ID: 945835310

View in Genome Browser
Species Human (GRCh38)
Location 2:214832831-214832853
Sequence AAATGCCACCTGGCCAAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945835310_945835315 21 Left 945835310 2:214832831-214832853 CCAAATTTGGCCAGGTGGCATTT No data
Right 945835315 2:214832875-214832897 TGTTTAAAAGTCTTGAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945835310 Original CRISPR AAATGCCACCTGGCCAAATT TGG (reversed) Intergenic
No off target data available for this crispr