ID: 945848583

View in Genome Browser
Species Human (GRCh38)
Location 2:214978827-214978849
Sequence TGCCGTAGCACCCGATGTTG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 29
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 27}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945848582_945848583 -5 Left 945848582 2:214978809-214978831 CCACGGTGGTATCTGAAATGCCG 0: 1
1: 0
2: 0
3: 9
4: 108
Right 945848583 2:214978827-214978849 TGCCGTAGCACCCGATGTTGAGG 0: 1
1: 0
2: 0
3: 1
4: 27
945848581_945848583 -2 Left 945848581 2:214978806-214978828 CCTCCACGGTGGTATCTGAAATG 0: 1
1: 0
2: 0
3: 5
4: 62
Right 945848583 2:214978827-214978849 TGCCGTAGCACCCGATGTTGAGG 0: 1
1: 0
2: 0
3: 1
4: 27
945848580_945848583 1 Left 945848580 2:214978803-214978825 CCTCCTCCACGGTGGTATCTGAA 0: 1
1: 0
2: 0
3: 13
4: 87
Right 945848583 2:214978827-214978849 TGCCGTAGCACCCGATGTTGAGG 0: 1
1: 0
2: 0
3: 1
4: 27

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945848583 Original CRISPR TGCCGTAGCACCCGATGTTG AGG Exonic
901804947 1:11732667-11732689 TGCCAAAGCACCAGATATTGGGG - Intergenic
907486987 1:54785134-54785156 TCCCGTAGCACGTGGTGTTGTGG + Intronic
1063019875 10:2117084-2117106 TGCTCTAGCCCCTGATGTTGGGG + Intergenic
1074442719 10:113492973-113492995 TGTGGGAGCACCCCATGTTGTGG + Intergenic
1088662723 11:112064568-112064590 TCCTGAAGCACCCCATGTTGGGG + Intronic
1105358416 13:19681810-19681832 TGCTGTAGCAGCCAGTGTTGTGG - Intronic
1111321638 13:86637479-86637501 GGCCATAGCACCCAATGTGGAGG - Intergenic
1113941173 13:114019291-114019313 TGCCGTGGCTCCCGATGTCACGG + Intronic
1114126496 14:19732468-19732490 TGCAGTAGCACCTCATTTTGTGG + Intronic
1119393670 14:74309581-74309603 TGCCTTAGCCTCCGTTGTTGAGG - Intronic
1120781283 14:88488321-88488343 TGCCGCAGCACCCAGTGTGGAGG + Intronic
1121691607 14:95881664-95881686 TGCCGTCGTAGCTGATGTTGGGG + Intergenic
1127812777 15:62578911-62578933 AGTCTTAGCACCCTATGTTGTGG + Intronic
1135495090 16:22944366-22944388 TGCTGAAGCACAGGATGTTGAGG + Intergenic
1138782130 16:59801463-59801485 TACCGTAGCACATGAAGTTGGGG - Intergenic
1149108423 17:52997103-52997125 TGCCGTAGCCCTGGATGGTGAGG - Intergenic
1168108442 19:54178877-54178899 TGCTGTAGCAGTCGATGTTGCGG + Exonic
939846105 2:147247665-147247687 TGCAGAAGCACATGATGTTGAGG + Intergenic
945848583 2:214978827-214978849 TGCCGTAGCACCCGATGTTGAGG + Exonic
965781038 3:172286407-172286429 TGCCATTGCACCCAATGTTCTGG - Intronic
971810960 4:31426389-31426411 TGCAGTAGCACCTGATCTTCAGG + Intergenic
991297679 5:65099128-65099150 TTCCATAGCACTCGATGTGGTGG - Intergenic
998039616 5:138944101-138944123 TGCCGGAGGACCCGAAATTGTGG + Intergenic
1004705863 6:18122992-18123014 AGCCGTAGCACCCGGCGCTGCGG - Intergenic
1005281476 6:24279148-24279170 TGCAGTAGCCCCCAATGTAGTGG - Intronic
1016416863 6:143842897-143842919 TGCCGTAGCAACGGAGGCTGGGG - Intronic
1059537045 9:115090658-115090680 TGCCGCAGCCCCTGATGTTAAGG - Exonic
1060819901 9:126655260-126655282 TGCCGCCTCACCCGATGTGGTGG + Intronic
1191685461 X:63885100-63885122 TGCTGTAGCCCCCGATGGTCAGG - Intergenic