ID: 945853489

View in Genome Browser
Species Human (GRCh38)
Location 2:215038667-215038689
Sequence CTGTCTCAGGGCGTAAATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 75}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945853484_945853489 4 Left 945853484 2:215038640-215038662 CCCTAGCAACCATGGAGATCAGT 0: 1
1: 0
2: 0
3: 7
4: 106
Right 945853489 2:215038667-215038689 CTGTCTCAGGGCGTAAATCTTGG 0: 1
1: 0
2: 0
3: 10
4: 75
945853485_945853489 3 Left 945853485 2:215038641-215038663 CCTAGCAACCATGGAGATCAGTT 0: 1
1: 0
2: 0
3: 12
4: 118
Right 945853489 2:215038667-215038689 CTGTCTCAGGGCGTAAATCTTGG 0: 1
1: 0
2: 0
3: 10
4: 75
945853483_945853489 9 Left 945853483 2:215038635-215038657 CCAAACCCTAGCAACCATGGAGA 0: 1
1: 0
2: 0
3: 15
4: 191
Right 945853489 2:215038667-215038689 CTGTCTCAGGGCGTAAATCTTGG 0: 1
1: 0
2: 0
3: 10
4: 75
945853486_945853489 -5 Left 945853486 2:215038649-215038671 CCATGGAGATCAGTTAGACTGTC 0: 1
1: 0
2: 0
3: 4
4: 86
Right 945853489 2:215038667-215038689 CTGTCTCAGGGCGTAAATCTTGG 0: 1
1: 0
2: 0
3: 10
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945853489 Original CRISPR CTGTCTCAGGGCGTAAATCT TGG Intronic
900924577 1:5696077-5696099 CTGTCTCAGTGGGTAGAGCTAGG - Intergenic
901871533 1:12141533-12141555 CTGGCTCAGGCCGTGAATTTCGG - Intronic
902079897 1:13813769-13813791 CCGGCTCAGGGCGTCCATCTGGG - Intronic
905166326 1:36085266-36085288 CTGTGTCAGGGCATCGATCTCGG - Exonic
908028879 1:59978828-59978850 TTGTGTCAGAGTGTAAATCTAGG - Intergenic
1063547395 10:6994909-6994931 CTGTCTCTGGTTGTACATCTAGG - Intergenic
1067824658 10:49561712-49561734 GTGTCTCAGGGCCAAAAACTGGG - Intergenic
1069500504 10:68948835-68948857 CTATCTCAGGGACAAAATCTAGG - Intergenic
1074162695 10:110847112-110847134 CTGTCTCAGGTGGGAAATCTGGG - Intergenic
1075018882 10:118932999-118933021 CTGTATCAGTGCCTAAATCTGGG + Intergenic
1076299435 10:129413822-129413844 CTGTGTCAGGTCTTAAATCTGGG + Intergenic
1079588549 11:22154862-22154884 CTGTCTCATGGGGTAAATAGTGG + Intergenic
1085473340 11:76772208-76772230 CTCTCACAGGGTTTAAATCTTGG - Intergenic
1088399965 11:109412680-109412702 CTGTCTCAGGGTCTGATTCTGGG + Intergenic
1089837049 11:121379737-121379759 CTGTGTCAGGGGGAAAATCTGGG - Intergenic
1090731013 11:129573508-129573530 CTGTCTCAGGACGGACCTCTGGG + Intergenic
1095480988 12:42635455-42635477 CTGTCTTATGGCTTAAATTTTGG - Intergenic
1108428281 13:50327140-50327162 CTGTCTCAGGGCACACATCAAGG + Intronic
1120504008 14:85331797-85331819 CTTTCTCAGGGCTTAAACTTTGG + Intergenic
1120947047 14:90007582-90007604 CTGTCTCGGGGCGGGAAACTGGG + Intronic
1122229643 14:100299350-100299372 CTGTCTCTGGGCCTCACTCTGGG + Intronic
1128670225 15:69569129-69569151 CTGTTTCAGGGTGCACATCTTGG - Intergenic
1133187098 16:4107789-4107811 CTGTCTCATGCCGGAAATCTGGG - Intronic
1142758157 17:2027922-2027944 CTGACTCAGGGCCTGAATGTGGG + Intergenic
1147699889 17:42387388-42387410 CTGTCTCAGAGCCAAGATCTTGG - Intronic
1153822461 18:8843990-8844012 CTGTGTGAGGGCTGAAATCTTGG + Intergenic
1155439391 18:25845470-25845492 CTGTCTCAAAGGGTAAAACTCGG - Intergenic
1156747406 18:40409103-40409125 CTTTCTCAGGGCCTATTTCTGGG - Intergenic
1157683921 18:49627935-49627957 TTGACTCAGGGCATTAATCTAGG - Intergenic
1158388791 18:57025742-57025764 GTGTCAGAGGGCGTAAATCATGG - Intronic
1162862810 19:13520103-13520125 CTGTCTCAGGAAGTAAATATTGG + Intronic
1165694803 19:37892819-37892841 CTGTCTCAGAGCGTAGGGCTGGG + Exonic
1167906094 19:52661936-52661958 CTGTCTCAGGGCCTTCACCTGGG - Intronic
1168355684 19:55698329-55698351 CTGTCCCAGGGAGAAATTCTGGG - Intronic
927813278 2:26192411-26192433 CTGTTTTAGGTCGTAAATCTGGG - Exonic
933135787 2:78733374-78733396 GTGTCTCAAGGCTTACATCTAGG + Intergenic
933642367 2:84777582-84777604 CTGTATCAGTCCCTAAATCTGGG + Intronic
940099911 2:150023162-150023184 CTGTCTCAGTGAGTCAACCTAGG + Intergenic
945853489 2:215038667-215038689 CTGTCTCAGGGCGTAAATCTTGG + Intronic
947759641 2:232594475-232594497 CTGTCTCAGAGGACAAATCTAGG - Intergenic
1168852684 20:987442-987464 CTGTCCCAGGGAGTAAAGGTGGG - Intronic
1175804348 20:61819172-61819194 CTGTCTGAGGGGGTCTATCTGGG - Intronic
1177276577 21:18919949-18919971 CTGTCCCTGGGTGAAAATCTGGG - Intergenic
1177694024 21:24549014-24549036 CTGTCTCATGGCATATTTCTGGG + Intergenic
1178022890 21:28430231-28430253 TTGCTTCAGGGTGTAAATCTGGG - Intergenic
1178185093 21:30209571-30209593 CTGTCTCAGGGGGATAACCTCGG - Intergenic
1183173728 22:36206539-36206561 CTGTCTCAGGGTGAAAATTTGGG + Intergenic
962365392 3:134775643-134775665 CTGTCTCAGGGTCTGATTCTGGG + Intronic
962544007 3:136413316-136413338 GTGTCTAAGTGCGGAAATCTGGG + Intronic
964358965 3:155874237-155874259 CTGTCTAAGGGTGAAACTCTTGG + Intronic
965991847 3:174828467-174828489 CTGTATCATGGAGTAAAGCTAGG + Intronic
969838616 4:9864002-9864024 CAGTCCCAGGGCCTAGATCTGGG - Intronic
971097531 4:23424718-23424740 CTGTTTCAGGCCCTAAATATGGG + Intergenic
973017941 4:45165251-45165273 CTAGCTCAGAGCGTAAATTTAGG - Intergenic
979037508 4:115742933-115742955 CTGACGCAGGGCATAAACCTGGG + Intergenic
987977051 5:25028151-25028173 TATTCTCAGGGAGTAAATCTGGG - Intergenic
989135284 5:38148073-38148095 CTGACTCAGGGGGTGACTCTGGG + Intergenic
990028933 5:51231816-51231838 CTTTCTCAAGGTGGAAATCTGGG + Intergenic
990217676 5:53552262-53552284 ATGTCTCAGTGCCTGAATCTGGG - Intergenic
990320432 5:54624837-54624859 CTGTCTCAGGGAGTGAATGGAGG + Intergenic
991385105 5:66078868-66078890 CTGTCTCTGGGCTAAAATCAAGG - Intronic
996514758 5:124357415-124357437 CTGATTCAAGGGGTAAATCTAGG + Intergenic
999505019 5:152185754-152185776 CTGTCTCAGGGAATGAATCCTGG - Intergenic
1005226809 6:23652711-23652733 CTGTCTCAGGATGGAAATGTGGG - Intergenic
1015846851 6:137529962-137529984 TTGTCTTAGGGCAAAAATCTTGG + Intergenic
1017181944 6:151562885-151562907 CTGGCTCAGGGCGAAAAGCAAGG - Intronic
1018556310 6:165054344-165054366 CTGCTCCAGGGCGTAAATCCAGG + Intergenic
1022442738 7:30447235-30447257 TTGTCTCAGGCCATAAAGCTGGG - Intronic
1022770479 7:33466867-33466889 CTGCCTCAGTGTGGAAATCTTGG + Intronic
1024427268 7:49240880-49240902 CTGTCTCAGCCTGTAAACCTGGG + Intergenic
1026979652 7:74518943-74518965 CTTGCTCAGGTTGTAAATCTGGG + Intronic
1028648063 7:93120217-93120239 CTGTGTCAGGGGGAAGATCTGGG - Intergenic
1034546291 7:151791529-151791551 CTGTCTCTTGGCGGAAATCAGGG - Intronic
1034584128 7:152074215-152074237 ATGCCTCAGGACGTTAATCTGGG - Intronic
1037597672 8:20367967-20367989 CTGTCTCTGGAAGTAAATTTTGG - Intergenic
1038536523 8:28357053-28357075 CTGTCTCAGGGCGTCACAGTGGG - Intronic
1043179220 8:77063777-77063799 CTGTTTCAGGGCCTAAAACAGGG + Intergenic
1049378490 8:142300806-142300828 CTGTCACTGGGCATCAATCTGGG + Intronic
1051709827 9:19920421-19920443 TTGTCTCAGGGTCTACATCTGGG - Intergenic
1051904729 9:22081996-22082018 CTTTATCAGGGAGTAAAACTTGG - Intergenic
1054853479 9:69872998-69873020 CAGACCCAGGGCTTAAATCTTGG + Intronic
1055219387 9:73909963-73909985 GTGTCTCAGGGCTTAGATCTTGG - Intergenic
1056038755 9:82637661-82637683 CTGTCTCAGGGCACAAAGCTGGG - Intergenic
1197681793 X:129393332-129393354 CTGTTTCAGGGAGTAAAGCCTGG - Intergenic
1197874064 X:131085544-131085566 CTGTCTCAGGGGGATAGTCTTGG - Intronic
1197945328 X:131832305-131832327 CTGTTTCAGGGTAAAAATCTTGG + Intergenic