ID: 945843436

View in Genome Browser
Species Human (GRCh38)
Location 2:214915207-214915229
Sequence ACGTTGGTGGAGAGGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945843420_945843436 29 Left 945843420 2:214915155-214915177 CCTGTGCCCTGTAGTTCAAGGTG No data
Right 945843436 2:214915207-214915229 ACGTTGGTGGAGAGGGAGGCAGG No data
945843421_945843436 23 Left 945843421 2:214915161-214915183 CCCTGTAGTTCAAGGTGTTTATC No data
Right 945843436 2:214915207-214915229 ACGTTGGTGGAGAGGGAGGCAGG No data
945843422_945843436 22 Left 945843422 2:214915162-214915184 CCTGTAGTTCAAGGTGTTTATCT No data
Right 945843436 2:214915207-214915229 ACGTTGGTGGAGAGGGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945843436 Original CRISPR ACGTTGGTGGAGAGGGAGGC AGG Intergenic
No off target data available for this crispr