ID: 945858498

View in Genome Browser
Species Human (GRCh38)
Location 2:215094432-215094454
Sequence TGATAGGTGGACAACTTCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 97}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945858498_945858507 16 Left 945858498 2:215094432-215094454 CCACTGAAGTTGTCCACCTATCA 0: 1
1: 0
2: 0
3: 9
4: 97
Right 945858507 2:215094471-215094493 GGCAAATGGTTCTTAGACTAAGG 0: 3
1: 98
2: 113
3: 77
4: 123
945858498_945858503 2 Left 945858498 2:215094432-215094454 CCACTGAAGTTGTCCACCTATCA 0: 1
1: 0
2: 0
3: 9
4: 97
Right 945858503 2:215094457-215094479 CCCTTCCCACTCAAGGCAAATGG 0: 1
1: 11
2: 168
3: 95
4: 225
945858498_945858501 -5 Left 945858498 2:215094432-215094454 CCACTGAAGTTGTCCACCTATCA 0: 1
1: 0
2: 0
3: 9
4: 97
Right 945858501 2:215094450-215094472 TATCAATCCCTTCCCACTCAAGG 0: 1
1: 10
2: 188
3: 95
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945858498 Original CRISPR TGATAGGTGGACAACTTCAG TGG (reversed) Intronic
904863637 1:33559521-33559543 TGAGAGGTGGATAAATTCTGAGG - Intronic
906167205 1:43695533-43695555 TGAGAGGCGGACAACGGCAGAGG + Intronic
906751586 1:48267538-48267560 TGCTGGGCGGCCAACTTCAGAGG - Intergenic
909987401 1:82178588-82178610 TGGAAGGTGGATGACTTCAGAGG + Intergenic
914386037 1:147171636-147171658 TCCCTGGTGGACAACTTCAGAGG - Intronic
915049162 1:153049478-153049500 TGACAAGTGGAGAACTCCAGCGG + Intergenic
917200704 1:172511418-172511440 AAACAGCTGGACAACTTCAGGGG + Intergenic
918494369 1:185117004-185117026 TGATAGGTGGAGAATATCTGTGG + Intergenic
918674939 1:187272016-187272038 TGATACTTGGACATCCTCAGGGG + Intergenic
920418735 1:205815600-205815622 GGAAAGGTGGTCAACTTCATTGG - Intergenic
921678773 1:218007315-218007337 TTATAGGTGCACAAATGCAGTGG + Intergenic
1063477772 10:6343831-6343853 TGCTGGGTGGAGAACTGCAGTGG + Intergenic
1063524831 10:6775328-6775350 TGTGAGGTGGACAACCTCTGTGG - Intergenic
1078505749 11:11942811-11942833 TGACAGGAGTACAAGTTCAGTGG + Exonic
1081162098 11:39761581-39761603 TGATAGGGAGAAAACTTTAGCGG - Intergenic
1082662781 11:55933661-55933683 TGATATGGGGAAAATTTCAGTGG - Intergenic
1086531077 11:87785797-87785819 TGACAGGTGAACAGTTTCAGAGG + Intergenic
1092194308 12:6540159-6540181 TGATACGTGGACAAGGTGAGGGG + Exonic
1096499163 12:52054944-52054966 TGTGAGGGGAACAACTTCAGGGG - Exonic
1097518280 12:60634982-60635004 TGAGGGGTTCACAACTTCAGTGG + Intergenic
1098621178 12:72601194-72601216 TGATAGGTTTAAAACTTCAGTGG + Intronic
1099162095 12:79254776-79254798 TGAGAGGTTCAGAACTTCAGTGG + Intronic
1099927007 12:89030737-89030759 TGAGAGTTGGATAACTTCTGGGG - Intergenic
1105768565 13:23585723-23585745 TGATTGGTGGTCAACTCCAGTGG + Intronic
1107117337 13:36761379-36761401 TGATAGGTGGCCACCCTTAGAGG + Intergenic
1110779235 13:79445644-79445666 GGTTGGGTGGAAAACTTCAGTGG + Intergenic
1110963967 13:81667276-81667298 TGATATGTTGAGAACTTCTGAGG + Intergenic
1112876824 13:104052075-104052097 TGAAAGTTTGACTACTTCAGAGG - Intergenic
1114849348 14:26364611-26364633 TGTTAGGGTGACAACTGCAGAGG - Intergenic
1117782986 14:59254115-59254137 TGGTAGGGGGACATTTTCAGAGG + Intronic
1119952918 14:78764467-78764489 TGATAGGTGGGCAGCTTAACGGG - Intronic
1121312885 14:92944638-92944660 TGAAAAGGGGACAACGTCAGTGG - Intronic
1127526226 15:59794396-59794418 AGACAGGAGGACGACTTCAGAGG - Intergenic
1130756912 15:86773737-86773759 TGGTAGGTGGACAGCATCAGGGG - Intronic
1135013324 16:18903399-18903421 GGAAATGTGGGCAACTTCAGAGG - Intronic
1135584472 16:23657976-23657998 TTATAGGGGAACAACTTCTGGGG + Intronic
1138897789 16:61229646-61229668 TGGTAGGAGGGCAGCTTCAGGGG + Intergenic
1142479627 17:211036-211058 TCATAGGTGTAATACTTCAGGGG + Intergenic
1142792854 17:2281807-2281829 CGGTAGGTGGAAAACTGCAGTGG - Intronic
1144354730 17:14434464-14434486 AGATAGGAGGATAACTTCTGAGG + Intergenic
1152170475 17:78743389-78743411 TGTTAGGTAGACAGCTTCAGAGG - Intronic
1160748565 19:722960-722982 TGGGAGCTGGACAACTTCACAGG + Intronic
1164796471 19:31037527-31037549 TGGTAGGTGGACAAGTGCAATGG + Intergenic
926893809 2:17662012-17662034 TGGTAGGGGGTGAACTTCAGAGG - Intergenic
926900660 2:17748200-17748222 TGATAGGTGGATATCTTCCCAGG - Intronic
927997981 2:27499674-27499696 AGATAGGTGGACTAGTCCAGGGG + Intronic
930524769 2:52514368-52514390 TCTTATGTGGCCAACTTCAGGGG - Intergenic
931114629 2:59151237-59151259 TGATATGTGAACTACTTCAATGG + Intergenic
931180357 2:59893258-59893280 TGACAGGTGGACAAATACTGAGG - Intergenic
935229501 2:101083593-101083615 AGATAGGTAGATAACTTCATGGG - Intronic
937626120 2:124045914-124045936 TGATGAGTGCACAATTTCAGGGG - Intronic
941520279 2:166533896-166533918 TGCAAGGTGGACATCTCCAGGGG - Intergenic
944720187 2:202416128-202416150 TGATAGGTTAAAGACTTCAGTGG + Intronic
945019641 2:205557912-205557934 TCATAGATGCACAACTTCAGGGG + Intronic
945858498 2:215094432-215094454 TGATAGGTGGACAACTTCAGTGG - Intronic
1169767767 20:9166608-9166630 AGGCAGGTGGAGAACTTCAGAGG - Intronic
1180160437 21:45996751-45996773 TGCTCCGTGGACAACTCCAGCGG - Intronic
1181148871 22:20868658-20868680 TGATGGGTGGATAGATTCAGAGG + Intronic
1182767803 22:32771289-32771311 TCCATGGTGGACAACTTCAGAGG - Intronic
951484734 3:23199392-23199414 TGATACATGGAGAACTTGAGGGG + Intergenic
951813050 3:26722522-26722544 TGCTAGGTGGTCCACTTCAGGGG - Intergenic
957128927 3:76198667-76198689 TCATAGATGGCCACCTTCAGAGG - Intronic
959769163 3:110072169-110072191 TGATAGGAGGGCTACTTCATAGG - Intergenic
960533143 3:118787810-118787832 TGGTAGGTGACCAACTTCATTGG - Intergenic
960646533 3:119890961-119890983 TGAAATGTGAATAACTTCAGAGG - Intronic
963183691 3:142389354-142389376 TGAGAGGTTCAAAACTTCAGTGG - Intronic
963476819 3:145816447-145816469 AGAAAGGAAGACAACTTCAGGGG + Intergenic
963683229 3:148407650-148407672 TGAGAGATGGGCAACTTTAGTGG - Intergenic
964948776 3:162261280-162261302 TGAGGGGTGCAAAACTTCAGTGG + Intergenic
965805063 3:172533754-172533776 TGATTGGTGGAGAGCTCCAGCGG - Intergenic
965998668 3:174919593-174919615 TGAGAGGTTGAGGACTTCAGTGG - Intronic
968545097 4:1194328-1194350 CGATAGAGGGACCACTTCAGAGG + Intronic
970619750 4:17805188-17805210 TGATAGGATCACAACTTCTGAGG - Exonic
972233371 4:37100877-37100899 TGGAATGTGGACAACTGCAGAGG + Intergenic
972565953 4:40269192-40269214 TCATAGGTGGACACCCTTAGAGG - Intergenic
975900283 4:79143336-79143358 TGAGGGGTTCACAACTTCAGTGG - Intergenic
981010408 4:139919529-139919551 TGTAAGATGGACAAGTTCAGAGG + Intronic
981771320 4:148311887-148311909 AGATAGTTGTACAACTTCTGGGG - Intronic
982148648 4:152426982-152427004 TAATAGATGGACAATTTCACAGG + Intronic
987155264 5:15082676-15082698 AGATTGGTGGATAATTTCAGAGG + Intergenic
989821545 5:45799926-45799948 AGTTAGGTGTACATCTTCAGTGG + Intergenic
994269245 5:97757515-97757537 TGAGAGTTGCACACCTTCAGAGG + Intergenic
995070901 5:107920580-107920602 TCTTAGGTGGTCAACTTCAAGGG + Intronic
999956693 5:156710763-156710785 TCATAGGTGGTCATCTTTAGAGG + Intronic
1010769174 6:79808854-79808876 GGAGAGGGGAACAACTTCAGTGG + Intergenic
1011581310 6:88868731-88868753 TGATATGTGGTCAATTTCAATGG - Intronic
1016846972 6:148578198-148578220 TGATATGTATACAAATTCAGTGG - Intergenic
1023633167 7:42183500-42183522 TGAAAAGTGGACAATTTCTGGGG + Intronic
1025871053 7:65434558-65434580 AGAGAGGTGGAGAACTACAGTGG - Intergenic
1028696864 7:93723925-93723947 TGATAGGAGGACCCCTCCAGAGG - Intronic
1030432455 7:109468189-109468211 TGATTGATTCACAACTTCAGTGG + Intergenic
1030586410 7:111425042-111425064 TGACAGCTGGAAAACTACAGAGG - Intronic
1034021969 7:147654594-147654616 TGAGAGGTTCAAAACTTCAGTGG - Intronic
1034109899 7:148526879-148526901 TCATAGGTGGACACCTTTAGTGG - Intergenic
1037027013 8:14051416-14051438 GGACATGGGGACAACTTCAGTGG - Intergenic
1046532122 8:115459782-115459804 AGACATGTGGATAACTTCAGTGG - Intronic
1055567323 9:77582267-77582289 TTATAAGTTCACAACTTCAGTGG + Intronic
1056274313 9:84978344-84978366 TGATAGGGAGAAAGCTTCAGTGG + Intronic
1056640993 9:88370362-88370384 TGATAAGTGCCCAGCTTCAGTGG - Intergenic
1058909504 9:109507834-109507856 TGATAGCTGGAGAACTTCATAGG - Intergenic
1203453988 Un_GL000219v1:147929-147951 AAATAGTTGGACAAATTCAGTGG - Intergenic
1187356544 X:18578387-18578409 TGATAGGTATACAACTTGACTGG + Intronic
1189553267 X:42114881-42114903 TGACAGGTGGACAACTGAGGTGG + Intergenic
1194019273 X:88666776-88666798 TTATTTGTGGACAACTTCAGTGG - Intergenic
1195430437 X:104783217-104783239 TGATAGGAGGAGAAATTTAGAGG + Intronic
1197854005 X:130895334-130895356 TGATAGGAGGACACCTTATGGGG + Intronic
1198162089 X:134018053-134018075 AGAGAGGTGGAGAACTACAGTGG + Intergenic