ID: 945858461

View in Genome Browser
Species Human (GRCh38)
Location 2:215094089-215094111
Sequence CAGTCCTTCTGAAAGAGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 426
Summary {0: 1, 1: 0, 2: 5, 3: 142, 4: 278}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945858461 Original CRISPR CAGTCCTTCTGAAAGAGTGA GGG (reversed) Intronic
900722231 1:4184611-4184633 TAGTCTTTTTGCAAGAGTGAGGG + Intergenic
900841068 1:5048976-5048998 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
902051193 1:13564834-13564856 TAGTCCCTTTGCAAGAGTGAGGG - Intergenic
902970088 1:20042118-20042140 TAGTCCTTTTGCAAGAGTGAGGG + Intronic
903395702 1:23000378-23000400 TAGTCTTTTTGCAAGAGTGAGGG + Intergenic
904171219 1:28593136-28593158 CAGGCCTTCTCCAAGAATGAGGG + Intronic
904394231 1:30207362-30207384 TAGTCCCTTTGCAAGAGTGAGGG - Intergenic
905060204 1:35133690-35133712 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
905429565 1:37911621-37911643 TAGTCCTTTTGCAAGAATGAGGG - Intronic
906379026 1:45319825-45319847 CAGTCCTTTTGCAAGAATGAGGG - Intergenic
910049669 1:82959462-82959484 TAGCCCTTTTGCAAGAGTGAGGG - Intergenic
910860997 1:91742218-91742240 CAGTCCATGTGAGAGAGGGATGG - Intronic
911147687 1:94568451-94568473 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
911790773 1:102013292-102013314 CATTTCTTCAGAAAGAGTAAAGG + Intergenic
911819384 1:102397968-102397990 GAGTCCTTTCAAAAGAGTGATGG + Intergenic
912815033 1:112822196-112822218 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
912939173 1:114029979-114030001 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
913095440 1:115511767-115511789 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
914777414 1:150750422-150750444 CAGTCCACCTGAAAGTCTGAGGG - Intronic
915989382 1:160498178-160498200 TAGACATTCTGAAAGAATGAAGG + Intronic
916747781 1:167697674-167697696 CAGTCCCCCTGGAGGAGTGAAGG + Exonic
917000033 1:170347523-170347545 CAGTCCTTCAGGATGAGTGGTGG - Intergenic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
919476677 1:198038856-198038878 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
919790100 1:201285144-201285166 CAGGCCTTAGGAGAGAGTGAGGG + Intronic
920180784 1:204130613-204130635 CTGGCCTTCTGAAAAAGTGACGG + Intergenic
920927820 1:210359220-210359242 CAGTTCTGCTCAAAGAATGAAGG + Intronic
922363254 1:224842032-224842054 TAGTCCTTTTGTAAGAGCGAGGG + Intergenic
922845128 1:228678682-228678704 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
922935100 1:229416500-229416522 TAGTCTTTTTGCAAGAGTGAGGG - Intergenic
923213908 1:231831787-231831809 TCGTCCTTTTGCAAGAGTGAGGG + Intronic
924895899 1:248337817-248337839 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1063322745 10:5066958-5066980 ATGCCCTTCTAAAAGAGTGAAGG + Intronic
1065807216 10:29405324-29405346 ATGTCCTTCTGTAAGAGTGAAGG + Intergenic
1066103115 10:32135405-32135427 TAGTCCCTTTGCAAGAGTGATGG + Intergenic
1067360628 10:45574878-45574900 TAGTCCTTTTGGAAGAGTGAGGG - Intronic
1068613755 10:59089145-59089167 CGGTCCTTCTGAAAAAGCTAAGG - Intergenic
1068929384 10:62573502-62573524 CAGTGGTTCTGAAACATTGATGG - Intronic
1070893747 10:79964138-79964160 TAGTCCTTTTGCAAGAGTGAGGG - Intronic
1071187550 10:83061430-83061452 TAGTCCTTTGGCAAGAGTGAGGG - Intergenic
1071976516 10:90961392-90961414 AAGTCCCTCTGAAACAGTGTTGG + Intergenic
1072011049 10:91303327-91303349 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1072884768 10:99263333-99263355 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1073014347 10:100386027-100386049 TAGTCCCTTTGCAAGAGTGAGGG - Intergenic
1073130628 10:101186810-101186832 TAGTCCTTTTGCAAGAGTGAAGG + Intergenic
1073395016 10:103210395-103210417 TAGTCCCTTTGCAAGAGTGAGGG - Intergenic
1073683792 10:105731345-105731367 TAGTCCCTTTGCAAGAGTGAGGG - Intergenic
1074085851 10:110208651-110208673 CAGTCCTGCTGCTAGAGGGAAGG - Intronic
1075979490 10:126724533-126724555 CAACCCTACTGAAAGAGGGATGG - Intergenic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1078315630 11:10291028-10291050 AAGTTGTTCTCAAAGAGTGATGG + Intronic
1078354775 11:10625477-10625499 AAGTCCATCTGCAAGTGTGAAGG - Intronic
1079230835 11:18647379-18647401 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1079578543 11:22033074-22033096 CACTCCTTCAGACAGAGTTAGGG + Intergenic
1079847363 11:25488598-25488620 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1080304226 11:30819167-30819189 CAGTCCTTCTGGGACAGGGATGG + Intergenic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1084354533 11:68628642-68628664 TAGTCTTTTTGCAAGAGTGAGGG - Intergenic
1084645657 11:70456050-70456072 CATTGCTGCTGAAGGAGTGAAGG - Intergenic
1084698831 11:70772466-70772488 CCATGCCTCTGAAAGAGTGAAGG + Intronic
1086133372 11:83422771-83422793 CAGTCCTTTTGGAAGAGTGAGGG - Intergenic
1086134518 11:83433001-83433023 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1086135964 11:83444290-83444312 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1086550523 11:88047515-88047537 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1087197198 11:95313637-95313659 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1087875896 11:103356806-103356828 CATTCATTCTGAAAGATTTATGG + Intronic
1088104394 11:106189638-106189660 ATGTCCTTATGAAAAAGTGAAGG - Intergenic
1088785490 11:113177907-113177929 CATTCCTTTTGAGGGAGTGAAGG - Intronic
1089117577 11:116108734-116108756 CACTCCTTATGAAAGTGGGAAGG - Intergenic
1089953653 11:122551454-122551476 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1090911369 11:131122547-131122569 CAGGCCTTCCGAGAGAGTGCTGG + Intergenic
1091136892 11:133199529-133199551 CAGTCCTTTTGCAAGATAGAGGG - Intronic
1091317300 11:134623664-134623686 CAGTCCTTCTGGAGCACTGAAGG + Intergenic
1092112205 12:5971594-5971616 CAGTCTTCCTGGAAGAGTGTAGG - Exonic
1092682086 12:10994419-10994441 CAGCCCTTCTGAAAAAGTCCTGG + Intronic
1092951013 12:13503172-13503194 CAGTCCTCTTGAAAGAGCGCTGG + Intergenic
1093358773 12:18199450-18199472 TAGTCCTTTTACAAGAGTGAGGG - Intronic
1094400990 12:30060314-30060336 TAGTTCTTTTGCAAGAGTGAGGG - Intergenic
1094826069 12:34270060-34270082 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1095637918 12:44453911-44453933 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1095806445 12:46325318-46325340 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
1096906978 12:54944989-54945011 TACTCCTTTTGCAAGAGTGAGGG + Intergenic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1097541877 12:60953357-60953379 CAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1098920230 12:76295951-76295973 TAGTCCCTTTGCAAGAGTGAGGG - Intergenic
1099328746 12:81253829-81253851 CATTCCTTCTGTAGGAATGAAGG + Intronic
1100940626 12:99719616-99719638 TAGTGCTTTTGCAAGAGTGAGGG - Intronic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1102116461 12:110406881-110406903 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
1102835359 12:116053057-116053079 CTGTCTTTCTGAAAGATTTACGG + Intronic
1103884701 12:124191671-124191693 CAGTCTCCCTGAAAGAGAGACGG - Intronic
1104257932 12:127156071-127156093 CAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1104639521 12:130458475-130458497 CAGCCCTTAAGACAGAGTGACGG + Intronic
1105032611 12:132894517-132894539 TAGTCCTTTTGCAAGAGTGAGGG - Intronic
1108347698 13:49562639-49562661 CAGCCTTTGTGACAGAGTGAGGG - Intronic
1108803587 13:54129270-54129292 TAGTCGTTTTGCAAGAGTGAGGG + Intergenic
1109353223 13:61209132-61209154 TAGTCTTTTTGCAAGAGTGAGGG - Intergenic
1109790060 13:67234419-67234441 CAGTCATTCAAAAAGAATGAAGG - Intergenic
1110845629 13:80187806-80187828 TAGTCCCTTTGCAAGAGTGAGGG - Intergenic
1110978761 13:81870306-81870328 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1111888750 13:94055199-94055221 CAGCCCTGGTGAAAGTGTGAGGG + Intronic
1112616177 13:101007858-101007880 CAGACCTGCTGAGAGAGTGAGGG - Intergenic
1112889054 13:104209690-104209712 TAGTCTTTTTGCAAGAGTGAGGG + Intergenic
1113296442 13:108964148-108964170 CAGCCCTCCTGCAACAGTGATGG + Intronic
1114049082 14:18905302-18905324 CAGCACTTCAGAAAGAGTGATGG - Intergenic
1114113482 14:19496631-19496653 CAGCACTTCAGAAAGAGTGATGG + Intergenic
1114115186 14:19614384-19614406 CAGCACTTCCGAAAGAGTGATGG + Intergenic
1114119227 14:19652395-19652417 CAGTCATTCTGCCAGGGTGAGGG + Intergenic
1114119233 14:19652422-19652444 CAGTCATTCTGCCAGGGTGAGGG + Intergenic
1114169150 14:20254262-20254284 CAATCATGATGAAAGAGTGAAGG - Intergenic
1114936521 14:27545775-27545797 CAGTCCTTCTTAAAGAGGCAGGG - Intergenic
1115635517 14:35287069-35287091 CAGTCATTCTGGATGAGTGTTGG - Intronic
1117174469 14:53132568-53132590 CAGTTCTTTTGCAAGAGTGAGGG - Intronic
1120539283 14:85734556-85734578 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1121192970 14:92046149-92046171 TAGTCCTTTTGCAAGAGCGAGGG + Exonic
1121219274 14:92274002-92274024 CAGTCCTCCTGAGAGATGGAAGG + Intergenic
1121980318 14:98448858-98448880 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
1123505143 15:20934871-20934893 CAGCACTTCAGAAAGAGTGATGG - Intergenic
1123562386 15:21508567-21508589 CAGCACTTCAGAAAGAGTGATGG - Intergenic
1123598631 15:21945854-21945876 CAGCACTTCAGAAAGAGTGATGG - Intergenic
1123882260 15:24687465-24687487 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1125849367 15:42888602-42888624 TAGTCCCTTTGCAAGAGTGAGGG - Intronic
1126477857 15:49085110-49085132 CAGTGCTTCTGAAAGGCTGTAGG - Intergenic
1126844084 15:52743079-52743101 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1129779199 15:78258878-78258900 CAGTGTTTCTGGAACAGTGATGG - Intergenic
1129929765 15:79400902-79400924 CAGGCCAGCTTAAAGAGTGAAGG - Intronic
1130304827 15:82706290-82706312 TAGTCCTTTTGCAAGACTGAGGG - Intronic
1130538472 15:84803491-84803513 GAGACCTTCTGAAGGGGTGAGGG + Exonic
1202970734 15_KI270727v1_random:235714-235736 CAGCACTTCAGAAAGAGTGATGG - Intergenic
1133882694 16:9797929-9797951 CAGTGGTTCTCAAAGGGTGAAGG - Intronic
1133939038 16:10293135-10293157 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1134763353 16:16733872-16733894 CAGTCCTTCTACGGGAGTGAGGG - Intergenic
1134982699 16:18625285-18625307 CAGTCCTTCTACGGGAGTGAGGG + Intergenic
1137055024 16:35741231-35741253 AAGTCCTTTTGCAAGAGTGGGGG + Intergenic
1137363753 16:47842896-47842918 TAGTCCCTTTGCAAGAGTGAGGG - Intergenic
1137632038 16:49953614-49953636 CAATCCTTCTGAACAAGTCAAGG - Intergenic
1137632155 16:49954406-49954428 CAATCCTTCTGAACAAGTCAAGG + Intergenic
1137896361 16:52217000-52217022 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1138758810 16:59519223-59519245 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1139275888 16:65727309-65727331 CAGTCCCTCTGAGGAAGTGACGG - Intergenic
1141365973 16:83443493-83443515 TAGTACTTCAGAAAAAGTGAGGG - Intronic
1143414027 17:6733008-6733030 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
1145080392 17:19890202-19890224 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
1148523861 17:48310950-48310972 CAGTCCCACTGAAAGACGGATGG + Intronic
1151259786 17:72907459-72907481 CAGTCCACGTGACAGAGTGACGG + Intronic
1151503056 17:74504694-74504716 TAGTCCCTTTGCAAGAGTGAGGG - Intergenic
1151929173 17:77220497-77220519 GAGTGCCACTGAAAGAGTGAGGG + Intergenic
1152454277 17:80404083-80404105 TACTCCTTCTGCAAGAGTGAGGG - Intergenic
1153323183 18:3793135-3793157 CAGTCCTTCTCAGAGAGAGAGGG - Intronic
1155137289 18:23008141-23008163 CAGTCCTTGTGAAAGGCAGAAGG - Intronic
1155941831 18:31807927-31807949 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1155962277 18:32004576-32004598 TAGTCCCTTTGCAAGAGTGAGGG - Intergenic
1156302571 18:35848253-35848275 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1156923830 18:42554494-42554516 TAATCCTTTTGCAAGAGTGAGGG + Intergenic
1156986752 18:43358664-43358686 CAGTCCTTCTGAAATAATTTAGG + Intergenic
1157215951 18:45783604-45783626 AAGTCCATCTGAAAGAATCAGGG - Intergenic
1158576517 18:58643297-58643319 TAGTCCCTTTGTAAGAGTGAGGG + Intergenic
1159393451 18:67826288-67826310 CAGTTATTTTGAAAGACTGAAGG + Intergenic
1159929447 18:74296105-74296127 CAGTCCCTTTGCAAGAGTGAGGG - Intergenic
1159959135 18:74541810-74541832 CAGTGCTTCTGAAGAAGTGGGGG - Intronic
1162258248 19:9510584-9510606 AAGTTCTTCTGAAAGTGTTATGG - Intergenic
1163899871 19:20091828-20091850 TAGTCCTTTTGCAAGAGTGAGGG + Intronic
1164003694 19:21130611-21130633 CAGTACCTTTGCAAGAGTGAGGG + Intergenic
1164153259 19:22572366-22572388 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1164220341 19:23187594-23187616 CAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1165672176 19:37688755-37688777 CAGCCCCTCTGGAAGAGTAAAGG + Intronic
1166905443 19:46105271-46105293 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1167193379 19:48007964-48007986 CTGTCCTTAGGAAAGTGTGATGG - Intronic
1167901454 19:52625226-52625248 TAGTCCCTTTGCAAGAGTGAGGG - Intronic
1168248538 19:55127145-55127167 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
925433554 2:3817403-3817425 CAGTCCCTTTGCAAGAGTGAGGG + Intronic
926246599 2:11126195-11126217 CATTCCTTCTGAGACAGTGAGGG - Intergenic
926820687 2:16848506-16848528 CAGTGTTTCTGAAAGAGACAAGG - Intergenic
927134431 2:20086345-20086367 TGGTCCTTTTGCAAGAGTGAGGG - Intergenic
927162910 2:20286008-20286030 CAGTACGACTGAAAGAGAGACGG + Intronic
929383886 2:41382438-41382460 TAGTCCATTTGCAAGAGTGAGGG - Intergenic
930098716 2:47586855-47586877 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
930379850 2:50614054-50614076 CTGTCTTCCCGAAAGAGTGAGGG + Intronic
930706410 2:54508998-54509020 TAGTCCCTTTGCAAGAGTGAGGG + Intronic
930945149 2:57064630-57064652 CACTCATTCTGAAAGAATAATGG + Intergenic
933179502 2:79213428-79213450 TAGTCCTTTTGCAAGAGTGAGGG + Intronic
935170068 2:100603943-100603965 CAGTCCCTATGAAAGAGGCATGG - Intergenic
936794013 2:116185847-116185869 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
937511812 2:122603849-122603871 CCCTCTGTCTGAAAGAGTGAAGG - Intergenic
937594690 2:123659542-123659564 CAGTCCTTTTGCAGGAGTGAAGG + Intergenic
937919109 2:127117932-127117954 CAGTCGTTCTGCAATAGTGGGGG + Intergenic
938270601 2:129967044-129967066 CAGTCATTCTGCCAGGGTGAGGG + Intergenic
938426392 2:131193563-131193585 CAGCACTTCAGAAAGAGTGATGG - Intronic
938666043 2:133538743-133538765 CAATCCTTCTTCAAGATTGAGGG - Intronic
939084419 2:137700903-137700925 CAGTGGTTCTGAAAAACTGATGG - Intergenic
939307690 2:140430264-140430286 TAGTCCTTTTGCGAGAGTGAGGG - Intronic
939380317 2:141426763-141426785 CAGTGGATCAGAAAGAGTGAGGG + Intronic
939872771 2:147543251-147543273 CCCTCATTCTGAAAGAGTTAGGG + Intergenic
940508545 2:154585118-154585140 TAGTCCTTTTGTAAGAGTGAGGG + Intergenic
941157072 2:161992239-161992261 CATTACTTCTGAAAAAATGAAGG + Exonic
941455856 2:165711706-165711728 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
941750900 2:169134671-169134693 TAGTCCCTTTGCAAGAGTGAGGG - Intronic
943412646 2:187562069-187562091 TAGTCCTTTTGCAATAGTGAAGG + Intronic
943460909 2:188170788-188170810 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
944358305 2:198820343-198820365 TATTTCTTCTGAAAGAGTAATGG + Intergenic
944387732 2:199183499-199183521 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
945361918 2:208903355-208903377 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
945376387 2:209082198-209082220 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
945711167 2:213296907-213296929 TAGTAGTTCTGAAAAAGTGATGG + Intronic
945858461 2:215094089-215094111 CAGTCCTTCTGAAAGAGTGAGGG - Intronic
947130376 2:226916662-226916684 CAAGCCTTCATAAAGAGTGATGG + Intronic
947598806 2:231431843-231431865 CAGTCCCTTTGCAAGACTGAGGG + Intergenic
947618424 2:231573677-231573699 CAGTTGTTCTGCAGGAGTGAGGG - Intergenic
947842509 2:233217217-233217239 TAGTCCCTTTGCAAGAGTGAGGG + Intronic
948207711 2:236171373-236171395 CAGACATTCCGAAAAAGTGATGG + Intergenic
948866256 2:240776251-240776273 GAGTCCTTCAGACAGAGTGGAGG - Intronic
1168942995 20:1729343-1729365 TACTCCTTTTGCAAGAGTGAGGG + Intergenic
1169593646 20:7173697-7173719 AATTCATTCTGAAAGAGTGAAGG - Intergenic
1170107550 20:12767878-12767900 CAGTCCCTCTGGCAGAGTGATGG - Intergenic
1170178710 20:13503158-13503180 CAGGCTTTCTGAAGGAGTCATGG - Intronic
1170428280 20:16256886-16256908 CAAGCCTTCTGATAGACTGAAGG + Intergenic
1170582859 20:17711968-17711990 CCGTCCTTCCTAAAGAGTGATGG + Intronic
1171721762 20:28570300-28570322 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1171756299 20:29113199-29113221 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1171785953 20:29464694-29464716 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1171862288 20:30412278-30412300 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1174901361 20:54504493-54504515 CAGTCCTTCTGAGTGAGTCAAGG - Intronic
1175124157 20:56739203-56739225 CATTCATCCTGAGAGAGTGATGG - Intergenic
1175359369 20:58396181-58396203 TAGCCCTTCTGAAAGGATGAAGG - Intronic
1175461784 20:59157318-59157340 AAGTCCTACTGAAAGTGTGGGGG + Intergenic
1177686935 21:24449231-24449253 CATTCCTTCTGGAAGAGGTAGGG + Intergenic
1179016041 21:37595077-37595099 CAGTCATTCTGAAAGGGAGGAGG - Intergenic
1180074392 21:45455381-45455403 CTTTCCTTCTGCAAGAGTGGGGG + Intronic
1180295318 22:10928987-10929009 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1180413354 22:12637057-12637079 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1180463512 22:15589660-15589682 CAGTCATTCTGCCAGGGTGAAGG - Intergenic
1180463517 22:15589687-15589709 CAGTCATTCTGCCAGGGTGAGGG - Intergenic
1180467560 22:15627691-15627713 CAGCACTTCCGAAAGAGTGATGG - Intergenic
1182394937 22:30028421-30028443 CAGTCCTGCTGTAAGAGCTAAGG - Intronic
1182962705 22:34490507-34490529 CGCTCCTTCTGAATGTGTGAAGG - Intergenic
1183635318 22:39058666-39058688 TAGTCCCTTTGCAAGAGTGAGGG + Intronic
1184634710 22:45817908-45817930 CATCCCTAGTGAAAGAGTGAGGG + Intronic
951187212 3:19727649-19727671 ATGTCCTTGTGGAAGAGTGAAGG - Intergenic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
951762472 3:26161754-26161776 TTGTCCTTTTGCAAGAGTGAGGG + Intergenic
951825137 3:26859865-26859887 CAGTCCTCCTGGAGGAGAGAGGG + Intergenic
952343299 3:32463044-32463066 TAGTCCTTTTGCAGGAGTGAGGG + Intronic
952894881 3:38071873-38071895 TAGTCCTTTTCCAAGAGTGAGGG + Intronic
953656221 3:44856890-44856912 TAGTCCTTTTGCAAGAGTGAGGG + Intronic
953834152 3:46328700-46328722 CAATCCTTTTGCAAGAGTGAGGG + Intergenic
954161445 3:48725692-48725714 TAGTCCTTTTGCAAGAGTGAGGG + Intronic
954775067 3:53009548-53009570 CAAACTTACTGAAAGAGTGAAGG - Intronic
956233237 3:67040367-67040389 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
956350354 3:68328355-68328377 CTGTCCTTCTGAAACTGGGACGG - Intronic
956622386 3:71234416-71234438 CAGTTCTTTTGCAAGGGTGAAGG - Intronic
957675039 3:83355199-83355221 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
958422280 3:93942252-93942274 TAGTCCCTTTGCAAGAGTGAGGG - Intronic
958676514 3:97274561-97274583 TAGTCCTTTTGCAAGAGTGAGGG + Intronic
959433840 3:106288180-106288202 CTGTCCTCCTGAATGAGTTAAGG + Intergenic
961147008 3:124602581-124602603 CAGCTCTTCTAAAGGAGTGAGGG + Intronic
961866027 3:129954211-129954233 CTTTCCTTCTGACAGGGTGAAGG - Intergenic
962441118 3:135417036-135417058 AAGTCCTTCTCAGAGAGGGAAGG - Intergenic
963111587 3:141693204-141693226 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
964125175 3:153228266-153228288 TAGTCCTTTTGCAGGAGTGAGGG + Intergenic
964299943 3:155276553-155276575 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
965028481 3:163332708-163332730 CAGTCAGTCTAAAAGGGTGAAGG + Intergenic
965861674 3:173157338-173157360 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
966067144 3:175832014-175832036 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
966192536 3:177284452-177284474 GAGCCCTTCAGAAAGAGGGAAGG - Intergenic
966279618 3:178211864-178211886 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
966398146 3:179522521-179522543 TACTCCTTTTGCAAGAGTGAGGG + Intergenic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
970256136 4:14172107-14172129 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
970533012 4:17001792-17001814 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
970853773 4:20631880-20631902 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
973751395 4:54023767-54023789 TAGTCCTTTTGCAAGAGTGAGGG - Intronic
974173137 4:58292909-58292931 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
974565854 4:63577682-63577704 CAGTCCTTCTTAAAGTGTTCTGG + Intergenic
974904114 4:68035111-68035133 TAGTCCCTTTGCAAGAGTGAGGG - Intergenic
976739617 4:88344968-88344990 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
977225061 4:94385054-94385076 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
977331182 4:95639708-95639730 CAGTCCTTTAGAAAAAATGATGG - Intergenic
977782173 4:100993456-100993478 AAGTCCTTTTGCAAGAGTGAAGG + Intergenic
980003087 4:127513057-127513079 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
980092190 4:128454588-128454610 CAGTTCTTCTGGAAGAGTTCAGG + Intergenic
980302381 4:131011341-131011363 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
980928251 4:139159932-139159954 TAGTCCCTTTGCAAGAGTGAGGG + Intronic
982319143 4:154060775-154060797 CAGTCATTTTGCAAGAGTGAGGG - Intergenic
982396448 4:154920438-154920460 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
983056343 4:163102456-163102478 TACTCCTTTTGCAAGAGTGAGGG + Intergenic
983247706 4:165307612-165307634 CAGTCCTCCTCAAAGAATCAAGG - Intronic
983883445 4:172957746-172957768 TAGTCCTTTTGCAAGAGTGAGGG + Intronic
983943942 4:173565350-173565372 CAGTGAATCTGAAAGAGTTATGG - Intergenic
984322464 4:178211211-178211233 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
984437576 4:179724776-179724798 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
985078717 4:186243738-186243760 TAGTCCCTTTGCAAGAGTGAGGG + Intronic
986368637 5:7059521-7059543 TAGTCCTTTTGTAAGAGTGAGGG + Intergenic
986871782 5:12056659-12056681 AAGTCCTTCTGAAGGTGTGTGGG + Intergenic
988849577 5:35165827-35165849 CAGTTCTGCTGAAATAGTCATGG - Intronic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
989660169 5:43789906-43789928 TAGTCCCTTTGCAAGAGTGAGGG - Intergenic
989688587 5:44115940-44115962 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
990564856 5:57018734-57018756 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
991016687 5:61940806-61940828 CAGTCCATCTGAAAGAGGCAGGG - Intergenic
992451724 5:76882056-76882078 TAGTCCCTTTGCAAGAGTGAGGG + Intronic
993370077 5:87082176-87082198 CTACCTTTCTGAAAGAGTGAAGG - Intergenic
994295423 5:98083194-98083216 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
994778673 5:104065783-104065805 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
994955216 5:106521828-106521850 CAGTGCTTCTGAAAGAGCCTTGG - Intergenic
996574750 5:124968496-124968518 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
996723152 5:126649210-126649232 CAGTCCTTTTGCAAGGGTGAGGG - Intergenic
997052656 5:130400745-130400767 CAGTCCTTTTGTAAGATTTATGG - Intergenic
1000142111 5:158415464-158415486 TAGTTCTTCTGAAAGGTTGATGG + Intergenic
1000170360 5:158696486-158696508 CATTCCTTCAGAAACAGTTAAGG + Exonic
1000438839 5:161244095-161244117 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1000440023 5:161252827-161252849 TAGTCTTTTTGCAAGAGTGAGGG - Intergenic
1000607212 5:163337974-163337996 CAGTCTTTTTGCAAGAGTGAGGG - Intergenic
1001353964 5:171002601-171002623 TAGTCCCTTTGCAAGAGTGAAGG + Intronic
1001706366 5:173743949-173743971 CAGGCCTTCTGAGAGAGGGGAGG - Intergenic
1003100089 6:3170362-3170384 TAGTCCCTTTGCAAGAGTGAGGG - Intergenic
1007084418 6:39133333-39133355 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
1007300646 6:40865481-40865503 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
1008093143 6:47312548-47312570 TAGACCTTCTGAAAGTGTGCAGG - Intergenic
1008681272 6:53875700-53875722 CAGTGCTTTTGATAGAGTGATGG + Intronic
1009379405 6:63009297-63009319 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1009751734 6:67884998-67885020 CAGTCCTTTGGTAAGAGTTAGGG + Intergenic
1010586413 6:77662137-77662159 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1010829423 6:80511900-80511922 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1010841067 6:80649650-80649672 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1011341867 6:86324826-86324848 AAGCCCTTCTAGAAGAGTGAAGG - Intergenic
1012130800 6:95489780-95489802 TAATCCTTCTGAAATAATGATGG + Intergenic
1012675374 6:102106075-102106097 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1014115011 6:117660925-117660947 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
1015801073 6:137062705-137062727 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1016751221 6:147632378-147632400 TAGTCCTTTTGCAAGAGTGAGGG + Intronic
1017270129 6:152494601-152494623 TAGTCCCTTTGCAAGAGTGAGGG - Intronic
1018000308 6:159572837-159572859 CAGCTCTTCTGAAAGAATGCTGG - Intergenic
1018077878 6:160232441-160232463 TAGTCCCTTTGCAAGAGTGAGGG - Intronic
1019191980 6:170256783-170256805 CAGGCCTTCTGAAAGAAGGAAGG + Intergenic
1019837505 7:3403731-3403753 GTGCTCTTCTGAAAGAGTGAGGG + Intronic
1020794507 7:12663786-12663808 TAGTCCTTTTGCAAGAGAGAGGG - Intergenic
1021172995 7:17418212-17418234 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1021430129 7:20549565-20549587 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1021660871 7:22916849-22916871 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1022447698 7:30483346-30483368 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1023112801 7:36831166-36831188 CAGTTCTTCAGAAAGTGTGGGGG - Intergenic
1023216845 7:37871667-37871689 AAGTCTTTATGACAGAGTGAAGG + Intronic
1023813464 7:43930251-43930273 CAGTCCTTCAGAAAGGAGGAAGG + Intronic
1024397842 7:48889695-48889717 CAGTCCATCTGAAAATGAGACGG + Intergenic
1024738940 7:52335077-52335099 CAGTCCTTTTGCAAGAGTAAGGG + Intergenic
1027158657 7:75786427-75786449 TAGTCCCTTTGCAAGAGTGAGGG - Intronic
1027354637 7:77343350-77343372 TAGTCCTTTTGCAAGATTGAGGG - Intronic
1028042604 7:86073912-86073934 GAATCCTTCTATAAGAGTGAGGG - Intergenic
1028589559 7:92480991-92481013 TAGTCCCTTTGCAAGAGTGAAGG + Intergenic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1030163295 7:106529803-106529825 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
1030445577 7:109644217-109644239 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1031305387 7:120119664-120119686 ATGTCCTTCTAAAAGAATGAAGG - Intergenic
1031354918 7:120778725-120778747 TAGTGCTTTTGCAAGAGTGAGGG + Intergenic
1032594423 7:133225243-133225265 CAGTGCTTCTGAAAGAGGGCAGG - Intergenic
1032922995 7:136570676-136570698 CAATTTTTCTGAAAGAGTGTAGG + Intergenic
1033084982 7:138332992-138333014 TAGTCCCTTTGCAAGAGTGAGGG - Intergenic
1033464726 7:141580199-141580221 TAGTCCTTTTGCAAGAGTGAGGG + Intronic
1033625841 7:143108784-143108806 TAGTCCCTTTGCAAGAGTGAAGG - Intergenic
1033869407 7:145732307-145732329 CATTCCTTCTGAAAGCTTTAAGG - Intergenic
1034428851 7:151030071-151030093 CAGTTCTTAGGAAAGAGTAAGGG + Intronic
1035733454 8:1869894-1869916 CAGTCCTTTAGAAAGGGCGATGG + Intronic
1035901417 8:3461685-3461707 CAGTCCTCCTGCAAGGATGATGG - Intronic
1036472055 8:9061025-9061047 TAGTCCTTTTGCAAGAGCGAGGG + Intronic
1036549990 8:9807209-9807231 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1039870783 8:41543449-41543471 CATTCCTCTTGAAAAAGTGAAGG - Exonic
1040648319 8:49423864-49423886 TAGTCCCTTTGCAAGAGTGAAGG - Intergenic
1041651528 8:60307869-60307891 TAGTCCCTTTGAAAGAGTGAGGG + Intergenic
1041917214 8:63149700-63149722 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1043717635 8:83506803-83506825 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1043827090 8:84942282-84942304 ATGTCCTTCTAAAGGAGTGAAGG - Intergenic
1043838005 8:85067053-85067075 TAGTCCTTTTGTAAGAGTGAGGG - Intergenic
1045085158 8:98675038-98675060 CTGTGCTTTTGAAACAGTGAAGG - Intronic
1045533099 8:103002750-103002772 TAGTCCTTTTACAAGAGTGAGGG - Intergenic
1046688758 8:117258571-117258593 CACTGGTTCTGAAATAGTGAAGG + Intergenic
1047097974 8:121644036-121644058 AAGTCAATCTAAAAGAGTGAAGG - Intergenic
1048998190 8:139807086-139807108 CAGTCCTTCTGAGTGGGTGGAGG - Intronic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1050711133 9:8465118-8465140 CAGTCATTTTGAAAGGATGATGG + Intronic
1050896312 9:10888597-10888619 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1051729667 9:20127260-20127282 CAAACATTCTGAAAGAGGGAGGG + Intergenic
1052841450 9:33294841-33294863 TAGTCCTTCTGAGAGTGAGAAGG + Exonic
1055882007 9:81013136-81013158 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1056300347 9:85233645-85233667 CAATTATGCTGAAAGAGTGAAGG - Intergenic
1056324170 9:85462773-85462795 TAGTCCCTTTGCAAGAGTGAGGG - Intergenic
1056385782 9:86095756-86095778 CAGACCTACTGATAGAGGGATGG + Intronic
1058025914 9:100142276-100142298 TAGTCCTTTTGCAAGAGTGAGGG + Intronic
1058342142 9:103911427-103911449 CAATTCTTCTTAAAGAGTTATGG + Intergenic
1059049523 9:110908757-110908779 CAGTTCTTCTGAAAGGATGCTGG - Intronic
1059955751 9:119514421-119514443 TAGTCCTTCTGAAAGGGCCAGGG - Intronic
1060060294 9:120453849-120453871 CAGACCTTCTGAAAGTGGTACGG - Exonic
1062030657 9:134360479-134360501 CAGTCCTTCAGAAAGGGAAACGG - Intronic
1202802194 9_KI270720v1_random:10091-10113 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1203446753 Un_GL000219v1:63862-63884 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1187103489 X:16218567-16218589 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
1187599792 X:20815654-20815676 CCATCTTCCTGAAAGAGTGAGGG - Intergenic
1188998213 X:36912218-36912240 CAGTCTTTCTGAAACATTCAAGG - Intergenic
1189088770 X:38055247-38055269 CATTCCTTGAGAAAGAATGAAGG + Intronic
1189163148 X:38831915-38831937 CAGTGATTCTGAAAGAGTGCAGG + Intergenic
1189395952 X:40623061-40623083 CAGCGGTTCTGAGAGAGTGAAGG - Intergenic
1191013915 X:55790076-55790098 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
1191675752 X:63790733-63790755 AAGTCCTTCAGAAAGTGAGAGGG + Intergenic
1191761623 X:64653402-64653424 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1192281643 X:69693652-69693674 CAGTCTTTCCGGAAGACTGAGGG + Intronic
1192454955 X:71268760-71268782 TAGTCCCTTTGCAAGAGTGAGGG - Intergenic
1192706439 X:73531802-73531824 TAGTCCCTTTGCAAGAGTGAGGG - Intergenic
1192890223 X:75382710-75382732 CATTCCTTCTGAAAAAGTAAAGG + Intronic
1192913826 X:75633729-75633751 CAATCCTTTTGCAAGAGTGAGGG + Intergenic
1193537393 X:82731172-82731194 TAGTCCTTTTGCAAGAGTCAGGG - Intergenic
1194660999 X:96628367-96628389 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1194873482 X:99160828-99160850 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1195016779 X:100788855-100788877 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
1195290883 X:103431224-103431246 TAGTCCTTTTGCAAGAGCGAGGG + Intergenic
1195326588 X:103763454-103763476 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1195478410 X:105314871-105314893 CAGTCCCTCTGGAAAAGGGAGGG + Intronic
1196497102 X:116334652-116334674 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1197500029 X:127230922-127230944 TAGTCCTTTTACAAGAGTGAGGG - Intergenic
1198966238 X:142230894-142230916 TAGTCCCTTTGCAAGAGTGAGGG - Intergenic
1200813150 Y:7505070-7505092 TAGTCCCTTTGCAAGAGTGAGGG - Intergenic
1201937449 Y:19423470-19423492 TAGTCCTTTTGAAAGAGTGAGGG - Intergenic
1202062304 Y:20900207-20900229 TAGTCCCTTTGAAAGAGTGAGGG - Intergenic
1202076209 Y:21040299-21040321 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic