATAGCTAGAATAAATATTTAGG + Intergenic
1109723659 13:66311208-66311230 TCTTTCTATAATAAAATTTCGGG + Intronic
1110171190 13:72502677-72502699 ACTAGATAGAATAGTTTTTCAGG - Intergenic
1111142143 13:84132918-84132940 ACTAGATTGAATAAAATCTTGGG + Intergenic
1111276503 13:85954751-85954773 AGTAGCTAGAACAAAATTTGTGG + Intergenic
1115798250 14:36962949-36962971 ACTACCAAAAAGAAAATTTCTGG - Intronic
1116392886 14:44415073-44415095 ACGAGCAACAATAAAATATCTGG + Intergenic
1118020652 14:61710210-61710232 ACCAGCTACCACAAAATTTCAGG - Intronic
1120306908 14:82782416-82782438 AAAAAATAGAATAAAATTTCAGG + Intergenic
1120311843 14:82838595-82838617 ACTATTTAAAATAAAAGTTCTGG - Intergenic
1120458205 14:84759251-84759273 ACTAGCTAGTACAATATTTTGGG + Intergenic
1121040371 14:90741352-90741374 ACTAGCAAGAGTAAAATTTGGGG - Intronic
1121164867 14:91784126-91784148 TCTAGTTAGAATAATAATTCTGG - Intronic
1121230563 14:92354567-92354589 ATGTGCTAGAATAGAATTTCTGG + Intronic
1127792240 15:62408378-62408400 ACTTGCTAAAAGAAAATCTCTGG - Intronic
1130372039 15:83293318-83293340 ACTGGCTAGAATAACACTACAGG + Intergenic
1130372235 15:83294878-83294900 ACTGGCTAGAATAACACTACAGG - Intergenic
1138180097 16:54935361-54935383 AGTAGCTACAAAAATATTTCTGG + Intergenic
1139494693 16:67307796-67307818 ACTAGCTAGAAGAAAATCATTGG - Intronic
1141235609 16:82213222-82213244 ACTAGTTAGTATCAAGTTTCTGG + Intergenic
1142721066 17:1776236-1776258 AGGAGCTAGAATTGAATTTCAGG - Intronic
1147487565 17:40832201-40832223 TTTAGTTAAAATAAAATTTCTGG - Intronic
1150138776 17:62711537-62711559 ACTAGCTAGTAAAAAATCCCAGG - Intronic
1151238942 17:72742974-72742996 ACTAATTAGAAGAAAATTTTGGG - Intronic
1153434235 18:5051905-5051927 ACTTCCTTGAGTAAAATTTCAGG + Intergenic
1153841635 18:9013290-9013312 ACTTGCCAGATTAACATTTCTGG + Intergenic
1154982872 18:21518358-21518380 ACTATCTTTAATAAAAGTTCTGG - Intronic
1154990801 18:21596496-21596518 ATTAGCTATAATAATATTACAGG + Intronic
1156946180 18:42835102-42835124 TCTAACTAGAGTAAGATTTCAGG + Intronic
1157999576 18:52600836-52600858 AATAGCTTGAATAACATTTGTGG + Intronic
1160222479 18:76987221-76987243 AGTAGCTAAAATAAGATTTCTGG + Intronic
1162613727 19:11778446-11778468 ACAAAATAAAATAAAATTTCTGG - Intronic
1163127656 19:15253014-15253036 TCTAGTTAGAATAAAATCCCAGG + Intronic
926374654 2:12214641-12214663 AATAGCTAGAATGAAATTGCTGG - Intergenic
926472662 2:13280380-13280402 ACTGGCTAGAACAATATCTCAGG - Intergenic
926908203 2:17825572-17825594 ACTAACTAGATTCAAAATTCAGG - Intergenic
927672478 2:25080594-25080616 AATAGATATAATAAAACTTCAGG - Intronic
929640199 2:43570580-43570602 ATTATTTAGAATAAAACTTCAGG + Intronic
930445487 2:51465932-51465954 AATAGGTAGAATAATAATTCAGG - Intergenic
931982741 2:67711689-67711711 ACCAGCTAGAATTAAATATGTGG + Intergenic
932280141 2:70484087-70484109 ACTAGGTAGAGTTCAATTTCAGG - Intronic
939427643 2:142060058-142060080 TCTTGCTAGAATAGAATTTCAGG + Intronic
940266268 2:151842187-151842209 ATTAGCTAAAATCAAATTTGAGG + Intronic
942555182 2:177165511-177165533 TCTGGCTAGAATAAAATCTAAGG + Intergenic
943294007 2:186114458-186114480 ACTAGCCAGAGTAAACTGTCAGG + Intergenic
945831342 2:214790108-214790130 ACTAGCTAGAATAAAATTTCTGG + Intronic
946576637 2:221082802-221082824 AATACCTAGAATAAAGTTTGTGG - Intergenic
946831710 2:223734504-223734526 ACTTGCTGGAAAAATATTTCTGG + Intergenic
1169651530 20:7873574-7873596 TTTAGCTAAAATAAGATTTCGGG + Intergenic
1170686860 20:18577138-18577160 AAGAGTTAGAATAAGATTTCTGG + Intronic
1170845264 20:19956887-19956909 ACAAGCTAGGAAGAAATTTCTGG - Intronic
1170923815 20:20704430-20704452 ACTAGCTTGAGTCATATTTCTGG - Intronic
1173761847 20:45568487-45568509 TCTATCAAGAATACAATTTCAGG - Intronic
1174434852 20:50498874-50498896 ACTGGTTAGAAATAAATTTCTGG - Intergenic
1176377382 21:6093246-6093268 ACTAAATACAATAAAATTACAGG - Intergenic
1176874205 21:14111688-14111710 ACTTGCTAGAAGAAAATATAAGG - Intronic
1177065663 21:16431151-16431173 AATACCTAGAATACAATTACAGG - Intergenic
1177190210 21:17842991-17843013 AATACCTAGAGTGAAATTTCTGG + Intergenic
1177709864 21:24760474-24760496 ACGTGATAGAATAAATTTTCTGG + Intergenic
1177785497 21:25666860-25666882 ACTATCTAGAAAAATATTTTAGG + Intronic
1178267356 21:31155801-31155823 ACTAGCTTCAAGAAAATTTCCGG - Intronic
1179746092 21:43444998-43445020 ACTAAATACAATAAAATTACAGG + Intergenic
1182259330 22:29061803-29061825 GCTAGCGAAAATAAAATTTAAGG - Exonic
1183918345 22:41142496-41142518 AGTAGTTAGAACAAATTTTCAGG + Intronic
949260851 3:2100637-2100659 AATAGCAAGAATAAACTTACGGG - Intronic
951276708 3:20696076-20696098 AGTAAGTACAATAAAATTTCAGG - Intergenic
951402292 3:22248294-22248316 TCAAGCTTGAATAAAATTTAAGG - Intronic
951755221 3:26083706-26083728 AATAGAGAGAATAAAATCTCAGG + Intergenic
952007155 3:28855086-28855108 GCTAGCTAGAACACAGTTTCTGG - Intergenic
954567708 3:51612710-51612732 ACTGACTACAATAAAATTACAGG - Intronic
956488958 3:69751465-69751487 ACAAGCCAAAAGAAAATTTCTGG + Intronic
956579846 3:70797773-70797795 ACTAGCTAAAATAAAACATAGGG - Intergenic
957155965 3:76544668-76544690 ACTTCCTAGATTCAAATTTCAGG + Intronic
957296838 3:78343834-78343856 ACTAGCTCTAATAAAAACTCAGG + Intergenic
960364847 3:116758677-116758699 ACTAACTAGAATAAAATTTATGG + Intronic
961154535 3:124667717-124667739 ACTTCCTAGAAGAAAATTTGTGG + Intronic
962647078 3:137451002-137451024 AATATCTAGAAGAACATTTCGGG + Intergenic
964015282 3:151937885-151937907 ATTACCAAAAATAAAATTTCAGG + Intergenic
964153256 3:153554215-153554237 ACTATCTAGAATAGAAATGCAGG - Intergenic
966859522 3:184222049-184222071 GCTAACTAGAAGAAAATATCTGG + Intronic
967698363 3:192561959-192561981 ACTAACTTGAATAAAGCTTCTGG - Intronic
972711443 4:41600049-41600071 ACTGGATAAAATAAAATTTGGGG + Intronic
973318992 4:48790789-48790811 ACTAGGTACAATAAAAGTTAAGG + Intergenic
974408663 4:61509795-61509817 ACTGGGTAGAATAATAGTTCTGG + Intronic
974596884 4:64024995-64025017 ACTAACTAAAAAAAAAATTCTGG + Intergenic
975521578 4:75307376-75307398 ACTTGCTGGAATAAAAATTTGGG - Intergenic
977528300 4:98170788-98170810 AATGGCTAGAATTATATTTCAGG - Intergenic
977765012 4:100787051-100787073 ACTAGCAAGGGTATAATTTCAGG + Intronic
978052480 4:104219295-104219317 CCTAGCTAAAATATAAATTCAGG + Intergenic
978083903 4:104626277-104626299 TGAAGCTCGAATAAAATTTCTGG + Intergenic
978871068 4:113578633-113578655 ACAAACTTGAGTAAAATTTCTGG - Intronic
981070240 4:140527918-140527940 ACAAACTATAATAAAATCTCAGG + Intronic
981291639 4:143083229-143083251 GCTAGCTAGAAGAAAAAGTCAGG - Intergenic
982857667 4:160405893-160405915 AAAAGCAAGAATGAAATTTCTGG + Intergenic
983009652 4:162531424-162531446 ACTAGCTACATTACACTTTCAGG + Intergenic
984169017 4:176338876-176338898 ACTAACTAGAAATACATTTCTGG + Intergenic
985292648 4:188402838-188402860 AATAGTTGGTATAAAATTTCCGG + Intergenic
987570463 5:19651305-19651327 AATTGCTAGAAAAAAATCTCTGG + Intronic
988139672 5:27219256-27219278 TTTAGATAGAATAAAATTTTTGG + Intergenic
989564561 5:42889263-42889285 ACTAGATAAACTAAAATTCCAGG + Intergenic
990524325 5:56609974-56609996 ACTAAATAGAATAAGATTTTTGG + Intergenic
993540482 5:89144089-89144111 ACTAGCTTGAAGAAAACATCTGG - Intergenic
995939304 5:117560194-117560216 CATAGCTAGAATATAATATCTGG + Intergenic
998738454 5:145170695-145170717 ACTATCTAAAATAAAAGTTGTGG - Intergenic
999479067 5:151928463-151928485 ACCTCCAAGAATAAAATTTCTGG + Intergenic
1000897977 5:166879305-166879327 ACAAGATAGAATAAAATTGATGG + Intergenic
1000942642 5:167381150-167381172 AGCAGGTAGAAGAAAATTTCAGG + Intronic
1001077399 5:168640599-168640621 ACTATCAAGAATAAATTTTCTGG + Intergenic
1003800347 6:9657994-9658016 ACCACCTAGAATAAACTTTAAGG - Intronic
1004395479 6:15244239-15244261 AATAGGTAGAATAAAATATATGG + Intergenic
1007138765 6:39550003-39550025 ACTAGCTGGCCAAAAATTTCGGG - Intronic
1007207064 6:40161326-40161348 ACTAGGTAGAACACAATTTCTGG - Intergenic
1008142840 6:47851911-47851933 ACTAGCTATTATGGAATTTCAGG - Intergenic
1008862683 6:56168930-56168952 ACTAGGTAGAATAATTTTTCAGG + Intronic
1010062533 6:71640582-71640604 ACAAGCAAAAATAAAATTTTAGG + Intergenic
1010881999 6:81188225-81188247 AATAGCAAAAATAACATTTCAGG - Intergenic
1010987635 6:82443260-82443282 AACAGGTAGAGTAAAATTTCTGG - Intergenic
1011453351 6:87519414-87519436 AGTAGCGAGTATAAAAATTCTGG + Intronic
1013233560 6:108176984-108177006 ACTTGCTGAAATGAAATTTCTGG - Intronic
1013437265 6:110123196-110123218 ATTAGCTAGAAATAAATTTTAGG + Intronic
1013586782 6:111586276-111586298 ACTGAATAGAATAAAATTACAGG - Intronic
1014086666 6:117353960-117353982 ACTAGCTGGAATGAAATCACGGG + Intronic
1015892449 6:137982299-137982321 ATCAGCTAGAATATAATTACAGG + Intergenic
1016275374 6:142345819-142345841 ACTAGCTAGACTTTAATTTGTGG + Intronic
1018286628 6:162246837-162246859 ACTAAATAGAATAATAATTCTGG + Intronic
1020711600 7:11613116-11613138 AATAGATATAATAAAAATTCAGG + Intronic
1023558342 7:41446740-41446762 ACTCCTTAGAATAACATTTCAGG + Intergenic
1024798116 7:53043059-53043081 AGTAGCTAGAATACAGTTCCAGG + Intergenic
1031488242 7:122355642-122355664 AAGAGCTAGAAAAAATTTTCTGG - Intronic
1031584659 7:123519775-123519797 AATAGCTAGAAGAAAAGTTTTGG + Intronic
1032223805 7:130014277-130014299 AGTAGCAAAAATGAAATTTCAGG + Intergenic
1032424231 7:131807812-131807834 ACTAGCTGCACTAAGATTTCAGG - Intergenic
1032963336 7:137066421-137066443 AATTGCTAGGATAAAACTTCAGG - Intergenic
1033111052 7:138576882-138576904 ACTAGCTAGGAGGAATTTTCAGG - Intronic
1035163837 7:156971635-156971657 TCGAGCTAAAATAAAATTTGAGG - Exonic
1036039694 8:5061882-5061904 ACTAGCTAGAAGAGAATATTTGG - Intergenic
1037684292 8:21125226-21125248 ACTAGCTAGGATACAGTTTGGGG - Intergenic
1038555804 8:28514062-28514084 ACTTTCTAAAATTAAATTTCTGG - Intronic
1039703519 8:39984864-39984886 ACTAGCTAGAATAAAATGTGGGG + Intronic
1040623664 8:49118919-49118941 AGGATCAAGAATAAAATTTCTGG + Intergenic
1041528834 8:58839356-58839378 ACTCTCTAGAATCTAATTTCTGG - Intronic
1041768460 8:61445793-61445815 TCTACCAAGAATAAAAGTTCTGG - Intronic
1041768731 8:61449404-61449426 GCTAGGAAGAATAAAAGTTCTGG + Intronic
1043920231 8:85974190-85974212 ACTAGCTGGGATCAAATTTATGG + Intergenic
1043999499 8:86862117-86862139 ACTTTCTAGTATAATATTTCAGG + Intergenic
1045627213 8:104068230-104068252 ATTAGATAGAAAACAATTTCTGG - Intronic
1045707984 8:104948884-104948906 AGTAAATAGAATAAAATTTCAGG + Intronic
1046151200 8:110228712-110228734 GCTAGCTTGGATAATATTTCTGG + Intergenic
1046181161 8:110649954-110649976 ACAATCTTGAATAAAATCTCAGG - Intergenic
1046360617 8:113149648-113149670 ACTAGCTAAAAGTAAATTTTGGG - Intronic
1047836486 8:128699027-128699049 ACTAATTAGAACAAAAATTCTGG - Intergenic
1050045921 9:1545099-1545121 ACTAGCTAGAAAAACACCTCAGG - Intergenic
1050310624 9:4349634-4349656 ACTAGCAAAAATAAGATTCCAGG + Intergenic
1051023333 9:12572745-12572767 ACTATGTAAAATAAAATCTCTGG - Intergenic
1051193135 9:14535172-14535194 ACTAGCTAGAACAAATGTTTGGG + Intergenic
1057349008 9:94278852-94278874 AATAGCTAGGAAGAAATTTCAGG - Intronic
1059000151 9:110340296-110340318 ATAAGCATGAATAAAATTTCTGG - Intergenic
1186070804 X:5817985-5818007 GCTAGCTAGAAAAAAAGTTAAGG + Intergenic
1186613385 X:11160664-11160686 ACTAGCTTGACAAAAATTTATGG - Intronic
1186876946 X:13826401-13826423 ACTAGCTTTAAGAAAGTTTCTGG + Intronic
1187364197 X:18653092-18653114 AATATGTAGAATAATATTTCTGG + Intronic
1187755994 X:22527149-22527171 ACTAGTTAGATTAAAAATTATGG + Intergenic
1187767695 X:22661460-22661482 ACTAGCTGTAATAGAGTTTCAGG - Intergenic
1188187739 X:27135851-27135873 ACGGCCTAGAATGAAATTTCAGG + Intergenic
1188887525 X:35568782-35568804 ACCAGATAGAATAAAATTGGTGG + Intergenic
1189184290 X:39039235-39039257 ACTAGATAGAAAAAAGTTTTAGG - Intergenic
1189677268 X:43474319-43474341 ACTAGCTAAATCAGAATTTCTGG - Intergenic
1190043579 X:47093004-47093026 TCTAACTAGATTGAAATTTCAGG - Exonic
1191084904 X:56555194-56555216 AATTGCAAGAATACAATTTCTGG + Intergenic
1193711918 X:84891385-84891407 AATAACTACAATAAAATTTCTGG - Intergenic
1194903191 X:99540696-99540718 ATTTGTTTGAATAAAATTTCTGG - Intergenic
1196348333 X:114695018-114695040 ACAAGCAAGATTATAATTTCTGG + Intronic
1196766930 X:119254460-119254482 ACTAGCTAGATTAAGATGTCTGG - Intergenic
1197358084 X:125461606-125461628 AGTAGCTAAAAAAAAATCTCAGG - Intergenic
1199970631 X:152858076-152858098 ACAAGCAAGAATAAAAATTCAGG - Intronic
1201420691 Y:13795421-13795443 ACCAGCAGGAATAAAATTTTAGG - Intergenic