ID: 945851258

View in Genome Browser
Species Human (GRCh38)
Location 2:215010452-215010474
Sequence AGGGAGAAGCAAAATGGTGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 403
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 376}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945851254_945851258 7 Left 945851254 2:215010422-215010444 CCAGCGGGCATGTTAATGATGTC 0: 1
1: 0
2: 0
3: 2
4: 35
Right 945851258 2:215010452-215010474 AGGGAGAAGCAAAATGGTGCTGG 0: 1
1: 0
2: 2
3: 24
4: 376
945851252_945851258 21 Left 945851252 2:215010408-215010430 CCCAAATCACAGGTCCAGCGGGC 0: 1
1: 0
2: 0
3: 2
4: 63
Right 945851258 2:215010452-215010474 AGGGAGAAGCAAAATGGTGCTGG 0: 1
1: 0
2: 2
3: 24
4: 376
945851253_945851258 20 Left 945851253 2:215010409-215010431 CCAAATCACAGGTCCAGCGGGCA 0: 1
1: 0
2: 0
3: 6
4: 74
Right 945851258 2:215010452-215010474 AGGGAGAAGCAAAATGGTGCTGG 0: 1
1: 0
2: 2
3: 24
4: 376

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945851258 Original CRISPR AGGGAGAAGCAAAATGGTGC TGG Exonic
900989413 1:6091465-6091487 AAGGAAAAGCAAAGTGGTGTTGG + Intronic
902470492 1:16645164-16645186 AGGCAGCAGCAAAAGGGTGGAGG + Intergenic
902873880 1:19329557-19329579 AGGAAGAAGCAGAATGGTTAAGG + Intergenic
903311949 1:22465655-22465677 AGGGAGAAGCCAAACAGTGGGGG + Intronic
905872900 1:41415251-41415273 AGGGAGAAGCAGGAAGGTGGAGG - Intergenic
906636843 1:47415917-47415939 GGGGAGGAGCAAAATGGGGAGGG + Intergenic
906734682 1:48114423-48114445 AGGGAGAGGACAAATGGTGTAGG - Intergenic
907207735 1:52788928-52788950 TGGGAGGAGAAAAATGGTGAAGG + Intronic
907281034 1:53347129-53347151 AGGGAGAAGCAAACTGGGGGAGG + Intergenic
907963629 1:59307827-59307849 AGGGAGAAGGGAAAGGGAGCTGG - Intronic
908361266 1:63370112-63370134 AGTAAGAAGCAAATTGATGCCGG - Intronic
909589769 1:77334077-77334099 AGGTAGAAGAAAAATGATCCAGG - Intronic
910791392 1:91054751-91054773 AGGCAGCAGCCAGATGGTGCAGG + Intergenic
911060714 1:93745514-93745536 GAGGAGAAGAAAAATGGTGGGGG - Intronic
911604765 1:99891446-99891468 AGGAAGGAGGAAAATGGTTCAGG - Intronic
914920563 1:151844556-151844578 AGGGAGAAGAACAATGGAGGAGG - Intergenic
915277820 1:154801698-154801720 AGGAAGAGGCAAGATGGTGGAGG + Intronic
915285455 1:154849295-154849317 AGCAAGAAGCAAGATGGAGCAGG + Intronic
916807018 1:168269197-168269219 AGGGAGAAGAACGATGCTGCTGG - Intergenic
917140305 1:171828522-171828544 AGAGAGAAGCAAGAGGGTGGAGG + Intergenic
917568829 1:176242013-176242035 AGGAAGAAGAAAAATGGTATAGG - Intergenic
917782200 1:178410083-178410105 AGGGAGAAGGAAAAGAGAGCAGG + Intronic
918990909 1:191696130-191696152 AGGTAGAAGCAAGATGGAGATGG - Intergenic
921250365 1:213291748-213291770 AGAGGGAAGCAGAATGGTGTGGG - Intergenic
922111908 1:222567065-222567087 ATGGATAAGCAAAATGTTGTAGG + Intronic
923010010 1:230081170-230081192 AGGAAGAAGCAAAGGGCTGCAGG - Intronic
923370188 1:233302618-233302640 AAGGAGAAGCAAAAAAATGCAGG - Intergenic
923449437 1:234102907-234102929 AGGGAGAAGTAAAAGTGGGCAGG + Intronic
924062777 1:240193601-240193623 AGGGAGAAGCGCAATAGTCCAGG + Intronic
1063350959 10:5354657-5354679 AGGGAGAAGAAATATGGAGAAGG - Intergenic
1063996618 10:11626043-11626065 AGGGAGAAGGAGAGTAGTGCAGG + Intergenic
1064043451 10:11988990-11989012 AGGGATAAGCCAAATCCTGCAGG + Intronic
1064178084 10:13092742-13092764 AGAAAGAAGCAAAATGTTGCTGG + Intronic
1064940483 10:20729433-20729455 AGGCAGAAGGAAAATGATACTGG + Intergenic
1066626505 10:37412544-37412566 AGGGAGAAGAACAATAGTGGAGG + Intergenic
1067394616 10:45903045-45903067 GGGGAGAAGAAAGATGGGGCAGG + Intergenic
1067723633 10:48749828-48749850 AGGCAGAAGCAAGAAGGAGCAGG - Intronic
1067862939 10:49872176-49872198 GGGGAGAAGAAAGATGGGGCAGG + Intronic
1068644258 10:59448229-59448251 ATGTAGAAACAAAATGGTTCAGG + Intergenic
1068890137 10:62140196-62140218 AGAGAGAAGAAAAATGATACAGG - Intergenic
1068985582 10:63104980-63105002 AGTTAGAAGCAAGATGGAGCTGG + Intergenic
1070149673 10:73798003-73798025 TGGGAGAAACAAAGTTGTGCAGG - Exonic
1070506376 10:77116942-77116964 AGGGAGAGGCCAAATCATGCAGG - Intronic
1070763510 10:79042237-79042259 AGAGAGAAGGAAAATGATACAGG + Intergenic
1071278835 10:84081181-84081203 AGGCAGAAGGAAAATGATACAGG - Intergenic
1071295880 10:84219303-84219325 AGGGAGAGGGAAAATGGTCTAGG - Intronic
1071950070 10:90693136-90693158 AGGAACAGGCAACATGGTGCTGG - Intergenic
1072329064 10:94328094-94328116 GAGGAGAAGCAAAATGGCACAGG + Exonic
1072867186 10:99076312-99076334 AGGGAGAAGTAAAAGTGTACAGG - Intronic
1073168885 10:101484312-101484334 ATGCTGAAGCAAAATGGTCCTGG + Intronic
1073339643 10:102735225-102735247 AGGGAGGAGCAACATGGAGAGGG - Intronic
1073660523 10:105471208-105471230 AGGCACAAGCAAAATGCTTCAGG + Intergenic
1073782519 10:106854995-106855017 AGAGAGAAGGAAAATGATACAGG - Intronic
1075494537 10:122908595-122908617 AGGGAGAAGGAAAGGGGTCCTGG - Intergenic
1076875042 10:133211654-133211676 AGGCAGAAGCACAGTGGTGGGGG - Intronic
1077550110 11:3196465-3196487 AGGGAGAAGCAAGGTCGTGCAGG - Intergenic
1078413780 11:11148860-11148882 GGGGAGAAGCAGAATGAGGCAGG - Intergenic
1078433588 11:11306488-11306510 AGGGACAAGGAAAATGGAGATGG - Intronic
1080866581 11:36200606-36200628 ATGGAGAGGCAACATGGTGATGG + Intronic
1081489696 11:43557882-43557904 GTGGAGAAGCTAAATGGGGCAGG + Intronic
1082767398 11:57180464-57180486 AGGGAGAAGCGAGAGGGCGCGGG + Intergenic
1085220403 11:74869587-74869609 AGGGATGGGCAACATGGTGCAGG + Intronic
1085338665 11:75717370-75717392 AGTGAGCAGAAAAATGGGGCAGG + Intergenic
1085338855 11:75718359-75718381 AGGGAGGAGGAAACTGGGGCTGG + Intronic
1085599565 11:77843110-77843132 GTGGAGATGTAAAATGGTGCAGG - Intronic
1086270398 11:85056958-85056980 AGGTAGAAGGAAAATGATACTGG + Intronic
1087942904 11:104122282-104122304 AGGAATAAGCAACATGGTGCAGG + Intronic
1089100357 11:115957945-115957967 AGGGAGTAAATAAATGGTGCAGG - Intergenic
1089503591 11:118947973-118947995 AGTGAGAAACAAAATGATCCAGG - Intronic
1089898895 11:121960779-121960801 AGGCAGAAGGAAAAAGGTGCTGG + Intergenic
1090198680 11:124839092-124839114 AGGGAGAAGGAATAGGGGGCAGG - Intergenic
1090234067 11:125133495-125133517 AGGAGGAAGCAAAAGGGTGTGGG - Intergenic
1090510737 11:127372050-127372072 AGGGAGAACCCAGATGGCGCTGG - Intergenic
1090743989 11:129692269-129692291 AGAGAGAAGAAAAGTGGAGCTGG - Intergenic
1093284029 12:17235168-17235190 AGGGAGAAGTAGAAGTGTGCAGG - Intergenic
1094164504 12:27428344-27428366 AGTTAGAAGCAAGATGGAGCTGG + Intergenic
1094320416 12:29176760-29176782 AGGCAGAATCAAAATGGTCAGGG - Intronic
1095154971 12:38841857-38841879 AGGGAGAAGCAGAAAGATGAAGG + Intronic
1095392414 12:41724543-41724565 AAGCACAAGCAAAGTGGTGCTGG + Intergenic
1096073132 12:48787183-48787205 AGGCTGAAGCAAAATGTTGTGGG - Intronic
1096795065 12:54071601-54071623 AGGCAGAAACAAGATGGGGCAGG + Intergenic
1097476594 12:60064662-60064684 ATGGAGAAGAAAAATGGTATCGG - Intergenic
1098756158 12:74365652-74365674 AGGATGAAGCTAAATGGAGCTGG - Intergenic
1098934270 12:76459942-76459964 AGGAAGAAGCAAAATGCATCAGG + Intronic
1100630305 12:96382101-96382123 AAGGAAATGCAAAATGGTGTGGG + Intronic
1100786411 12:98083181-98083203 AGGGAGAAGCAATACTGTACAGG - Intergenic
1103739050 12:123078881-123078903 TGGGAGCAGCGAAATGGGGCTGG + Intronic
1103744089 12:123110493-123110515 AGGGAGAAGCACAATGGGAGAGG + Intronic
1104693056 12:130840822-130840844 AGGGAGAATTAAAATGGTGGTGG - Intergenic
1105564685 13:21532955-21532977 AGAGAGAAACAAACTGGTGATGG + Intronic
1105746674 13:23383593-23383615 AGGGAGGAGCCAGATGCTGCAGG - Intronic
1106052138 13:26201468-26201490 AGGCAGAAGATAAATGGTGGGGG + Intronic
1106312824 13:28568648-28568670 ATGGAGCAGCACAGTGGTGCTGG - Intergenic
1106785676 13:33106099-33106121 AGGGAGCAGCAAAAGGGGACAGG + Intronic
1108152958 13:47555577-47555599 TTGGAGAAGCAGCATGGTGCAGG - Intergenic
1108584974 13:51863239-51863261 AGGGAGAAGCAAGCTGGAGTTGG + Intronic
1108732879 13:53253341-53253363 AGAGAGCAGCAAAAGGGGGCAGG - Intergenic
1109881694 13:68486825-68486847 ATGGTGAAGGAAAATGGTGAAGG - Intergenic
1110827136 13:79985687-79985709 AGAGAGAAGAAAAATGATACCGG - Intergenic
1111249194 13:85581095-85581117 AGTTAGAAGCAAAATGATCCTGG - Intergenic
1111511425 13:89269607-89269629 AGGGGAAAGCAAATTTGTGCAGG - Intergenic
1111799148 13:92960709-92960731 GGGCAGAAGAAAAATGCTGCCGG + Intergenic
1111937738 13:94573690-94573712 AGGAGGAAGCAAAATTGGGCAGG - Intergenic
1112109179 13:96275826-96275848 AGAGAGAAGAAGAATGGTACTGG - Intronic
1112654573 13:101436655-101436677 AGGAAGAAGCAAGATTGGGCAGG + Intergenic
1112869547 13:103953273-103953295 AGGAAGAAGGAAAAGGGTGCAGG - Intergenic
1113074391 13:106453465-106453487 AGGGAGAAGGAAACTGCTGAGGG + Intergenic
1113142908 13:107174754-107174776 AGGGAGAAGCAGGATGTGGCTGG + Intronic
1113970432 13:114184737-114184759 AGAGAGAACAAAAATGGTGTAGG + Intergenic
1115720067 14:36151007-36151029 AGGGAGAAGAAAAATGATATAGG - Intergenic
1116083904 14:40209762-40209784 AGGGAGAAGAACAATGATACAGG + Intergenic
1116548696 14:46206034-46206056 GTGGGGATGCAAAATGGTGCAGG + Intergenic
1117642613 14:57816137-57816159 AGGGAGAATCACAATGATGGTGG + Intronic
1118422655 14:65623792-65623814 AGGTACCAGCAAAATAGTGCTGG - Intronic
1118500923 14:66361958-66361980 GAGGAGAGGCAAAATGGTGGTGG + Intergenic
1118841192 14:69513724-69513746 AGGGAGAAGGAAAATGATATAGG - Intronic
1119331303 14:73796074-73796096 AAGGCCAAGCACAATGGTGCAGG - Intergenic
1119886873 14:78150915-78150937 AGGGAGGAGAAAAATGATGAGGG - Intergenic
1120590793 14:86371221-86371243 AGGGAGAGGAAAGATGATGCAGG - Intergenic
1120867306 14:89306660-89306682 AAGGAGAACCAAAATGGGCCGGG - Intronic
1121636339 14:95456387-95456409 AGGGAGAAGAACCGTGGTGCAGG - Intronic
1121986015 14:98506704-98506726 AGTGAATAGCAAGATGGTGCTGG + Intergenic
1123893542 15:24805156-24805178 AGGTAGAAGAAAAATGGAGTTGG + Intergenic
1124344273 15:28911343-28911365 CAGGGGAAGCAAAATGGTCCAGG - Intronic
1124962217 15:34407475-34407497 CAGGGGAAGCAAAATGGTCCAGG - Intronic
1124978840 15:34553696-34553718 CAGGGGAAGCAAAATGGTCCAGG - Intronic
1125792703 15:42381254-42381276 AGGGAGAAGAAAAATGATACAGG - Intronic
1126166775 15:45660194-45660216 AGGAAAAAGCAAAATGGATCAGG + Intronic
1126180507 15:45780820-45780842 AGGCAGAAGCCAAAGGGGGCAGG - Intergenic
1127192320 15:56543607-56543629 AGAGAGGAGGAAAATGGTGTAGG - Intergenic
1127762634 15:62153962-62153984 AGGTAGAAGAAAAATGGGGAAGG + Intergenic
1128531878 15:68458551-68458573 ATGGAAAATGAAAATGGTGCAGG + Intergenic
1128687402 15:69696951-69696973 ACAGAGAAGCAGAATAGTGCTGG - Intergenic
1128734640 15:70046305-70046327 AGAGACAAGCAAATAGGTGCAGG + Intergenic
1128845378 15:70890184-70890206 ATGAAGAAGAAAAATGGTGTAGG + Intronic
1129711397 15:77821998-77822020 AGGTAGAAGGAAAATGGTCAGGG - Intergenic
1131533750 15:93216524-93216546 AGGAAGAAGCCAAATTGTGAAGG - Intergenic
1132108840 15:99087482-99087504 AGGGAGCAGCAGAATGTTTCCGG - Intergenic
1132758958 16:1499754-1499776 AGGGTGAAGCAAGATGTGGCCGG - Intronic
1132831886 16:1932468-1932490 AGGGAGAAGCAGAAAGGGACAGG + Intergenic
1134183792 16:12067421-12067443 GGGGACAAGGAACATGGTGCTGG - Intronic
1135616397 16:23914472-23914494 TGGGAGAGGCAGAATGGTGTTGG + Intronic
1135958824 16:26979029-26979051 AGGGAGGATCAAAAAGGTGGGGG - Intergenic
1137029139 16:35506239-35506261 AGGGAGGAGCAAGAAGGGGCGGG + Intergenic
1137265930 16:46868972-46868994 GGGCAGAGGCAAAATGCTGCCGG + Intergenic
1137679215 16:50324520-50324542 AGGAAGAAGCAGAAGAGTGCAGG - Intronic
1137775670 16:51052481-51052503 AGGAAGAAACAGAATGGGGCAGG - Intergenic
1137820778 16:51443318-51443340 AGGGAGAAGATAATTTGTGCTGG + Intergenic
1137964555 16:52917395-52917417 TGGGAAATGCAAAATGGTGGAGG - Intergenic
1138781206 16:59790189-59790211 AGGCAGAAGGAAAATGATACAGG - Intergenic
1138793296 16:59935283-59935305 ATGGGAATGCAAAATGGTGCAGG - Intergenic
1142600347 17:1050779-1050801 GGGGAGAAGCCAGATGGTCCCGG - Intronic
1142669589 17:1481867-1481889 AGAGAGAGGCCAAACGGTGCAGG - Intronic
1142957024 17:3529285-3529307 AAGGAGGAGCAAACTGGGGCTGG - Intronic
1143341110 17:6211777-6211799 AGGGGGAAGGAAGAGGGTGCTGG + Intergenic
1143549202 17:7619014-7619036 AGGGAAAACAAAAATGGTACAGG + Intronic
1143685555 17:8512335-8512357 ACAGAGAAGCAAAAGGGTTCTGG - Intronic
1143783692 17:9242056-9242078 AGGAGGCAGCAAAGTGGTGCGGG + Exonic
1144657003 17:17043049-17043071 AGGGAAAATAAAAATGGAGCAGG + Intronic
1145987433 17:29056465-29056487 AGGCAGAAGAAAAAGGGAGCGGG - Exonic
1148346157 17:46904857-46904879 AGGGAGAAGCAGAGTTCTGCAGG - Intergenic
1150161481 17:62901809-62901831 AGGGAGTAGCTAGATGGTGCTGG - Intergenic
1150221984 17:63500943-63500965 AGGGAGAGGCAACATGGGGAGGG - Intronic
1150778187 17:68099014-68099036 AGGGAACAGCATAATGGTCCAGG - Intergenic
1153148940 18:2067962-2067984 AGCAAGAAGCAAAATGGGGGTGG - Intergenic
1153384972 18:4482608-4482630 TGGGAAAAGCAGAATGATGCAGG + Intergenic
1153962876 18:10154298-10154320 AAGGAGAAGAAAAATGATGAAGG + Intergenic
1155669382 18:28350548-28350570 AGGTTGAAGCAAAATGGAGGTGG - Intergenic
1155769864 18:29682928-29682950 AGGAATAGGCAACATGGTGCTGG - Intergenic
1156069638 18:33190948-33190970 AGTGAGAAGCAAATTGCTGATGG - Intronic
1156437859 18:37153015-37153037 AGGAACAGGCAACATGGTGCTGG + Intronic
1156509588 18:37625318-37625340 AGGGAGAAGCAAAATCCTCATGG - Intergenic
1157723041 18:49940338-49940360 ACAGAGTAGCAAGATGGTGCTGG + Intronic
1157781660 18:50445047-50445069 GGGCAGCAGCAAAATGCTGCCGG + Intergenic
1159373275 18:67557814-67557836 AGAGAGAAGAAAAATGATACAGG - Intergenic
1159707214 18:71706615-71706637 GGGAAGAGGCAACATGGTGCGGG + Intergenic
1159746515 18:72242868-72242890 AGGGTGAAGAAAAATGGGGGTGG + Intergenic
1162461328 19:10815913-10815935 AGGGAGAAGCAAAGAGAGGCGGG + Intronic
1162687130 19:12396884-12396906 AGAGAGAAGAAAAATGATACAGG + Intronic
1162691457 19:12436711-12436733 AGAGAGAAGAAAAATGTTACAGG + Intronic
1163411775 19:17159353-17159375 AGGGAGAAGGAAAAGGGAGATGG - Intronic
1165883819 19:39062932-39062954 AGGGGGAAAAAAAATAGTGCAGG - Intergenic
1168500320 19:56887613-56887635 GGGGAGAAGAGAAATGGTGCAGG - Intergenic
926609780 2:14935124-14935146 GGGGAAAACAAAAATGGTGCAGG - Intergenic
928060426 2:28107183-28107205 ATAGAGAAGCAACTTGGTGCAGG - Intronic
928281413 2:29949598-29949620 AGGAAGAGGAAAAAGGGTGCGGG + Intergenic
928573467 2:32630872-32630894 ATGAAGAAGTAAAGTGGTGCAGG + Intronic
929080071 2:38113671-38113693 AGGGAGAACCAAAGAGGTGAGGG + Intergenic
929279468 2:40062122-40062144 AGATGGAAGAAAAATGGTGCAGG - Intergenic
930256135 2:49094236-49094258 AGGGAGGAGCTTAATGGTGGTGG - Intronic
930594016 2:53363725-53363747 AGGGAGAAAGAAAATGCTGCTGG + Intergenic
931463131 2:62465210-62465232 AGTGAGAAGCAAGATGGAGTTGG + Intergenic
931469418 2:62523367-62523389 AGAGAGAAGCATAGAGGTGCAGG - Intergenic
931630537 2:64294522-64294544 AGGGAGAAGCAAACAAGTTCTGG + Intergenic
932796023 2:74697083-74697105 ATGGAAATGCAAAATGGTACAGG - Intergenic
932936365 2:76107642-76107664 AGGGAGAAGGAAAATGATATAGG - Intergenic
933710303 2:85320372-85320394 AGAGAGAAGCAAAATGGGCTGGG + Intronic
933885250 2:86713297-86713319 AGAGAGAAGGAAAATGATGTAGG + Intronic
933924924 2:87083386-87083408 AGAGAGAAGGAAAATGATGTAGG - Intergenic
934486457 2:94717516-94717538 AGGGAGAAGAAAAAGGGTATAGG - Intergenic
934725199 2:96612461-96612483 AGTGAGAAGCAAAGTGCTGGAGG - Exonic
935178613 2:100670876-100670898 AGGGAGGAGAAGAAAGGTGCAGG - Intergenic
935192113 2:100786592-100786614 AGGCAGAAGCAAAAAGCAGCAGG - Intergenic
936478759 2:112865728-112865750 AGGAAGAAGCAAAATTGTTGAGG - Intergenic
936575128 2:113646908-113646930 AGGAGGAAGTAAAATAGTGCAGG + Intergenic
937423916 2:121781644-121781666 AGGGAGACCCAACATGGCGCAGG - Intergenic
938010576 2:127825634-127825656 AGGAACAGGCAACATGGTGCCGG + Intergenic
938233399 2:129680962-129680984 AGAGACAAGCAACATGGTCCAGG + Intergenic
939846375 2:147251358-147251380 AGGGAGAAGCAAATGGGTAGAGG + Intergenic
940642289 2:156358379-156358401 AGGGAGAGGCAAACTTGAGCAGG - Intergenic
942098186 2:172553590-172553612 AGTGAGAAGCAAGATGGAGTTGG + Intergenic
942796788 2:179830274-179830296 GTGGAGATGCAAAATGGTTCAGG + Intronic
943456155 2:188110125-188110147 AGGCAGAAGGAAAATGATACTGG - Intergenic
945543221 2:211115291-211115313 AGGGAGAAGCCAAATCATTCAGG - Intergenic
945851258 2:215010452-215010474 AGGGAGAAGCAAAATGGTGCTGG + Exonic
946212972 2:218162340-218162362 AGGGAGATTCAACATGGAGCTGG - Intergenic
946757073 2:222958541-222958563 AGGTAGTAGCAAAGTGGTGAAGG - Intergenic
948131691 2:235605514-235605536 AGGGAGAAGATAAATGATGCCGG - Intronic
948173927 2:235928531-235928553 AGTGAGAAGCTAGAAGGTGCTGG + Intronic
948512269 2:238476517-238476539 AGAGAGGAGCAAAATGAGGCCGG + Intergenic
1168910065 20:1440485-1440507 AGAGAGAAGAAAAATGAAGCAGG + Intergenic
1169798620 20:9492864-9492886 AAGAAGAAGACAAATGGTGCGGG + Intergenic
1169973241 20:11294483-11294505 AGAGAGAATCAAAATGGTGCTGG - Intergenic
1170449058 20:16462908-16462930 AGGAACAAGCAACATGGTGCTGG + Intronic
1170589001 20:17757023-17757045 AGGGAGAAGCAGAAAGATACGGG - Intergenic
1170972190 20:21126262-21126284 AGCGGGAAGGAAAATGGGGCAGG - Intronic
1171353733 20:24526684-24526706 AGGAAGAAGAAAAATAATGCTGG - Intronic
1172190575 20:33059751-33059773 AGGGAAGTGCAAAATGGGGCAGG + Intronic
1172254063 20:33501478-33501500 AGGGAAATGCAGAATGGTGAGGG + Intronic
1173213240 20:41054311-41054333 AGTGTGAAGCAAAGTGGGGCAGG - Intronic
1173304403 20:41834711-41834733 AGGGAGGATCAGAATGGTGAGGG + Intergenic
1173428358 20:42962733-42962755 AGGGAGGAGGTAAATGGTGGTGG - Intronic
1173515519 20:43663012-43663034 AGAGAGAAATAAAATGGTGGAGG + Intergenic
1173571297 20:44078190-44078212 AGGGGGAAGCAAGATGGAGGAGG - Intergenic
1173670993 20:44798815-44798837 AGGGAGACGCAGCATGGGGCAGG - Intronic
1173851345 20:46220377-46220399 AGGGTGAAGAAAGATGGTGGGGG + Intronic
1174478004 20:50810929-50810951 AGGGAAAAGTAAATTGGGGCAGG + Intronic
1174957872 20:55120876-55120898 AGGGAGAAAGAAAATTTTGCTGG + Intergenic
1175251669 20:57613664-57613686 AGGGAAAAGGGCAATGGTGCAGG - Intronic
1175254913 20:57636128-57636150 AGGGAGAAGAAAAATGATGTAGG + Intergenic
1178600686 21:33991987-33992009 AGGGAGAAGCAGAAAGGTGCAGG + Intergenic
1179464582 21:41563094-41563116 AGAGAGAAACAAGATGGCGCAGG + Intergenic
1180899803 22:19362167-19362189 AGAGAGAAGATAAATGATGCAGG + Intronic
1180936590 22:19629505-19629527 AGGGAGAAGCATCATAGTGGGGG + Intergenic
1181030462 22:20146977-20146999 AGAGAGAAGCAGAAAGGTGGAGG - Intronic
1183322442 22:37173229-37173251 AGGGAGAAGCAAATTTGGGAGGG - Intronic
1184020279 22:41816346-41816368 AGGTTGAAACAAAATTGTGCTGG + Intronic
1185425051 22:50763991-50764013 AGGAGGAAGTAAAATAGTGCAGG - Intergenic
949204642 3:1423501-1423523 AGGGAGAGGCAGACTGATGCAGG - Intergenic
950867999 3:16204786-16204808 GGGGAGAAGCAATGTGGGGCAGG + Intronic
951057142 3:18160706-18160728 AGAGAGAAGTAAAATGCTCCTGG - Intronic
951696515 3:25450765-25450787 CGTGAGAGACAAAATGGTGCTGG + Intronic
952473252 3:33678651-33678673 AGAGAGAAGGAAAATGATACAGG + Intronic
952498882 3:33940732-33940754 AGGCAGAAGAAGAATTGTGCTGG + Intergenic
953916138 3:46922328-46922350 AGGGAGAAGCAGGAAGGTGAAGG + Intronic
954298932 3:49689066-49689088 AGGCAGCAGCAAAAGGGTGGAGG - Intronic
954807202 3:53227397-53227419 AGGCAGGAGCAAGATGGGGCTGG - Intronic
955481018 3:59390260-59390282 AGTGGGATGCAAAATGGTACAGG - Intergenic
955808347 3:62760072-62760094 AGGGAGGTGCAAGATGGAGCAGG - Intronic
956812572 3:72878420-72878442 AGAGAGAAGGAAAATGATGTAGG - Intergenic
958673975 3:97242232-97242254 AGGAAGAAGCTAGATAGTGCAGG - Intronic
960188230 3:114670788-114670810 TGGTAGAAGCAAAATGCTGTGGG + Intronic
961265052 3:125634927-125634949 GGGGAGAAGGAAGATGGGGCAGG + Intergenic
962280859 3:134050798-134050820 GGGGAGAAGCAAATTGCAGCCGG - Intronic
962326896 3:134441877-134441899 AGGGAGAAACAAAAGCTTGCAGG - Intergenic
964210264 3:154219240-154219262 AGGGAAAAGAAAAATGGTTAGGG - Intronic
964713755 3:159699531-159699553 AGGGAGAACCAAGATTATGCTGG + Intronic
966114520 3:176445691-176445713 AGGGAAAAGTAAAAAGATGCTGG - Intergenic
968450356 4:673233-673255 AGGGATAAGGAAAATGGAGGAGG - Intronic
968831782 4:2935876-2935898 GGTTAGAAGCAAAATGGAGCTGG - Intergenic
970186936 4:13465661-13465683 AGGGAGAAGGAAAATGATATGGG + Intronic
970676938 4:18461932-18461954 AGAGAGAAGAAAAATGGAGGAGG + Intergenic
971017763 4:22506143-22506165 GGGGAGAAGCAGGAAGGTGCTGG + Intronic
971249356 4:24959919-24959941 AGGCAGAAGGAAAATGATACCGG + Intronic
972542927 4:40055834-40055856 TGAGAGAAAAAAAATGGTGCAGG + Intergenic
972652230 4:41029268-41029290 AGGGAGAAGCTAAATAAAGCTGG + Intronic
972832313 4:42828541-42828563 AGTGAGAAATAAAATGATGCTGG - Intergenic
973746972 4:53973237-53973259 AGTGGTAAGCAAACTGGTGCAGG - Intronic
973823781 4:54685289-54685311 AGGCAGCAGCAAAAAGGTTCTGG - Intronic
973864212 4:55095511-55095533 AGGGAAACTCAAAATGGTACAGG - Intronic
974072096 4:57133192-57133214 AGGAAGAAGCTAAAAGATGCTGG + Intergenic
974217212 4:58865296-58865318 GTGGACATGCAAAATGGTGCCGG + Intergenic
975974232 4:80076631-80076653 AGTGAGATGCAAAATGCTCCAGG - Intronic
976526041 4:86090097-86090119 AGGGAGGGGCAAAATGGGGAAGG + Intronic
977453936 4:97234030-97234052 AGGGAGTAGAAAAATGGTTCTGG + Intronic
978052643 4:104221435-104221457 AGGGAAAAGAAAAATGATCCTGG - Intergenic
978383810 4:108160024-108160046 AGGGAAAAGCAACACAGTGCAGG - Intronic
979045246 4:115854248-115854270 AGGGAGATGCATAATGGTAAGGG + Intergenic
979271742 4:118770313-118770335 AGAGAGAAGCAAAAGCATGCAGG + Intronic
981092130 4:140742845-140742867 AGAGAGAAGAAAGAAGGTGCAGG + Intronic
981120131 4:141040025-141040047 ATGGAGAAGGAAAAAGGAGCGGG - Intronic
981440370 4:144775618-144775640 AGGGAGAAACAGACTGGTCCTGG + Intergenic
983579668 4:169295022-169295044 AGAGAGAAGAAAAATGATACAGG + Intergenic
984705297 4:182843378-182843400 AGGGAGAAGAAAAAAAGAGCAGG + Intergenic
986136882 5:4988234-4988256 AGGGAGAAGTCAACAGGTGCAGG + Intergenic
986275374 5:6270603-6270625 AGGGACAAGCAAAATCCAGCAGG + Intergenic
986395635 5:7326924-7326946 AGGAAGAACCAAACTGGTGATGG + Intergenic
986876045 5:12111184-12111206 AGGGAGAAGGGCAATGATGCTGG + Intergenic
987190883 5:15477198-15477220 AGGGAGAAGGAAAATGGGGAGGG - Intergenic
989652106 5:43702365-43702387 AGGGAGAAGCATAATAATGCAGG + Intronic
991292002 5:65042228-65042250 AGGAAGAAGAAAAATGCTGGAGG - Intergenic
992829045 5:80576684-80576706 ATGGGAAAGTAAAATGGTGCAGG + Intergenic
993007707 5:82446209-82446231 AGGAAGAAGAAAAATGTTGTTGG + Intergenic
993629068 5:90261623-90261645 AGGGAGAAGAAAAAAGGAGTGGG + Intergenic
994437488 5:99757615-99757637 AGGAAGAAGGAAAATGGTCAAGG - Intergenic
994513535 5:100740251-100740273 ATGGAAAAGCAAAATGGCACAGG - Intergenic
996415710 5:123208144-123208166 AGTGTGAGGCAAAATGCTGCGGG - Intergenic
996671053 5:126117997-126118019 AGGGGGAAGGAAAATGGTCCAGG - Intergenic
997218236 5:132132968-132132990 AGGGAGAAGGAAAATGATATAGG - Intergenic
997427101 5:133810775-133810797 AGGAACAGGCAACATGGTGCTGG - Intergenic
997702089 5:135909650-135909672 AGGGAGAGGCAGCAGGGTGCAGG + Intergenic
997791197 5:136763954-136763976 AGGGAGAAGGAAAAGGGTTGGGG - Intergenic
999075399 5:148790900-148790922 AAGCACAAGAAAAATGGTGCTGG - Intergenic
999498680 5:152125246-152125268 AGGGAGAAGCTAAGTGGTGTGGG - Intergenic
1002282933 5:178143749-178143771 AGGTCGAAGCAGAATGCTGCTGG - Intronic
1002815024 6:671560-671582 AGGGAGAAGCAAAATGATATAGG - Intronic
1003942782 6:11044711-11044733 GGGGAGAAGCAGTATCGTGCAGG + Intergenic
1003974132 6:11326769-11326791 AGGGGGAAGGAAGATGGTACGGG - Intronic
1004370107 6:15044891-15044913 AGGGAAAAGGAAGATGGTGGGGG - Intergenic
1004629499 6:17407845-17407867 ATGAAGAAGCAAAAGGGGGCTGG + Intronic
1005128988 6:22481406-22481428 AGGGAGAAGGAAAATGATAGAGG + Intergenic
1005221274 6:23591674-23591696 AGGGAGAAAAAAAATGACGCTGG + Intergenic
1008433791 6:51451512-51451534 AGGGAGTAGCAAACAGGTGAGGG + Intergenic
1009588322 6:65635393-65635415 AGGGAAAGGCAAGATGGGGCGGG - Intronic
1009590935 6:65670088-65670110 AAGGAGAAACAGAAAGGTGCAGG - Intronic
1010188785 6:73173204-73173226 AGGGAAATGCAAAAATGTGCTGG + Intronic
1011784037 6:90824488-90824510 ATGGAAATGCAAAATGGTACAGG - Intergenic
1012331766 6:97999360-97999382 AGAAAGCAGAAAAATGGTGCAGG - Intergenic
1013126584 6:107190331-107190353 GGGGAGAAGCAACCTGCTGCAGG - Intronic
1013354130 6:109332440-109332462 AGGGAGAGGGAGAAGGGTGCAGG - Intergenic
1013862457 6:114652218-114652240 AGGGAGAAGCAGAATTGGGCAGG - Intergenic
1014249426 6:119100216-119100238 AGGGAGAAATGAAATGGTACAGG + Intronic
1016927521 6:149366629-149366651 AGGAAGAAACAAATTGGTGGAGG - Intronic
1017339896 6:153308984-153309006 AGGAAGAAGCAAAGTGGAGTAGG - Intergenic
1017437646 6:154432099-154432121 GTGGAAATGCAAAATGGTGCAGG - Intronic
1017646696 6:156545767-156545789 AGGGAGCATCTAAATGTTGCAGG + Intergenic
1018027193 6:159815775-159815797 AGGGGAAAGAACAATGGTGCAGG - Intronic
1019739244 7:2664582-2664604 GGGGAAATGCAAAATGGTTCAGG - Exonic
1019793152 7:3030424-3030446 AAGTAGATGAAAAATGGTGCTGG - Intronic
1020529489 7:9313352-9313374 GGGGAGAAGTAAAATTGTGGAGG + Intergenic
1021223231 7:17998819-17998841 AGGGAAAAGAACAATGGTGGAGG - Intergenic
1022833344 7:34090396-34090418 AGGGAGAAGCAATATGAGGCTGG - Intronic
1025085922 7:56023177-56023199 AAGGAGAACGAAAATGGTGAAGG + Intronic
1026372939 7:69719816-69719838 AGGGGGAAGGAATATGGTTCAGG + Intronic
1028988601 7:97026518-97026540 TGGGAGAAGGAGAATGCTGCTGG - Intergenic
1029263679 7:99322280-99322302 AGGGGGAAGCAAAAAGAAGCAGG + Intergenic
1029499769 7:100921500-100921522 AGGGAAAGGCAAGGTGGTGCAGG + Intergenic
1029803837 7:102976361-102976383 AGGGAGCAGAAAAGTGGAGCGGG - Intronic
1031855352 7:126915713-126915735 GGGGAGAAGAGAAATGGTGGCGG + Intronic
1033529060 7:142244991-142245013 AGGGAGAGGAAGAAAGGTGCAGG + Intergenic
1037688937 8:21166692-21166714 AGGGAGAAAGAAAGTGGAGCAGG - Intergenic
1037930580 8:22877843-22877865 AGGGAGAGGCAGAAAGCTGCAGG + Intronic
1038061260 8:23915892-23915914 AGGGAGAAGAAAAATAGTATAGG - Intergenic
1039117498 8:34108574-34108596 AGGAACAGGCAACATGGTGCTGG - Intergenic
1039719466 8:40147061-40147083 AGGCAGAAGCCGAATGCTGCAGG - Intergenic
1039899095 8:41737770-41737792 AGAGAGATGCAAGATGGTCCGGG + Intronic
1039968756 8:42303801-42303823 ATGCAGAAGAAAAATGGGGCTGG - Intronic
1042530534 8:69810316-69810338 AGGGCAAAGCAAGATGGTGGAGG + Intronic
1043071851 8:75646175-75646197 AGGAAGAAGAAACATGGTACAGG + Intergenic
1044559347 8:93597187-93597209 AGGGAGAAGGAAGATGTCGCAGG - Intergenic
1046176310 8:110579675-110579697 ATGGAGAAGTAAAATGCTTCTGG + Intergenic
1046529744 8:115428049-115428071 TGGGGCAAGAAAAATGGTGCTGG + Intronic
1046712191 8:117522422-117522444 ATGGGTCAGCAAAATGGTGCTGG - Intronic
1047113165 8:121813460-121813482 AGGGAGTACCAAAATGTTGGGGG + Intergenic
1047164543 8:122422397-122422419 AGGGAGAAGCTAAGTTGTGCAGG - Intergenic
1047577336 8:126171707-126171729 AGGTAGAAGCAAAGTGTTACAGG + Intergenic
1048556330 8:135480978-135481000 AGGGAGAAGAATAATGCTGGTGG - Intronic
1048577391 8:135703918-135703940 TGGGAGAATAAAAATGGAGCTGG - Intergenic
1048714330 8:137251155-137251177 AGGGAGACTCAGAAGGGTGCAGG + Intergenic
1048963814 8:139600700-139600722 AAGGAGCAGCAAAAAGGGGCAGG + Intergenic
1049265459 8:141665558-141665580 AGTGAGAAGGGAAAAGGTGCTGG - Intergenic
1049625963 8:143621341-143621363 AGAGAGAAGGGAAATGGTGTAGG - Intergenic
1049851139 8:144831187-144831209 CTGGAGAAGCAAACTGCTGCTGG - Intronic
1050570962 9:6938588-6938610 AGGGAGAATGAAAAGAGTGCTGG - Intronic
1052066475 9:24027640-24027662 GGTGAGAAGCAATATGGTACAGG + Intergenic
1052501020 9:29290200-29290222 AAGGATAAGCAAAATTTTGCCGG - Intergenic
1052976593 9:34415407-34415429 TGGGACAACCAAAATGGTGGAGG + Intronic
1053587364 9:39473582-39473604 TAGAAGCAGCAAAATGGTGCTGG - Intergenic
1053671342 9:40366809-40366831 AGGGAGAAGAAAAAGGGTATAGG + Intergenic
1053921152 9:42993183-42993205 AGGGAGAAGAAAAATGGTATAGG + Intergenic
1054382454 9:64506859-64506881 AGGGAGAAGAAAAAGGGTATAGG + Intergenic
1054513274 9:66009501-66009523 AGGGAGAAGAAAAAGGGTATAGG - Intergenic
1054578937 9:66891654-66891676 TAGAAGCAGCAAAATGGTGCTGG + Intronic
1055664890 9:78543497-78543519 AGGGAGAAGAGAAATGAAGCGGG - Intergenic
1056816074 9:89802117-89802139 AGAGAGAGGCAGAATGCTGCTGG - Intergenic
1057136213 9:92689897-92689919 AGAGAGAAGGAAAATGATACAGG - Intergenic
1057730112 9:97601161-97601183 AAGGAGAAGCCAAATGGGGATGG - Exonic
1059254209 9:112913971-112913993 AGGGAGAAGGAAAAGGGAGGAGG - Intergenic
1060802843 9:126555614-126555636 AGGAAGAAGAAATAAGGTGCAGG + Intergenic
1061573221 9:131490425-131490447 TTGGAGCACCAAAATGGTGCAGG - Intronic
1187123917 X:16435550-16435572 AGGTAAAAGCAAAATGCTTCTGG - Intergenic
1187797499 X:23020384-23020406 AGGGAATAGCAAGAGGGTGCAGG + Intergenic
1188379936 X:29478916-29478938 AGGATGAAGCAAAATAATGCAGG - Intronic
1188780570 X:34278994-34279016 TGGGATAAGGAAAGTGGTGCAGG - Intergenic
1189044726 X:37578338-37578360 AGGGAGAAGGAAATGGTTGCTGG + Intronic
1191961728 X:66710837-66710859 AGAGAGAACCAAAATGGGGTTGG + Intergenic
1192079194 X:68031297-68031319 AGAGAGAAGCAATATCCTGCTGG + Intergenic
1193027147 X:76856547-76856569 GGATAGAAGAAAAATGGTGCCGG + Intergenic
1195604572 X:106790446-106790468 AGGAAGAAGGAAAATGGAGATGG - Intronic
1197433906 X:126401077-126401099 AGGGAGAAGAAAAAGGGAGGTGG + Intergenic
1199718463 X:150524760-150524782 AGGGAGAAGCAACAAGGAGGAGG - Intergenic
1199729778 X:150620587-150620609 AGGAACAATCAAGATGGTGCAGG - Intronic
1200371904 X:155736308-155736330 AGGGAGAAGGAAAATGATATAGG - Intergenic