ID: 945850400

View in Genome Browser
Species Human (GRCh38)
Location 2:214999314-214999336
Sequence CTAGTATAAAGCAGAAATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 234}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945850397_945850400 20 Left 945850397 2:214999271-214999293 CCTGTAATGTTTCTTCCAAGTGA 0: 1
1: 0
2: 1
3: 16
4: 280
Right 945850400 2:214999314-214999336 CTAGTATAAAGCAGAAATGTTGG 0: 1
1: 0
2: 1
3: 29
4: 234
945850396_945850400 21 Left 945850396 2:214999270-214999292 CCCTGTAATGTTTCTTCCAAGTG 0: 1
1: 0
2: 2
3: 24
4: 211
Right 945850400 2:214999314-214999336 CTAGTATAAAGCAGAAATGTTGG 0: 1
1: 0
2: 1
3: 29
4: 234
945850395_945850400 22 Left 945850395 2:214999269-214999291 CCCCTGTAATGTTTCTTCCAAGT 0: 1
1: 0
2: 0
3: 28
4: 245
Right 945850400 2:214999314-214999336 CTAGTATAAAGCAGAAATGTTGG 0: 1
1: 0
2: 1
3: 29
4: 234
945850398_945850400 5 Left 945850398 2:214999286-214999308 CCAAGTGATAGTGTATTTTAGAT 0: 1
1: 0
2: 1
3: 15
4: 181
Right 945850400 2:214999314-214999336 CTAGTATAAAGCAGAAATGTTGG 0: 1
1: 0
2: 1
3: 29
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945850400 Original CRISPR CTAGTATAAAGCAGAAATGT TGG Intronic
900711427 1:4117020-4117042 CTAATATAAAGGGGAAATGTAGG - Intergenic
904342301 1:29844748-29844770 CAGGTATACAGGAGAAATGTGGG - Intergenic
908073489 1:60489638-60489660 CTTGTATAAAGAAAAAATGTGGG - Intergenic
909375496 1:74936941-74936963 TTAGTACAAAGGAGAAATGTAGG - Intergenic
909929573 1:81480346-81480368 TTGGTATAAAGAAGAAATGAAGG - Intronic
910566580 1:88650474-88650496 CTAGTATAGAACAGAAATTTGGG + Intergenic
911095460 1:94051292-94051314 TCAGTATAAAGCAGAAATCCAGG - Intronic
911830044 1:102538777-102538799 CAAGTACAAAGCATAAAAGTGGG + Intergenic
916529418 1:165641597-165641619 CTGGTATAAACAATAAATGTTGG - Intronic
916982548 1:170154280-170154302 CTAGTGTGGAGGAGAAATGTGGG + Intronic
917213369 1:172653397-172653419 ATAGAATACAGCAGAAATGATGG - Intergenic
918176536 1:182051214-182051236 ATAGAATAAAGCAGAAGTGATGG - Intergenic
921837340 1:219791806-219791828 CCACTGTAAAGCAGAAAAGTGGG + Intronic
924268660 1:242309249-242309271 CTAGTAGTAAGCAGAAAAGCGGG - Intronic
924335444 1:242982696-242982718 TTAGCATAAAGCAGAAGTGAAGG - Intergenic
1063778084 10:9287563-9287585 GTATTACAAAGCAGAAATTTAGG + Intergenic
1063976084 10:11416699-11416721 CTCGGATACAGCAGGAATGTTGG + Intergenic
1064626310 10:17265430-17265452 CTAATTTAAAGCAGAAATGATGG - Intergenic
1065528486 10:26645895-26645917 CTAAAATAAACCAGAGATGTTGG + Intergenic
1065641268 10:27784759-27784781 CTAGTATCATACAGAAATGGTGG - Intergenic
1065643640 10:27811941-27811963 CTAGTATTTAGGAGAAATTTGGG + Intergenic
1066348211 10:34610445-34610467 CTAATATTAAACAGAAATCTAGG + Intronic
1066597144 10:37063408-37063430 ATAGTATAAAGTAAAAATGTTGG + Intergenic
1066716246 10:38289519-38289541 CTAGTAGTAAGCAGAAAAGTGGG + Intergenic
1067737175 10:48866553-48866575 ATAGAAAAAAGCATAAATGTCGG + Intronic
1068503234 10:57866287-57866309 GGAGTAAAATGCAGAAATGTAGG + Intergenic
1070249226 10:74759431-74759453 CTAGGATAAAGAACAAATATAGG + Intergenic
1072785791 10:98280905-98280927 ATAATAAAAAGAAGAAATGTTGG - Intergenic
1074664107 10:115698477-115698499 CTAGTGTCAAGAAGAAATGTGGG + Intronic
1075306009 10:121367828-121367850 CTAGTATAAAATAAAAATGAAGG - Intergenic
1076194818 10:128510087-128510109 CTAGTATAAAATAAAAATCTGGG - Intergenic
1079889050 11:26027725-26027747 CTAGTACAAAATAAAAATGTGGG + Intergenic
1080681438 11:34480289-34480311 CTACTATAAAACAGGAATTTTGG - Exonic
1080710590 11:34743738-34743760 CTAGGATAAAGAAGAAAGGAAGG - Intergenic
1081619533 11:44611165-44611187 CTAGTGCAAAGCAAAAATGCAGG - Intronic
1082855992 11:57807220-57807242 GTAGTATAGAGCAGAAATTTAGG + Intronic
1085715447 11:78868887-78868909 CTAATATAAAACAGAAAAGTGGG - Intronic
1085892459 11:80597127-80597149 ATAGTGTAAAGTAAAAATGTTGG - Intergenic
1086643594 11:89191130-89191152 GTAGGAGAAGGCAGAAATGTTGG - Intronic
1087284375 11:96248728-96248750 CTAGTATAAAGAAATAAGGTGGG - Intronic
1087476791 11:98646179-98646201 GTATTTTGAAGCAGAAATGTTGG + Intergenic
1087716156 11:101611418-101611440 GTATTTAAAAGCAGAAATGTTGG + Intronic
1088859386 11:113785622-113785644 CTAGTAAAAGGCAGAAGTGCAGG - Intergenic
1093778917 12:23111424-23111446 CTAGTTTAAAGATGAAATGGAGG + Intergenic
1093842059 12:23915890-23915912 CTATTGTAAAGAATAAATGTGGG + Intronic
1098239170 12:68448864-68448886 CTAGTAATAAGCAGAAAAGAGGG + Intergenic
1098423031 12:70324554-70324576 CTAATCTAGAGCAGAAATTTAGG + Intronic
1099362805 12:81726963-81726985 TTAGAATAAAGAAGACATGTGGG + Intronic
1100170583 12:91970659-91970681 GTAGTGTAAAGAGGAAATGTGGG - Intergenic
1100492530 12:95094919-95094941 TTAATATAAAGCAGAACTTTTGG - Intronic
1103338216 12:120206086-120206108 CCAATAAAAAGCAGAAATATGGG - Intergenic
1103814145 12:123639510-123639532 ATATTCTAAAGCAGAAATGTGGG - Intronic
1104148900 12:126062667-126062689 CTTGTACAAAGCAGAAAAATAGG + Intergenic
1105395325 13:20028042-20028064 CTGGAATAAAGCAGAATTGTTGG - Intronic
1107009092 13:35650012-35650034 CTAACATACAGCAGAAATGAAGG - Intronic
1107326909 13:39254016-39254038 ATAGAAAAAAGCAGAAATGATGG - Intergenic
1108786972 13:53915831-53915853 GTATTATAAAGCAGATATATAGG + Intergenic
1109710636 13:66154251-66154273 GTAGTATATAGCATAAATCTGGG + Intergenic
1110544949 13:76745752-76745774 CCAGCATGAAGCAGAAATGGTGG - Intergenic
1111554856 13:89867335-89867357 ATAGGATCAAGCAGAAAAGTAGG - Intergenic
1112159768 13:96855046-96855068 ATAGTATAAAGCAGGATTCTAGG - Intergenic
1113414574 13:110118203-110118225 CCAGCATCCAGCAGAAATGTGGG + Intergenic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1116000158 14:39234361-39234383 TTGGTATAAAAAAGAAATGTTGG + Intronic
1116529015 14:45944348-45944370 TTATTTTAATGCAGAAATGTTGG + Intergenic
1117529639 14:56647220-56647242 CTAGAAAACAGCAGAAATGTTGG - Intronic
1120633184 14:86916546-86916568 TTAGAATAAAGCAGAAATCAAGG - Intronic
1124171727 15:27380357-27380379 CTCAGATAAAGCAGAGATGTTGG - Intronic
1125047027 15:35253625-35253647 ATGGGAGAAAGCAGAAATGTGGG - Intronic
1125088114 15:35755598-35755620 CTATTACAAATAAGAAATGTTGG + Intergenic
1126046860 15:44649918-44649940 ATAATATAAAGTAGAAATGTGGG - Intronic
1126441554 15:48694933-48694955 CTATAATAAAACAGCAATGTTGG - Intergenic
1126517788 15:49555231-49555253 CTCTTATAAAGCAGATTTGTTGG + Intronic
1127358141 15:58221521-58221543 CAATTATAAAGTAGAAATATTGG - Intronic
1127595454 15:60477981-60478003 CTAGAGTGAAGCAGAAATCTAGG - Exonic
1127656069 15:61057284-61057306 CTAGTATAAAAGAGAAATACAGG + Intronic
1128871447 15:71159170-71159192 CTGGCATAAAGCAGACATATAGG - Intronic
1130817449 15:87452890-87452912 CTAGAAAAAAGCAGTAATGTGGG + Intergenic
1130826312 15:87549944-87549966 AGAGTAGAAAGCTGAAATGTAGG - Intergenic
1133877702 16:9750575-9750597 GTAGTATAAATCAGAGATGATGG + Intergenic
1137974724 16:53021695-53021717 CTAGAATCAAACAGGAATGTCGG + Intergenic
1140968417 16:79989728-79989750 CTTGTATTAAGCTGAGATGTTGG - Intergenic
1141023290 16:80518878-80518900 GTAGTATAAAGGAGAAATAAAGG - Intergenic
1143426743 17:6845487-6845509 CTTGGAGAAAGCAGAAATGATGG + Intergenic
1148375007 17:47135164-47135186 ATAATATAAAACAGAAATGTGGG - Intronic
1149110705 17:53026046-53026068 ATAGCATAAAGCAGCAATGCTGG + Intergenic
1149411658 17:56414459-56414481 CCAGTATTAATCAGAAATATTGG - Intronic
1151119024 17:71771670-71771692 CTAGAATAAAAGAGACATGTAGG + Intergenic
1153741368 18:8132585-8132607 TTAATATACAGCAGAAATTTTGG + Intronic
1155560402 18:27070314-27070336 TTAGTATAAAATAAAAATGTAGG - Intronic
1156355935 18:36339880-36339902 GTAGCATAAACCAAAAATGTGGG - Intronic
1156535006 18:37853911-37853933 CTAGTCTAAAGCAGAGAAATGGG + Intergenic
1157086279 18:44583256-44583278 CTAGCTTGAAGCAGAAAAGTGGG - Intergenic
1157219919 18:45821273-45821295 GCACTATAAAGCAGCAATGTGGG + Intergenic
1162579902 19:11522772-11522794 CTAGTAAAAAGAAAAAAGGTCGG + Intronic
1165771617 19:38383775-38383797 CTACTAAAAAGAATAAATGTTGG + Exonic
926254808 2:11182834-11182856 CTTGTATAAAGCCATAATGTTGG - Exonic
926785834 2:16517732-16517754 CTAGTATAGAGCAGCATTCTTGG + Intergenic
927437584 2:23082725-23082747 CAAGTACAAAACAGATATGTGGG - Intergenic
930732526 2:54742111-54742133 CTAGCATAGAGCAGAAATTCTGG - Intronic
930980776 2:57523790-57523812 GCAGTATAAAGAAGAAGTGTAGG + Intergenic
933360921 2:81282908-81282930 CTTGTTGAAAGCAGAAATGTTGG - Intergenic
933498205 2:83078034-83078056 TAAGTATCAAACAGAAATGTTGG + Intergenic
933516676 2:83312731-83312753 TTAGTAAAAATCAGGAATGTGGG - Intergenic
933551148 2:83777309-83777331 CTAGCATAAAGCAGACACATAGG - Intergenic
933785129 2:85833078-85833100 ATAATATAAAGCCAAAATGTGGG + Intergenic
935684908 2:105674590-105674612 CTAGTCTGAAAAAGAAATGTGGG + Intergenic
938031511 2:127998559-127998581 CTATTATAATACAGAAATATTGG + Intronic
939442963 2:142273516-142273538 CTAATATTAAGAAAAAATGTGGG + Intergenic
939731466 2:145789700-145789722 CTCATATAAAGTAGAAATGATGG - Intergenic
941081845 2:161070860-161070882 CTTGCACAAAGCAGTAATGTGGG - Intergenic
941933988 2:170969126-170969148 ATAGTCAAAAGCAGAAATTTTGG - Intergenic
942761670 2:179405760-179405782 ATAGGAGAAAGCAGAAATGCTGG + Intergenic
943643343 2:190382753-190382775 CTAGTATAAAATGAAAATGTGGG - Intergenic
943703611 2:191012771-191012793 CTGGAGCAAAGCAGAAATGTTGG - Intronic
944499619 2:200345639-200345661 CTAGTAAATAGAAGAAATGCAGG - Intronic
945594129 2:211770701-211770723 CTAGTATGGAGCAGACTTGTTGG - Intronic
945716627 2:213365840-213365862 CTAGTCTAAAGAAGAAAGATAGG + Intronic
945850400 2:214999314-214999336 CTAGTATAAAGCAGAAATGTTGG + Intronic
947341118 2:229140753-229140775 CAAATATAAAGTAGAAATGTTGG - Intronic
947516579 2:230810643-230810665 TTTGTATGCAGCAGAAATGTGGG - Intronic
948925917 2:241097649-241097671 CCAGAATAAAGCAGGAATATAGG - Intronic
1170687387 20:18581814-18581836 CTGTTATAAAGCAGGAATGGGGG - Intronic
1172517576 20:35545627-35545649 CTAGTATATTGCAGAAATGATGG - Intronic
1172563905 20:35913226-35913248 CTAGAATTAAACACAAATGTTGG - Intronic
1175072036 20:56343110-56343132 ATAGAATACAGCAGAAATGATGG - Intergenic
1179049434 21:37876041-37876063 CTAGTGTAAAACAAAAATGCAGG + Intronic
1181822882 22:25489307-25489329 CTAGAGTATAGAAGAAATGTGGG - Intergenic
949219652 3:1616608-1616630 CTAGTATAAAGGAATAATTTTGG + Intergenic
950320300 3:12046000-12046022 GTACTATAAAGGAGAAATATGGG - Intronic
952787496 3:37170169-37170191 CTAATCTAAAGCAAAAAAGTGGG + Intronic
955883654 3:63574621-63574643 CAAGTATAAACCAGAAAGATGGG - Intronic
956710190 3:72032392-72032414 CTAGGATACAGCAGAAAGGAGGG - Intergenic
958096185 3:88948116-88948138 CTAGAGTGAAGCAGAAATCTAGG + Intergenic
959383156 3:105667056-105667078 CTAGCTTAAAGGAGAATTGTTGG - Intronic
959805150 3:110542298-110542320 ATGGTGTAAAACAGAAATGTAGG - Intergenic
959878533 3:111415779-111415801 TCAGTGTAAAGCAGAAATTTGGG + Intronic
960552021 3:118986420-118986442 ATAGTATAAAGCAGAAATTGAGG - Intronic
961507703 3:127381729-127381751 CTAATATAACACAGAAATATAGG + Intergenic
961697215 3:128713824-128713846 GTAATATAACCCAGAAATGTGGG - Intergenic
961854278 3:129853855-129853877 CTAAGTTAAATCAGAAATGTAGG + Intronic
963279593 3:143369746-143369768 ATAGAATATAGCAGAAATGATGG + Intronic
964482499 3:157155936-157155958 CTCGTATAAATCAGAAAAATTGG - Intronic
965305742 3:167060906-167060928 GTAGTATAAATTAGAAATGCAGG - Intergenic
965778105 3:172255159-172255181 CTGGCTTAAAGAAGAAATGTAGG - Intronic
965888691 3:173482271-173482293 CACATATAAAGGAGAAATGTAGG - Intronic
967012416 3:185448608-185448630 ATAGGAAAAAGTAGAAATGTGGG + Intronic
967878728 3:194284156-194284178 CTAGAATATGGCAGAAATGATGG - Intergenic
970088328 4:12373207-12373229 CTAGAATAGAGCACAAATTTGGG - Intergenic
970097403 4:12479400-12479422 GTAGTACAGAGAAGAAATGTGGG - Intergenic
970965785 4:21926424-21926446 CTAGTATAAAGCTGAGAAGCAGG + Intronic
971012844 4:22458180-22458202 CAAGTAGAAAGCAAAAGTGTAGG - Intronic
971830104 4:31681118-31681140 CTTATTTAAAGCAGAAATCTTGG - Intergenic
972555884 4:40180849-40180871 CTGGTATAAAGAAAAACTGTAGG + Intergenic
972902205 4:43699368-43699390 AGAGCATCAAGCAGAAATGTTGG - Intergenic
973058495 4:45689859-45689881 CTAGGATATTGCAGAAATGATGG + Intergenic
974049555 4:56927868-56927890 CTATTTTAAAGCAAAAATATAGG - Intronic
974310453 4:60201511-60201533 CTAATAGAATTCAGAAATGTGGG - Intergenic
976164900 4:82244256-82244278 ATAGAATAAAGCAGAAGTGATGG - Intergenic
976238004 4:82921422-82921444 CTATTATAAAGAAGACATGGAGG + Intronic
976659789 4:87528257-87528279 CTAAAATAAAGCAATAATGTAGG - Intronic
977812624 4:101374723-101374745 AAAGAATAAAGCAGAAATTTTGG + Intergenic
977927154 4:102714240-102714262 ACAATATAAAGCAGATATGTAGG - Intronic
978369629 4:108017380-108017402 CTAGTATAAAGAAGACAAGAGGG - Intronic
979107989 4:116711797-116711819 CTAATATCAAGCATAACTGTTGG + Intergenic
979241670 4:118452597-118452619 TTAGCATAAAGCAGAAGTGAAGG + Intergenic
980493292 4:133558823-133558845 CAAGTATAAAGCAGTAATGTTGG + Intergenic
980708910 4:136538684-136538706 ATAGTAAAAAGCAGAATTCTAGG + Intergenic
980788663 4:137588930-137588952 CTAGTGTAAAGCAAGAATATTGG - Intergenic
981113587 4:140963706-140963728 ATAGTATATAGCAGAAATTCAGG + Intronic
987549026 5:19354208-19354230 AAATTAGAAAGCAGAAATGTGGG + Intergenic
987896041 5:23948639-23948661 CTAAAAAATAGCAGAAATGTTGG - Intergenic
989737167 5:44721682-44721704 CTAGTATAATGCTGAAATAAGGG + Intergenic
990085810 5:51975202-51975224 CTAAAATAATGAAGAAATGTCGG - Intergenic
992196241 5:74341896-74341918 CTCCTAGAAAGCAGAAATGATGG - Intergenic
993007326 5:82442755-82442777 CTAACATACAGCAAAAATGTTGG - Intergenic
993266778 5:85736391-85736413 CTAATAGTAAGCACAAATGTTGG + Intergenic
994079809 5:95695847-95695869 CTTGAATACAGCAGAAATGATGG + Intronic
994237272 5:97377537-97377559 ATAGTATATATTAGAAATGTGGG - Intergenic
994338141 5:98593627-98593649 CTAGTCTAAAGCACAAATGCAGG + Intergenic
995134632 5:108667565-108667587 TAAGTATAAAGAAGAAATCTAGG - Intergenic
995684790 5:114760472-114760494 CTAGGTTTAAGCTGAAATGTAGG - Intergenic
996094589 5:119384722-119384744 TTAGTATAAAGCAGTATGGTTGG - Intronic
998807454 5:145932821-145932843 CTGTTATAAAGGAGAAGTGTAGG + Intergenic
999086901 5:148900667-148900689 CTAGGAAAAAGCACATATGTTGG + Intergenic
1000044710 5:157512648-157512670 CTAGTAAAATTCAAAAATGTAGG + Intronic
1000447869 5:161346478-161346500 TTATTAGAAAGCAGATATGTTGG - Intronic
1000716235 5:164648501-164648523 CTAGTAAAAAGCATACATTTTGG + Intergenic
1000828900 5:166079543-166079565 CAAGTCTAAAGAAGGAATGTTGG - Intergenic
1001365893 5:171139539-171139561 CTAGTATAAACCAGAAACCTAGG + Intronic
1002121605 5:177008760-177008782 ATAGAATAAGGCAGAAATGATGG + Intronic
1002129696 5:177072939-177072961 CAAGTATTAGGCAGAAATCTTGG - Intronic
1003109311 6:3240353-3240375 ATGGTATAAAGGAGAAATTTTGG - Intronic
1005139739 6:22614946-22614968 CTTTTACAAAGCAGAAAGGTGGG - Intergenic
1005325163 6:24692893-24692915 ACATTATAAAGCAGAAATGCTGG + Intronic
1005901151 6:30217422-30217444 CTACCAGAAAACAGAAATGTTGG - Intergenic
1006254920 6:32823312-32823334 CTCTTATAAAGCAGAAATTAAGG - Intronic
1006966765 6:37994863-37994885 CTAGTGTACACCAGAAATTTGGG - Intronic
1008175268 6:48261068-48261090 CAAGTGCAAAGCAAAAATGTGGG + Intergenic
1008793249 6:55265959-55265981 CTAGTAATAAGCAGAAAAGAGGG - Intronic
1010497654 6:76554736-76554758 CTGCTATGAAGCAGAAATGTGGG - Intergenic
1011847836 6:91589016-91589038 TTAGTATAAATCTGAAATGATGG - Intergenic
1013963570 6:115928905-115928927 GTATTATAGAGGAGAAATGTGGG - Intergenic
1014002356 6:116378764-116378786 CTAGAATAAAAAAGAAATGTGGG - Intronic
1014450650 6:121577714-121577736 ATAATATAATGTAGAAATGTAGG - Intergenic
1015505471 6:133981945-133981967 CTTGAATAAAGGAGAAATGTTGG - Intronic
1017562032 6:155638403-155638425 CAAGCATGAAGCAGCAATGTTGG - Intergenic
1020696559 7:11420582-11420604 GCAGTGTGAAGCAGAAATGTGGG + Intronic
1022915067 7:34940601-34940623 CCAGTACAAAACAAAAATGTGGG + Intronic
1027527808 7:79292941-79292963 ATTGTTTAAAGCAGTAATGTAGG - Intronic
1027978904 7:85191727-85191749 CTTGAACAAAGCAGAAGTGTTGG - Intergenic
1033642006 7:143270093-143270115 CTAGTATAAAATAAAAATATGGG + Intronic
1034397652 7:150839327-150839349 CCAGTATAAAGTGAAAATGTGGG + Intronic
1035960762 8:4134943-4134965 CTAGTATACAACAGATGTGTTGG - Intronic
1035993373 8:4516847-4516869 CTAGTATAAAGAAAAAAAATTGG - Intronic
1036040800 8:5078736-5078758 CTAGCATAAGGGAGAAAAGTAGG - Intergenic
1037152871 8:15658961-15658983 CTTGTTAAGAGCAGAAATGTTGG + Intronic
1037321165 8:17644703-17644725 CTAGTATAATTAAGAAAGGTAGG - Exonic
1037996905 8:23359299-23359321 ATAGAATACAGCAGAAATGATGG + Intronic
1038879931 8:31598288-31598310 CTAGTATAAAATAAAAATATGGG + Intergenic
1038895036 8:31773056-31773078 CTACTCTAATGCAGAAAGGTTGG + Intronic
1039660185 8:39452873-39452895 CTAAAATAAGTCAGAAATGTTGG - Intergenic
1039754495 8:40509065-40509087 CTAGGATCAAGCAGAACTGAAGG - Intergenic
1040118284 8:43650357-43650379 ATAGTAGAAAGCAGATATCTGGG + Intergenic
1040559679 8:48513635-48513657 CAAGTATAGAGCAGAACAGTGGG - Intergenic
1040989075 8:53329797-53329819 CTGGCTTAAAGAAGAAATGTGGG - Intergenic
1041811722 8:61918843-61918865 CAAATATAAAACAGAAATGTCGG - Intergenic
1042797945 8:72685077-72685099 CTGTTCTAAAGCACAAATGTTGG + Intronic
1042870718 8:73396301-73396323 CTAGTAGAAAGAATAAAAGTAGG + Intergenic
1044206764 8:89499996-89500018 ATAGAATACAGGAGAAATGTTGG - Intergenic
1044294787 8:90515401-90515423 GTAGTATAAAGTAGATATGGGGG + Intergenic
1046019326 8:108645486-108645508 CTAGCAGAAAGAAGAAATTTTGG + Intronic
1046699553 8:117384551-117384573 CCTGTAAAAAGCATAAATGTTGG - Intergenic
1047914093 8:129563006-129563028 ATAATACAAAGCAGATATGTAGG - Intergenic
1048636584 8:136302306-136302328 CTATAATAAAACAGAAATATTGG - Intergenic
1051152538 9:14099071-14099093 TTAGTATAAAGCAGAAAAGAGGG + Intronic
1052789110 9:32857932-32857954 CTGGTAGAATTCAGAAATGTGGG - Intergenic
1053255041 9:36609794-36609816 CTTATATAAAGCAGAAATTCAGG - Intronic
1055182583 9:73406239-73406261 CTAGAATAAAGAAGAAATATAGG + Intergenic
1055778145 9:79788882-79788904 CTAATATAAATCAGACTTGTAGG - Intergenic
1056487488 9:87073359-87073381 CCAGTATAAAGTAAAATTGTGGG - Intergenic
1059079004 9:111226884-111226906 GAAGGATAAAGCAGAAATTTAGG - Intergenic
1059617542 9:115967368-115967390 GCAGTATAAAGTGGAAATGTGGG - Intergenic
1187565577 X:20446421-20446443 CTGGTTTATAGCAGAAATTTTGG - Intergenic
1187585490 X:20657015-20657037 CAAAAGTAAAGCAGAAATGTAGG + Intergenic
1188728381 X:33613825-33613847 TTAATTTAAAGCTGAAATGTAGG + Intergenic
1189669105 X:43388652-43388674 ATAGAATACAGCAGAAGTGTTGG - Intergenic
1190896255 X:54621174-54621196 TTAGCATATAGCAGAAATGATGG + Intergenic
1191735494 X:64384430-64384452 GCAGTATAGAGGAGAAATGTAGG - Intronic
1192297096 X:69862332-69862354 ACAGAATAAAGCAGAAATGATGG - Intronic
1194157735 X:90414391-90414413 ATAGAATAAAGCAGAAATTCTGG - Intergenic
1194434869 X:93857078-93857100 CTAATAAAAAGCAGTTATGTAGG + Intergenic
1194449046 X:94019624-94019646 CTAGAATAAAGCAGAGATCATGG + Intergenic
1196008680 X:110863249-110863271 CTAATTAAAAGCAGATATGTTGG + Intergenic
1196296455 X:114003127-114003149 TTAGTATAAACCATAAAAGTAGG - Intergenic
1197190170 X:123638297-123638319 GTAGGCTAAAGAAGAAATGTTGG - Intronic
1197381705 X:125751297-125751319 CTAGAATAAAGAAAAAAAGTGGG + Intergenic
1197629168 X:128838021-128838043 CTAGTATGAAGTAGAATAGTAGG - Intergenic
1198573978 X:137989850-137989872 CTCGTAAAAAGGAGAAATTTGGG - Intergenic
1198894390 X:141436330-141436352 TTAGGATAAAGCAGAATTGTAGG - Intergenic
1200251255 X:154555306-154555328 CTAGAAGACAGCAGAGATGTAGG + Intronic
1200504069 Y:3991363-3991385 ATAGAATAAAGCAGAAATTCTGG - Intergenic
1200568184 Y:4794185-4794207 CTGTTTTAAAGCAGAAATATTGG - Intergenic
1202389381 Y:24354427-24354449 TTAGCATAAAGCAGAAGTGAAGG + Intergenic
1202481406 Y:25315692-25315714 TTAGCATAAAGCAGAAGTGAAGG - Intergenic