ID: 945858537

View in Genome Browser
Species Human (GRCh38)
Location 2:215094703-215094725
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 11, 1: 13, 2: 6, 3: 33, 4: 169}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945858537 Original CRISPR AACCTTTCACTGCTATTCAT GGG (reversed) Intronic
900841417 1:5051517-5051539 AACCTTTCACTGTTATTTTCGGG - Intergenic
901070826 1:6517356-6517378 GACCATTCTCTGCTGTTCATGGG + Intronic
904716047 1:32468362-32468384 AATGTTTCATTGCTTTTCATTGG + Intronic
906379100 1:45320384-45320406 AACCTTTCACTGCTATTCATGGG - Intergenic
909730125 1:78879363-78879385 AACCTTTCACTGCTATTTATGGG - Intergenic
911759361 1:101598719-101598741 AACCTTTCACTGTTATTTTTAGG + Intergenic
911967577 1:104387050-104387072 AATCTTTCACTGTTATTTAAAGG - Intergenic
913305297 1:117424336-117424358 AAGCTATCACTGCAATTCCTAGG - Intronic
916636635 1:166676861-166676883 AACATTCCACTGGTATTTATTGG - Intergenic
920760797 1:208782053-208782075 CCCCTTTCACTTCTATTCAGTGG - Intergenic
920908705 1:210194170-210194192 AAACTTTCACTGTTATTCATGGG - Intergenic
921520626 1:216151081-216151103 AACCTTTCACTGTTATTTTCGGG - Intronic
922369151 1:224892122-224892144 AACCTTTCACTACTATTCATGGG - Intergenic
923075789 1:230607537-230607559 AACCTTTCACTGTTATTTTCGGG - Intergenic
923816587 1:237386172-237386194 AAACTTTCAATCTTATTCATTGG + Intronic
1063532178 10:6844146-6844168 AACCTTTCAGTGGTATTTCTAGG + Intergenic
1065610837 10:27469372-27469394 AACATTTCACTGCTATTTTCGGG - Intergenic
1065825101 10:29563597-29563619 AAGCTTGCACAGCTATTCTTAGG - Intronic
1067359388 10:45563803-45563825 AAACTTTTTGTGCTATTCATTGG - Intronic
1069336015 10:67351598-67351620 AACATTTTACAGCTATTCAGAGG - Intronic
1071187638 10:83062041-83062063 AACCTTTTACTGCCATTCGTGGG - Intergenic
1073709078 10:106018308-106018330 AACCTTTCACTGTTATTTTCGGG + Intergenic
1075804481 10:125175764-125175786 AACCTTGCCTTGTTATTCATGGG - Intergenic
1080173446 11:29334068-29334090 AACCAACCACTGCTATTTATAGG + Intergenic
1084354857 11:68631265-68631287 AACCTTTCACTGTTATTTTTGGG - Intergenic
1086005435 11:82030251-82030273 AACCTTTCACTGTTATTTTCAGG - Intergenic
1086883918 11:92181377-92181399 ATGCATTCACTGGTATTCATTGG + Intergenic
1087197548 11:95316204-95316226 AACCTTTCACTGTTATTTTCGGG - Intergenic
1087827815 11:102786383-102786405 AGCTTTGCACTGCAATTCATTGG + Intergenic
1088607916 11:111548928-111548950 AACCTTACACTACTATCCAGTGG - Intronic
1088767357 11:112996467-112996489 AACCTTTCACTGTTATAAATTGG + Intronic
1089415112 11:118282150-118282172 AAACTCTCATTGCTAATCATTGG - Intergenic
1092592362 12:9963936-9963958 TACCTTTCACTGTTATTTATGGG + Intronic
1093024757 12:14235507-14235529 AACCTTTCACTGTTATTCATGGG - Intergenic
1093359127 12:18202096-18202118 AACCTTTCACTGTTATTTTCAGG - Intronic
1093951476 12:25167993-25168015 AACCTTTCACTGTTATTTTCGGG - Intronic
1094826417 12:34272630-34272652 AACCTTTCACTGTTATTTTGGGG - Intergenic
1095806105 12:46322785-46322807 AAATTTTCACTGTTATTTATGGG + Intergenic
1096075870 12:48803990-48804012 AACCTTTCACTTAGATTCACTGG - Intergenic
1096905521 12:54932008-54932030 AACCTTTCACTGCTATTCATGGG + Intergenic
1098052055 12:66464564-66464586 AACCCATCACTGCTCTGCATGGG + Intronic
1099381903 12:81964812-81964834 AACCCTTGTATGCTATTCATGGG - Intergenic
1099424443 12:82504876-82504898 ATGCTTTCACTGCTAGGCATAGG - Intergenic
1101849398 12:108390279-108390301 AACTTTTCAGGGCTATTCAGAGG - Intergenic
1102605046 12:114061850-114061872 AACCTTTCACTGCTATTCATGGG - Intergenic
1102858822 12:116318029-116318051 AAGATTTCACAGCTATTCAAGGG - Intergenic
1103503333 12:121422558-121422580 AATGTTTTACTGCCATTCATGGG - Intronic
1104258003 12:127156628-127156650 AACCTTTCATTGCTATTCATGGG - Intergenic
1105032663 12:132894981-132895003 AACCTTTCACTATTATTTATGGG - Intronic
1109644050 13:65229375-65229397 AACATTTAATTCCTATTCATAGG - Intergenic
1109652317 13:65345208-65345230 AAGCTATTACTGCTATACATTGG + Intergenic
1112974963 13:105305784-105305806 AACCTTGCACTGACATGCATTGG + Intergenic
1114770730 14:25427030-25427052 AACCTTTCACTGCTATTCATGGG + Intergenic
1116605982 14:46996277-46996299 TACCTTTCACTGGTTTTCCTTGG - Intronic
1116842953 14:49838107-49838129 AACATTTCACTGCTATTTGCAGG + Intronic
1119248022 14:73129750-73129772 AACCTTTCACTGTTATTTATGGG + Intergenic
1120266366 14:82256203-82256225 TACTTTTCCCTGCTGTTCATGGG + Intergenic
1120579756 14:86231256-86231278 AACAGTTCACTGTTACTCATGGG + Intergenic
1121192615 14:92043597-92043619 AACCTTTCACTGTTATTTACGGG + Exonic
1121389333 14:93560950-93560972 AACCTTTCACTGTTATTTATGGG + Intronic
1122041560 14:98991334-98991356 AACCTTTCACTGTTATTTTCAGG - Intergenic
1124084921 15:26539522-26539544 AACTTTTCCCTCCTATTCCTTGG - Intergenic
1126529768 15:49699998-49700020 AACCTTTCACTGTTATTTTTGGG + Intergenic
1129261371 15:74369679-74369701 AACCTTTCCCTGTGTTTCATTGG - Intergenic
1134816836 16:17212814-17212836 TACATTTCACTGCAATTCACTGG + Intronic
1135737074 16:24940295-24940317 AACCTTACACTGCCATTGGTAGG - Intronic
1137054708 16:35738848-35738870 AATCTTTCAGTACTATTTATGGG + Intergenic
1138758442 16:59516523-59516545 AACCTTTCACTGTTATTTTCGGG + Intergenic
1140998240 16:80282106-80282128 AACCTTTAACTACTATTTGTGGG - Intergenic
1144369881 17:14579928-14579950 AACCTTTCACTTCTGTTCTCAGG - Intergenic
1152454635 17:80406653-80406675 AACCTTTCGCTGCTATTCATGGG - Intergenic
1153881286 18:9423869-9423891 AACCTTCCATTGTTATTCAGGGG + Intergenic
1154163693 18:11998327-11998349 AACCCATCACAGCTATACATAGG - Intronic
1156237810 18:35220992-35221014 AACCTTTCACTGTTATTTTCGGG - Intergenic
1156916447 18:42468216-42468238 AACCTTTCACTGTTATTTATGGG - Intergenic
1158394091 18:57066206-57066228 AACCTTTCACTGTTATTTTCGGG + Intergenic
1158819154 18:61138456-61138478 AACCCTTCAATGCTTTTCACAGG + Intergenic
1159233615 18:65641948-65641970 AACTTTTCTCTGCTTTTCAGAGG + Intergenic
1159367826 18:67492421-67492443 AAACTTTCACTGCTTCTCACTGG - Intergenic
1161836726 19:6652711-6652733 AACCAGTGACAGCTATTCATTGG - Intergenic
1162242270 19:9364840-9364862 AACCTTTCACTGTTATTTTCAGG + Intronic
1162262959 19:9547517-9547539 AACCTTTCATTGCTATTCATGGG - Intergenic
1162287509 19:9750296-9750318 AGTCTTTCACTACTATTCATGGG - Intergenic
1163899504 19:20089243-20089265 AACCTTTCACTGTTATTTTCGGG + Intronic
1164081210 19:21862903-21862925 AACCTTTCATTGCTATTCATAGG - Intergenic
1165037563 19:33044948-33044970 AACCTTTCAGGGCTACCCATGGG + Intronic
1166396961 19:42448496-42448518 AACCTTTCACTGTTATTTACAGG + Intergenic
1166532894 19:43553139-43553161 ACCCTTTCACTCCTATCTATGGG + Intronic
1167901525 19:52625753-52625775 AAACTTTCACTGTTATTTATGGG - Intronic
925375949 2:3385977-3385999 AACGTTTTACTCCTTTTCATTGG + Intronic
926024590 2:9530218-9530240 AAAATTTCACTCCTATTCATAGG - Intronic
928770433 2:34697964-34697986 AACCTTTCACTGTTATTTTCAGG + Intergenic
928778691 2:34794550-34794572 AACCTTTCACTGTTATTTTCAGG - Intergenic
930098344 2:47584281-47584303 AACCTTTCACTGCTATTCATGGG + Intergenic
930958782 2:57233731-57233753 AACCTTTCACTGTTATTTGCGGG - Intergenic
931422732 2:62143171-62143193 TGCCTTTTTCTGCTATTCATAGG - Intronic
931837285 2:66112197-66112219 ATCCTTTAAGTGCTTTTCATGGG + Intergenic
932239187 2:70143672-70143694 CACCTTTCACTGTCACTCATGGG - Intergenic
934141966 2:89055402-89055424 AACCTTTCACTGTTATTTACGGG - Intergenic
934227271 2:90145144-90145166 AACCTTTCACTGTTATTTACGGG + Intergenic
935046502 2:99488665-99488687 AACCTTTCACACATATTCTTGGG - Intronic
935759541 2:106307643-106307665 AACCTTTCACTGTTTAGCATAGG - Intergenic
938440291 2:131324322-131324344 ACACTTTCCCTGCTATTGATAGG - Intronic
940530691 2:154873006-154873028 AACCTTTCACTGTTATTTTGGGG - Intergenic
940726789 2:157343878-157343900 AACCTTTCACTGCTATTCATGGG - Intergenic
942105304 2:172628205-172628227 AACCCTTACCTGCTAGTCATAGG + Intergenic
942235674 2:173902284-173902306 AAAATTTCATTGTTATTCATTGG + Intergenic
943412301 2:187559494-187559516 AACCTTTCACTGTTATTTTCGGG + Intronic
943865783 2:192923299-192923321 AACCTTTCACTGTTATTTTCAGG - Intergenic
944251810 2:197586233-197586255 AACTTTTCACTGTTATTTATGGG - Intronic
944874351 2:203946530-203946552 AAACTTACATTGCTATTCAAAGG - Intronic
945372743 2:209040119-209040141 AACCTTTGAATACTACTCATGGG - Intergenic
945858537 2:215094703-215094725 AACCTTTCACTGCTATTCATGGG - Intronic
946475529 2:220003195-220003217 ATCCTTTCAGTGCTATCCAAAGG + Intergenic
947075713 2:226342494-226342516 AGTCTTTCAATGCTATTCTTTGG - Intergenic
947558679 2:231124875-231124897 AATCTTTCATTTCTATTCAGCGG - Intronic
949071260 2:242025920-242025942 AACTTTTTACAGCTCTTCATGGG - Intergenic
1168739714 20:177271-177293 AAACTTTCACTGTTATTTACAGG - Intergenic
1168839511 20:900240-900262 AACCATTCACTGTTATTTACAGG - Intronic
1170418209 20:16166951-16166973 AGCCTGTCACTGGTATTTATGGG - Intergenic
1177062649 21:16394338-16394360 AACCGTTCACTGCTATTCATGGG + Intergenic
1178228794 21:30756239-30756261 CTCCTTTCACTACTATTCCTTGG + Intergenic
1178814160 21:35912261-35912283 TACATTTCACTGCTATCCATTGG - Intronic
1179201357 21:39224757-39224779 AACCTTTGACGCCTCTTCATTGG - Intronic
1179243221 21:39609849-39609871 AGCCTCTCACGGATATTCATGGG - Intronic
1179902703 21:44402203-44402225 CACCTTGCACTGCTCTTCCTGGG - Intronic
1184859154 22:47163378-47163400 AACCTTTAAATGCCATTCTTAGG + Intronic
951057801 3:18168192-18168214 AACCTTTCTCAGCTATTCTCAGG - Intronic
951331937 3:21379399-21379421 AACCTTTCACTGTTATTTTTGGG + Intergenic
951762127 3:26159175-26159197 AACCTTTCACTGTTATTTTCGGG + Intergenic
952036955 3:29214318-29214340 AATTTTTCACTTCTTTTCATTGG + Intergenic
952297567 3:32074646-32074668 AACCTTTCACTGCTATTCATGGG - Intronic
952322987 3:32295549-32295571 AATCATTTACTTCTATTCATTGG - Intronic
952509547 3:34039336-34039358 ATCCTTTCCCTGCTAATAATGGG + Intergenic
953159377 3:40404335-40404357 AAGCATTAACTGTTATTCATGGG + Intronic
953834065 3:46328088-46328110 AACCTTTCATTGCTATTCATAGG + Intergenic
954756191 3:52841495-52841517 AACCTTTCCCTGGTATTCAGAGG - Intronic
956267959 3:67418798-67418820 TACCTTTAACTGTTCTTCATGGG + Intronic
958755834 3:98248266-98248288 AAGCTTTCACTGCTATTCATGGG - Intergenic
963059069 3:141210191-141210213 AAACTTTCACTGCTATTTTCAGG - Intergenic
963320442 3:143804352-143804374 AACCTTTCACTGTTATTTACGGG - Intronic
965286253 3:166824117-166824139 AAACTTTCACTGTTATTTTTGGG + Intergenic
965335776 3:167429648-167429670 AATCTTTCACTGTTATTTATGGG - Intergenic
965992836 3:174841418-174841440 AACATTTAACAGCTGTTCATGGG - Intronic
966067497 3:175834643-175834665 AACCTTTCACTGTTATTTTTGGG - Intergenic
968412341 4:401108-401130 AACCTTTCACTGCTATTCATGGG + Intergenic
969056641 4:4406725-4406747 TTCCTTTCACTGCTATTCACAGG + Intronic
969509163 4:7607807-7607829 CACCTATCTCTGCTACTCATTGG - Intronic
970819678 4:20197644-20197666 AATCTTTCACCGCTATTCATGGG - Intergenic
972969030 4:44549483-44549505 AAGCTTTCACTCCTATTTTTAGG + Intergenic
973073441 4:45894235-45894257 AACTCTTACCTGCTATTCATTGG - Intergenic
976315670 4:83656347-83656369 AACCTAGCACTGCTACTTATTGG - Intergenic
977042243 4:92029563-92029585 AACCTTTCACTGTTATTTTTGGG - Intergenic
978516724 4:109576759-109576781 AACCTTGGACTACTATTGATGGG + Intronic
979909160 4:126338799-126338821 AAGCAATCATTGCTATTCATTGG - Intergenic
980490873 4:133526583-133526605 AAACTTTCATAGCTATTCTTTGG + Intergenic
980715092 4:136617336-136617358 AATCTTTCACTGCTATTCATGGG - Intergenic
982072588 4:151708525-151708547 AACCCTACACTGCTCTCCATTGG + Intronic
983135435 4:164073679-164073701 AACCTTTAGCTGGTATTCAGAGG - Intronic
984164958 4:176295728-176295750 AACCTTTCACTGTTATTTACAGG + Intergenic
984953874 4:185026259-185026281 AACCTAGCAATTCTATTCATTGG - Intergenic
986303638 5:6499228-6499250 AGACTCTCACTGCAATTCATGGG + Intergenic
986598727 5:9449957-9449979 AAGCCTTCAATGCTGTTCATAGG + Intronic
989614171 5:43322708-43322730 AAACTTTCACTGTTATTTACGGG + Intergenic
989680561 5:44023574-44023596 CACCTCTCAATGCTATTCACTGG - Intergenic
990965288 5:61440335-61440357 AGCCTCTTAGTGCTATTCATTGG + Intronic
991451573 5:66756451-66756473 AAACTTTCACTGATGTTCAAGGG - Intronic
991480994 5:67079556-67079578 AACCTCTGACTGTTATTCACTGG - Intronic
991624178 5:68581471-68581493 AACCTGTCATAGCTATTCTTGGG - Intergenic
994325302 5:98439632-98439654 AACCTTTCATTGCTATTCATGGG - Intergenic
995124756 5:108569166-108569188 AACCTTTCACTGTTATTTTCAGG + Intergenic
995833896 5:116381564-116381586 AACCTCTCCCTGTTATTCCTGGG + Intronic
996358070 5:122618456-122618478 AACCTTTCACTGTTATTTTTGGG + Intergenic
997570831 5:134926032-134926054 AACCTATTCCAGCTATTCATCGG - Intronic
999223958 5:150004539-150004561 TACTTTTCACTTATATTCATGGG - Intronic
1000843417 5:166250377-166250399 AAACTTTTACTTCTATTCTTTGG - Intergenic
1002938468 6:1695314-1695336 ACCGTTTCAATGCTATTCATTGG - Intronic
1003778654 6:9398340-9398362 AACCTATCACCTCTGTTCATCGG + Intergenic
1006325399 6:33349892-33349914 AACCTTTCACTGTTATTTACGGG - Intergenic
1007300290 6:40862916-40862938 AACCTTTCACTGTTATTTACGGG + Intergenic
1007883462 6:45194968-45194990 AACATTACACTGCAATTTATAGG - Intronic
1008700973 6:54098914-54098936 AAGGTTTCACTGCTATTAAGTGG + Intronic
1008849822 6:56011680-56011702 AACCTTTCACTGTTATTTTCGGG + Intergenic
1009277480 6:61701711-61701733 AACATTTCACTGCTGTTTCTAGG + Intronic
1010161614 6:72862973-72862995 CTCCTTGCACTGTTATTCATAGG + Intronic
1010586050 6:77659563-77659585 AACCTTTCACTGTTATTTTTGGG + Intergenic
1011818677 6:91224343-91224365 AAACTTACATTGCTATTCACTGG + Intergenic
1012044262 6:94249220-94249242 AATCTTTAACTGCAATACATTGG + Intergenic
1014072250 6:117196359-117196381 AACTTTTCATTCCTATTTATAGG + Intergenic
1014267123 6:119292308-119292330 AACCATTCACTAATAATCATGGG + Intronic
1016205114 6:141459159-141459181 AACCTTTCACTGTTATTTCGGGG - Intergenic
1016799295 6:148152772-148152794 TACCTTACTCTGCTTTTCATGGG + Intergenic
1017018946 6:150124672-150124694 AACTTTTCACTGCTAGTTGTGGG + Intergenic
1017922119 6:158881916-158881938 AACCTTTCACTGCTATTCATGGG + Intronic
1018175902 6:161179107-161179129 AACCATTGCCTGCTATTCAGGGG + Intronic
1021122203 7:16808740-16808762 AACTTTTCACATATATTCATTGG + Intronic
1021253750 7:18363842-18363864 ATCCTTTCAATGCAAGTCATTGG - Intronic
1023101611 7:36723700-36723722 AAATTTTTACTGCTTTTCATGGG - Intronic
1027962265 7:84961004-84961026 AACTTTTAACTGCTCATCATAGG - Intergenic
1028504413 7:91555713-91555735 AAACCTTCACTCCTCTTCATGGG + Intergenic
1029317584 7:99728377-99728399 AAACTTTCATTGCTATTCATGGG - Intronic
1031860436 7:126973522-126973544 AACTTATCACTGACATTCATTGG - Intronic
1032657571 7:133948147-133948169 AATCTTCCACTGCTCCTCATTGG - Intronic
1034084428 7:148310910-148310932 AACCTTTCACTGTTATTTTCGGG + Intronic
1036908002 8:12723983-12724005 AACCTTAAATTGCTATTTATCGG + Intronic
1037034815 8:14153390-14153412 AGCCTTGCACTGGTATTCAGAGG - Intronic
1037168709 8:15863520-15863542 GACCTTTCATTGCCTTTCATTGG + Intergenic
1037799838 8:22026327-22026349 AACCATTCACTGCTAGTGACAGG + Intronic
1040639073 8:49310689-49310711 AACCCTTCACTCTTATTCAAGGG + Intergenic
1042094443 8:65197726-65197748 TTCCTTTCTCTGCTCTTCATTGG - Intergenic
1045702655 8:104884749-104884771 AGCCATTCTCTGCTATTCAAAGG + Intronic
1050149344 9:2603737-2603759 AACCTATCACTGCTCTGCAAGGG - Intergenic
1052052744 9:23866594-23866616 AACCCTTCACTGCCATGCAGAGG - Intergenic
1053307071 9:36992309-36992331 AACCTAGCAATGCTATTGATTGG - Intronic
1056324533 9:85465366-85465388 AACCTTTCACTGTTATTTTTGGG - Intergenic
1057122086 9:92585764-92585786 ATACTTTCACTGGAATTCATAGG - Intronic
1060226599 9:121795191-121795213 AACCTTTCACTGTTATTTTCGGG - Intergenic
1186391959 X:9169704-9169726 ACCCTTGCACTGCTATTTAACGG + Intergenic
1188200260 X:27287780-27287802 AACCTTTCACTATTATTTACGGG + Intergenic
1191761973 X:64656034-64656056 AACCTTTCACTGTTATTTTCGGG - Intergenic
1192137514 X:68617992-68618014 AATTTTTCACTTCTATTTATGGG + Intergenic
1192763822 X:74123101-74123123 AACCTTTCACTGCTATTGATGGG + Intergenic
1192913740 X:75633126-75633148 AACCTTTCACTGCTATTCATGGG + Intergenic
1194318863 X:92418030-92418052 AATCTTTCACTGATATATATTGG + Intronic
1195033519 X:100949191-100949213 AAACTTTCACTTCCATCCATTGG + Intergenic
1196226823 X:113177651-113177673 AGCCTTTCACTGTTATTTATGGG + Intergenic
1196525080 X:116721816-116721838 AACCTTTCACTATTATTTACGGG + Intergenic
1197887752 X:131236009-131236031 AACCATTCACTTCTCTTCCTTGG + Intergenic
1200626996 Y:5531186-5531208 AATCTTTCACTGATATATATTGG + Intronic
1201723639 Y:17131596-17131618 AATCTTTCATTGCTATACATGGG + Intergenic
1201937765 Y:19426104-19426126 AACCTTTCACTGTTATTTTTGGG - Intergenic
1202075859 Y:21037517-21037539 AACCTTTCACTGTTATTTTCAGG + Intergenic