ID: 945853983

View in Genome Browser
Species Human (GRCh38)
Location 2:215045322-215045344
Sequence ACTGATATGCAGGCTTGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 159}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945853978_945853983 21 Left 945853978 2:215045278-215045300 CCTGCAAAGGTTTTAAAATCTTT 0: 1
1: 1
2: 1
3: 73
4: 711
Right 945853983 2:215045322-215045344 ACTGATATGCAGGCTTGGAAAGG 0: 1
1: 0
2: 2
3: 16
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945853983 Original CRISPR ACTGATATGCAGGCTTGGAA AGG Intronic
902852206 1:19168315-19168337 ACTGTTATTCATGCTGGGAAGGG + Intronic
903173388 1:21567150-21567172 TATGAGATGCAGGCCTGGAATGG + Intronic
904869814 1:33609488-33609510 ACATATATCCAGGCCTGGAAAGG + Intronic
905725597 1:40249051-40249073 ACTGTTATGCAGGATTGTGATGG - Intronic
906554771 1:46700516-46700538 AATGATATCCAGGTTTGAAAAGG + Intronic
908875145 1:68665287-68665309 ACTGAATTGCAGGCTTTAAAAGG - Intergenic
910607097 1:89099053-89099075 ACTGATATGTAGGCATGTAGAGG + Intergenic
911096858 1:94062034-94062056 ACAGATATACAGGCCTGGGATGG + Intronic
917218717 1:172704735-172704757 CCTGACATGAAGGCCTGGAAGGG - Intergenic
919660589 1:200240897-200240919 ACTGACAGACAGGCTTGGAATGG + Intergenic
920578891 1:207086028-207086050 AAGAATATGCAGGCTTGGAAGGG + Intronic
923760979 1:236843823-236843845 ACTGAGAAGCAGGTTTGGGATGG + Intronic
1064912407 10:20416881-20416903 ACTAATAAGCAGGCTGGGCATGG - Intergenic
1067714379 10:48678036-48678058 AGTGAGCAGCAGGCTTGGAAAGG - Intergenic
1067807855 10:49405689-49405711 ACAGATATGCAGATGTGGAAGGG - Intergenic
1068309436 10:55259334-55259356 ACTGATCCCCAGTCTTGGAAAGG + Intronic
1070501155 10:77073641-77073663 ACTGATCTGGAGTATTGGAAAGG - Intronic
1071087826 10:81883870-81883892 ACAGATAATCAGTCTTGGAAGGG + Intronic
1071094601 10:81958610-81958632 ACAGATATACAGGCTGGGCATGG + Intronic
1071460089 10:85885489-85885511 ACTGATATGGAGGCTAGTAATGG + Intronic
1072072419 10:91931958-91931980 AAGGATAAACAGGCTTGGAATGG + Intronic
1072620162 10:97074455-97074477 AGTGAGATGCAGGCTCAGAAGGG + Intronic
1074303109 10:112250789-112250811 ACTGGTATGCAGGACTTGAAAGG + Intergenic
1074963962 10:118472631-118472653 AGTGATTTTCAGGCCTGGAAAGG - Intergenic
1075700531 10:124466745-124466767 AATGATATGCAGGCTGGGCGCGG - Intronic
1077230867 11:1457656-1457678 GCTGAGATGCAGGCTGGGAGAGG - Intronic
1077356711 11:2122144-2122166 ACTGAAAGGCAGACTTGGAGAGG + Intergenic
1080886141 11:36369885-36369907 ACTGAGTTGCAGGCTGGGCATGG - Intronic
1081257831 11:40919186-40919208 ACAGAAATGCAGGGTTGGAAGGG + Intronic
1081927314 11:46841708-46841730 AGTGATATGCTGGCTCGGCACGG + Intronic
1083495100 11:63044858-63044880 ACTGATCTTCAGGCCTGGCACGG - Intergenic
1085249423 11:75132527-75132549 ACTGAGATCCATGGTTGGAAAGG - Intronic
1086152427 11:83626731-83626753 ACATATATGGAGACTTGGAATGG + Intronic
1086326603 11:85707786-85707808 ACTAATATGCAGGGGTGGAAAGG + Intronic
1086944214 11:92829076-92829098 ACTGATCTTCAGGCCTGAAAAGG + Intronic
1088227778 11:107640470-107640492 AATGACTGGCAGGCTTGGAAAGG + Intronic
1089220500 11:116867110-116867132 ACTGAAAAGCAGCCTTGGGAAGG - Intronic
1089319838 11:117618170-117618192 ATAGACATGCAGGGTTGGAAAGG + Intronic
1089473745 11:118741760-118741782 GCTTATATGGAGGCTTTGAAAGG - Intergenic
1089598608 11:119598797-119598819 ACTGATGAGTGGGCTTGGAAAGG - Intergenic
1090849219 11:130556997-130557019 AGTTATATGCAGGCTGGGCATGG - Intergenic
1092843461 12:12563885-12563907 ACTGATAAGCAGGTTTGGGTGGG + Intergenic
1093180335 12:15960345-15960367 AATGATATGCGGGCTGGGGACGG + Intronic
1099416167 12:82389039-82389061 ACTGAAATGTAGGACTGGAATGG - Intronic
1100815598 12:98384293-98384315 AGTGAAATGAAGGCTTGGAAGGG - Intergenic
1103320515 12:120090301-120090323 AGTGATCTCCAGACTTGGAATGG + Intronic
1104033179 12:125079736-125079758 ACTGAGCTGCAGGCTTTAAAAGG - Intronic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1107011529 13:35675446-35675468 ACTGTCATGCAGGCTGGGAGAGG - Intergenic
1115305121 14:31925674-31925696 ACTGATATCCACTCTGGGAATGG - Intergenic
1118986180 14:70756822-70756844 ACAGATATGGAGGCTTAGATAGG - Intronic
1119191895 14:72688590-72688612 ACTTAAATGCAGCCTTGGTAGGG - Intronic
1119610276 14:76056124-76056146 ACTCATCTGCAGGCTAGGTAAGG + Intronic
1120695362 14:87638588-87638610 ACACATCTGCAGCCTTGGAAGGG + Intergenic
1124348906 15:28941376-28941398 ACTGATTTGCAGGAACGGAAAGG + Intronic
1126278961 15:46919697-46919719 TCTGCTGTGCAGCCTTGGAAAGG + Intergenic
1130801789 15:87272377-87272399 ACTGATAAGCAGGGTTATAAGGG - Intergenic
1133193922 16:4154844-4154866 ACAGATAAGCAGGCATGGCAGGG + Intergenic
1133328431 16:4956566-4956588 AATGTGATGCAGGCTAGGAAGGG + Intronic
1134759902 16:16705092-16705114 AATGAAATGCAGGCTGGGCATGG + Intergenic
1134986170 16:18654113-18654135 AATGAAATGCAGGCTGGGCATGG - Intergenic
1135500786 16:22994108-22994130 ACTGATACACAGTTTTGGAATGG - Intergenic
1135768686 16:25199713-25199735 TCTGATGTGCAGCCTTCGAAAGG + Intergenic
1136556179 16:31009305-31009327 ACTGAGATTCAGGCGTGGGAAGG - Intronic
1137013448 16:35347246-35347268 ACGGGAATGCAGGCATGGAAAGG - Intergenic
1137359644 16:47802163-47802185 AATGCTATGCAGCCATGGAAAGG + Intergenic
1138388841 16:56655344-56655366 AGTGATATGAAGGCTGAGAAAGG - Intronic
1143158547 17:4853966-4853988 ACAGAACTGCAGGCCTGGAAGGG - Intronic
1144126603 17:12208538-12208560 ACTGAGATACAGGCTCTGAAGGG + Intergenic
1144940456 17:18935869-18935891 AAAGATATACAGGCTTGGCATGG + Intergenic
1145902469 17:28497678-28497700 ATTGAAATTCAGGCTTGGAGTGG + Exonic
1148469738 17:47885531-47885553 GCTGATTGGCAGGCTGGGAAGGG + Intergenic
1148977511 17:51542648-51542670 ACTGAGAAACAGGATTGGAAAGG + Intergenic
1149078161 17:52621825-52621847 ACTGTCATGCAGGCTATGAAGGG + Intergenic
1150266362 17:63834655-63834677 GCTGATGTGCAGGTTTGGCAGGG - Intronic
1152351268 17:79785168-79785190 CTTGATGGGCAGGCTTGGAAGGG + Exonic
1161763124 19:6188893-6188915 ACTGGTATGCAGGACTTGAAAGG + Intronic
1164754264 19:30678350-30678372 ACCGATATCCAGGCTCAGAAGGG - Intronic
1167228156 19:48263845-48263867 AATGAAATGCAGGCTGGGCACGG + Intronic
1168672582 19:58252096-58252118 ACTGATATGCCAGCTTGCAAAGG - Intronic
925679936 2:6409735-6409757 ACTGCAATGCAGGCTGGGAGTGG - Intergenic
927057409 2:19378569-19378591 ACTGATGTCCAGGCTAGGGATGG + Intergenic
927837117 2:26408019-26408041 ACTGAGAAGCAGGCTTTGAAGGG - Intronic
929947465 2:46381803-46381825 AGGGCTATGCTGGCTTGGAAGGG - Intronic
931169106 2:59783835-59783857 ACTGACATGAAGGCATGGGAGGG + Intergenic
933673424 2:85030986-85031008 ACAGACATGTAGGCTTGGCATGG - Intronic
935311982 2:101793375-101793397 TTTGACATGCAGGCTTGGCAAGG - Intronic
936805063 2:116321393-116321415 AATGATATGAAGGCTGGGAAAGG + Intergenic
939615211 2:144354694-144354716 ACTGATTTGCAGGCTTGGAGAGG + Intergenic
940056254 2:149515302-149515324 ACTGATGTGCAGGCCGGGAGCGG - Intergenic
940112377 2:150169078-150169100 AATGTTATGCAAGCTTTGAAGGG - Intergenic
945853983 2:215045322-215045344 ACTGATATGCAGGCTTGGAAAGG + Intronic
1168780826 20:488293-488315 ACTGATGTGCAGGCTGGGCACGG - Intronic
1177794932 21:25765491-25765513 ACTGAGATGAAGGGATGGAAAGG - Intronic
1181515410 22:23408546-23408568 ACTGTTATTCAGCCTTAGAAAGG + Intergenic
1183181264 22:36261673-36261695 ACTGATAATGAGGCCTGGAACGG + Exonic
1183602006 22:38845122-38845144 TCAAAAATGCAGGCTTGGAAGGG - Intergenic
952015815 3:28956118-28956140 ATTGAGATGCAGGCTTTTAATGG - Intergenic
953403873 3:42650793-42650815 ACTCGTCTGCAGGCTGGGAAGGG - Intergenic
953435170 3:42872087-42872109 ACTGATAAGCACGCTGGGAAGGG + Intronic
956760841 3:72443104-72443126 ACTGATTTGCAGACTTACAATGG + Intronic
958457631 3:94351479-94351501 ACTGATATGCATGATTAGATGGG - Intergenic
960192254 3:114720914-114720936 ACTGATATGTAGGCTGACAAAGG + Intronic
962256695 3:133875568-133875590 ACTGATGTGCAGGCTGGGCCTGG - Intronic
963106634 3:141653126-141653148 TCTAACATGCAGCCTTGGAAAGG - Intergenic
963492032 3:146014238-146014260 ATTTATATGCAGGTTTAGAATGG + Intergenic
963815090 3:149821028-149821050 ACTGATATATAGACATGGAAAGG - Intronic
964354996 3:155842155-155842177 AATGATATTAATGCTTGGAATGG - Intronic
965369271 3:167840715-167840737 AGTTACATGCATGCTTGGAAAGG - Intergenic
965407561 3:168289174-168289196 ACAGACATGCAGACTTGTAATGG + Intergenic
969212643 4:5699594-5699616 AATATTATGCAGCCTTGGAAAGG + Intronic
969845390 4:9916425-9916447 CCTGATATGCAGTCTTGGTTGGG - Intronic
970671562 4:18402325-18402347 CCTGATATGCAGGCTTTTGAGGG + Intergenic
971827384 4:31643535-31643557 TCTGAGATGCAGGCAAGGAAAGG + Intergenic
974785132 4:66609708-66609730 TCTGATGTGCAGACTTGGCAGGG - Intergenic
976825789 4:89258827-89258849 ACTAATGTGCAGCCGTGGAAAGG - Intronic
977705451 4:100065443-100065465 ACTGTTGTGCAGGATTGGATGGG + Intergenic
978233634 4:106431014-106431036 ATTGAAATTCAGGCATGGAAGGG + Intergenic
978472415 4:109084120-109084142 ACAGATGTGCATGATTGGAAGGG - Intronic
979951041 4:126894217-126894239 ACTGATAAACAATCTTGGAAAGG - Intergenic
980171868 4:129298885-129298907 ACTGGTGTGAAGGCTAGGAAAGG + Intergenic
981699942 4:147597342-147597364 AATGAGATGCAGACTAGGAAAGG + Intergenic
981804624 4:148700047-148700069 ACTGATAGGAAGGCAAGGAATGG - Intergenic
981834896 4:149043168-149043190 ACTGGTATGCAGCCTTTGACTGG + Intergenic
987005562 5:13706241-13706263 ACAGAAATGCAGGCATGGAAAGG - Intronic
988665772 5:33325773-33325795 AATGATATGCTGGCTTGCATGGG + Intergenic
989093418 5:37758173-37758195 ACTGATAATCAGGATTGCAATGG - Intergenic
989620930 5:43383794-43383816 AGTGACATGCAGGCTGGGCACGG + Intronic
990204811 5:53417197-53417219 ACTGATATGTAGGCTGGGTGCGG - Intergenic
995061898 5:107820163-107820185 AAAGATTTGGAGGCTTGGAAAGG + Intergenic
995544125 5:113213351-113213373 AGTGCCATGCAGGCTTGGAAGGG + Intronic
997049803 5:130366192-130366214 ACTGCTATTCAGCCTTGTAAAGG - Intergenic
997806646 5:136924520-136924542 ACTGATATGCAAGATGGGGAGGG + Intergenic
998247705 5:140523396-140523418 AGTTATATGCAGGCTGGGCATGG - Intronic
1000963400 5:167627014-167627036 AATGACATGAGGGCTTGGAAAGG + Intronic
1005267177 6:24124554-24124576 ACTTTTATGCAGGCTGGGAAGGG + Intergenic
1007090597 6:39182205-39182227 AATGATTTGCAGGCTGGGAAGGG - Intergenic
1007837958 6:44690603-44690625 ACTGATCTGAAGGCTGGGCATGG + Intergenic
1009786188 6:68342983-68343005 ACTGAAATGCAGGGTTGGAAGGG - Intergenic
1010619292 6:78054624-78054646 ACGGATAAGGAAGCTTGGAAAGG - Intergenic
1013938443 6:115629599-115629621 ACTGATATGCAGTCTTTCAGAGG + Intergenic
1014753300 6:125276590-125276612 ACTTAATTGCAGGTTTGGAATGG - Intronic
1014909227 6:127069796-127069818 ACTGATATGCAACCTTGGTTAGG + Intergenic
1016357182 6:143231227-143231249 ACTGATGTTCAGGTTTGAAATGG + Intronic
1017383274 6:153855354-153855376 ACTGAAATGCATGCTTCAAATGG + Intergenic
1019556160 7:1632619-1632641 ACTGATATTCAGGCCTGGCTGGG - Intergenic
1024934186 7:54696390-54696412 ATTGAAATGCAGGCCAGGAATGG - Intergenic
1026438345 7:70419762-70419784 GCTGATATGCAGTGTTGGCAAGG - Intronic
1027948820 7:84785948-84785970 ACTGACATAAAGGCTTGGATAGG - Intergenic
1029546516 7:101213009-101213031 TCTGATATGGGGGCTGGGAAGGG + Intronic
1029869134 7:103670205-103670227 AATGATATGCATTCTTGGTAGGG + Intronic
1030549312 7:110938068-110938090 ACTGATATGCATACTGGGAGAGG - Intronic
1031309014 7:120170441-120170463 TCAGAAATGCTGGCTTGGAAGGG - Intergenic
1032512939 7:132486539-132486561 TCTGCTCTGCAGGCTTGGAGTGG - Intronic
1033441994 7:141388287-141388309 ACTAATAGTCAGGCTTCGAATGG + Intronic
1037376672 8:18237817-18237839 ACTTATATGCAGCCTTGCAGTGG - Intergenic
1037605981 8:20437428-20437450 ACTGGTATGGTGGCTTGGACTGG - Intergenic
1038954613 8:32453860-32453882 TCTGATGTGCAGGGATGGAAAGG - Intronic
1043351124 8:79362098-79362120 ACTGTAATGCAGGCTTATAACGG - Intergenic
1043558934 8:81467963-81467985 ACTGAAATGCATGCTTAAAATGG - Intergenic
1045306454 8:100960851-100960873 ACTGAAATACAGGCTAGAAAGGG - Intergenic
1046943388 8:119952846-119952868 TCTGATATGCAGGCTGGTGAAGG + Intronic
1048214920 8:132485207-132485229 AGTGATATGAAGTCTAGGAAAGG - Intergenic
1049418631 8:142506957-142506979 ACTGAAATGCAGGTCTGCAAGGG - Intronic
1049495300 8:142928104-142928126 ACTGCAAGGCAGGCTGGGAACGG - Intergenic
1050080913 9:1914875-1914897 GCTGATATGCTGGCTTGGCGTGG - Intergenic
1051076146 9:13238728-13238750 ACAGATATGTAAGCTGGGAAAGG - Intronic
1059122123 9:111650191-111650213 AATGATATGCATGTTTGCAAGGG + Intronic
1061750198 9:132771779-132771801 ACTGATACACAGGCTCTGAAAGG - Intronic
1186000878 X:5009080-5009102 ATGGATAAGCAGGCTTGGCATGG + Intergenic
1186881636 X:13872458-13872480 AGTGATATGTAGGCTTGGCATGG - Intronic
1186916866 X:14232513-14232535 ACTGATATACAAGCATGGAGTGG + Intergenic
1189002473 X:36961479-36961501 ACTGTTTGGAAGGCTTGGAATGG - Intergenic
1189993047 X:46612635-46612657 ACTGAGATGCAGGCCGGGCATGG + Intronic
1190605143 X:52133841-52133863 ACTCTTATGCAGGCTTTTAAAGG + Intergenic
1192081330 X:68050615-68050637 ATTGATCTGCAAGCTTGGACAGG - Intronic
1195246218 X:102997966-102997988 ACTTATATGCTTGCATGGAAAGG - Intergenic
1199726138 X:150584108-150584130 TCTTATATGCATGCTAGGAATGG + Intronic