ID: 945858876

View in Genome Browser
Species Human (GRCh38)
Location 2:215098095-215098117
Sequence CTCTCTACACAGCTCTAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 106}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945858876_945858878 -6 Left 945858876 2:215098095-215098117 CCATGTTAGAGCTGTGTAGAGAG 0: 1
1: 0
2: 0
3: 9
4: 106
Right 945858878 2:215098112-215098134 AGAGAGGTGTATGAGAGTTTAGG 0: 1
1: 0
2: 0
3: 13
4: 242
945858876_945858879 6 Left 945858876 2:215098095-215098117 CCATGTTAGAGCTGTGTAGAGAG 0: 1
1: 0
2: 0
3: 9
4: 106
Right 945858879 2:215098124-215098146 GAGAGTTTAGGTATGCCATGTGG 0: 1
1: 0
2: 0
3: 7
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945858876 Original CRISPR CTCTCTACACAGCTCTAACA TGG (reversed) Intronic
902745457 1:18470769-18470791 CTCTCGTCACTGCTGTAACACGG - Intergenic
919130855 1:193448835-193448857 CTCTCTACTCAGCTCTACCTGGG - Intergenic
1064247767 10:13682943-13682965 CTTTCTACACAGGTTTACCAGGG - Intronic
1078119353 11:8490539-8490561 CTCTCTTCACAGCTGTGAGACGG - Intronic
1079229176 11:18634641-18634663 TTCTCTACCCAGCGCTCACAAGG - Intronic
1081760193 11:45571617-45571639 CTCTCTCCTCATCTGTAACATGG + Intergenic
1082660133 11:55899269-55899291 ACCTCTACTCAGCTCTAACCAGG + Intergenic
1083207596 11:61161775-61161797 CTCTGTACACAGCTCGATCTTGG + Intergenic
1084672365 11:70614885-70614907 CTCTCCAGAAACCTCTAACACGG - Intronic
1085051387 11:73381958-73381980 CTCTCAACACAGCTCCACGAGGG - Intronic
1085123104 11:73980042-73980064 CACTCTTCACAGCTCTGACCTGG - Intronic
1085378221 11:76087742-76087764 CTCTTTACTCAGTTCTAAAATGG - Intronic
1089598555 11:119598501-119598523 CACTCTACACACCTCTTTCAGGG - Intergenic
1090446518 11:126769191-126769213 CTTTCAACACATCTCTAATATGG + Intronic
1090908139 11:131095184-131095206 CTGTCCACACATCTCTAAAATGG - Intergenic
1092372605 12:7929756-7929778 CACTCTAAAGAGCTCTAGCACGG + Exonic
1093822438 12:23637929-23637951 CTACCACCACAGCTCTAACAGGG + Intronic
1102585754 12:113921898-113921920 CTCTATAGACAGCTCTACCTGGG + Intronic
1106383817 13:29265227-29265249 CTCTTTACAAAGTTGTAACATGG + Intronic
1112186511 13:97133202-97133224 CCCTCTGCTCAGCTCTCACAGGG + Intergenic
1116700698 14:48237945-48237967 CTCTATACACAGCTCACAAATGG - Intergenic
1119069388 14:71567249-71567271 CTCTCTAGAGAGCTCTAGAATGG - Intronic
1129272535 15:74426969-74426991 ATCTCTGCACAGCTCTGCCATGG + Intronic
1129870332 15:78936124-78936146 GTCTCTACACAGCCCCAGCAGGG + Intronic
1131671688 15:94626468-94626490 CTCTCCACACACCTCTATCATGG + Intergenic
1132285388 15:100658682-100658704 CTCTCTGCACATCTAAAACAGGG - Intergenic
1132420026 15:101657530-101657552 ATTTCTACACAGCTCTATTAGGG - Intronic
1139271325 16:65686125-65686147 CTCTCTAAATAGATCTACCATGG - Intergenic
1139702954 16:68720486-68720508 AGCTCTAAACATCTCTAACAAGG + Intronic
1140190953 16:72816051-72816073 CTTTTTACATAGCTGTAACATGG - Intronic
1146981958 17:37171647-37171669 CTCTCTAAACAGCGATAAAAGGG + Intronic
1147623177 17:41881756-41881778 CTGGCTACACAGATCTACCAAGG + Intronic
1149186707 17:54006753-54006775 GTCTCTACACATCTCCAAAATGG + Intergenic
1151033025 17:70763752-70763774 CTGTCTAGCCAGCTCAAACACGG - Intergenic
1152718124 17:81909592-81909614 CTGTCTCCACAGCTATGACATGG - Exonic
1162605358 19:11702604-11702626 CTCTCTACAGAGCCCTGACCTGG + Intergenic
1165270780 19:34705879-34705901 CTCTCTTCAAAGCTCTCAGATGG + Intergenic
1167211530 19:48136798-48136820 TTCTCTAGACAGCACTACCAAGG + Intronic
925190219 2:1876455-1876477 CTCTCCACACAGCTCCTGCAGGG + Intronic
929532811 2:42763164-42763186 CTCTGCACACAGCTCTTCCATGG - Exonic
935672366 2:105566678-105566700 CTCTCTACACCGCCCCACCATGG + Intergenic
936411672 2:112263795-112263817 CTGTCTTCACAGCTGCAACAAGG + Intergenic
938196757 2:129335414-129335436 TTCTCATCACAGCTCCAACAAGG + Intergenic
938852363 2:135274502-135274524 CTGTCTACACCACTCTAAAACGG + Intronic
939171282 2:138699366-138699388 CTCTTTTCACAGCTCTACCCTGG - Intronic
942660603 2:178260529-178260551 CTCTCTAAGGAGCTCTAAGATGG + Intronic
943121272 2:183739160-183739182 TTCTCTAAACAACTCTAAGAAGG - Intergenic
945858876 2:215098095-215098117 CTCTCTACACAGCTCTAACATGG - Intronic
1170321147 20:15099395-15099417 CTCTCCACACACCTGCAACAAGG + Intronic
1171190328 20:23154432-23154454 CTCTGGACTCAGCTCTAACAAGG + Intergenic
1175669410 20:60889299-60889321 CTCTTTATGCAGCTCTGACAGGG + Intergenic
1178215814 21:30597348-30597370 CTATCTATTCAGCTCTAAAATGG + Intergenic
1178600153 21:33987716-33987738 CTCTTTTCCCAGCTCTAAAAGGG - Intergenic
1179507711 21:41852759-41852781 CTCTCCACCCAGCCCTCACATGG + Intronic
1181751052 22:24989501-24989523 GTCTCTTCACTGCTGTAACAAGG + Intronic
1182459268 22:30472413-30472435 CCCTCTACCCAGCTCTGAAAGGG + Intergenic
949410038 3:3753695-3753717 CTCCCTACAAAGCCCTTACATGG - Intronic
949541047 3:5032256-5032278 CTGTCTGCTCAGCTCTAACATGG - Intergenic
953196130 3:40735362-40735384 CTGTCTACACAACTGTAAAATGG + Intergenic
958979840 3:100708627-100708649 CTCACTACACTGCCTTAACAAGG - Intergenic
959576677 3:107941749-107941771 CTCTCTTCACAGCCTTAATATGG - Intergenic
963202354 3:142598404-142598426 GTCTTGATACAGCTCTAACATGG - Intronic
969373303 4:6747544-6747566 CTCTCTCCTCATCTCTGACATGG + Intergenic
969848836 4:9941217-9941239 CTCTCTACAGAGCCCTGAAAAGG - Intronic
970253726 4:14145059-14145081 CTCTATGCTCAGCTCTAACGTGG - Intergenic
970926787 4:21461221-21461243 CTCTCTCCACTGCTCCACCATGG + Intronic
971220877 4:24705002-24705024 CTCTCTTCACAGCTGGAAGATGG + Intergenic
972315539 4:37922437-37922459 CTCTGTACTGAGTTCTAACAGGG - Intronic
972652269 4:41029819-41029841 CTCTCTCCTCATCCCTAACATGG - Intronic
977584399 4:98759344-98759366 CTCTCTGCCCAGCTCCAACAAGG - Intergenic
978477559 4:109148031-109148053 CTTTCTACACAGTTTTAAAAGGG + Intronic
981429188 4:144640902-144640924 CTATCTACACAGCTCTACAAGGG + Intergenic
982434551 4:155368956-155368978 CTCTATACAGAGCTCTAGTAAGG + Intronic
984018712 4:174457928-174457950 CTCTCTACACAGTACTGGCATGG + Intergenic
984510244 4:180670152-180670174 CTCTCTACACACATACAACAAGG - Intergenic
984615374 4:181891014-181891036 CACTCAACACAGCTCTTAAAGGG + Intergenic
985912019 5:2892139-2892161 CTCTCTATAAAGCGCTAACTTGG - Intergenic
986269041 5:6215846-6215868 CTCCCTACACAGCCCTCAGAAGG + Intergenic
993112993 5:83682692-83682714 GTGTCTACACAGCTCAAAAAAGG + Intronic
993634203 5:90324875-90324897 CTCTCTACCCATCTCTTCCAGGG + Intergenic
995257168 5:110060077-110060099 CTCTAATCACAGCTGTAACAAGG + Intergenic
996786153 5:127238546-127238568 CTCTGTCCACATCTGTAACATGG - Intergenic
1202775133 5_GL000208v1_random:62843-62865 CTCTCTTCAAAGCTCAGACAGGG + Intergenic
1003398150 6:5770743-5770765 TTCTCTACACAGCACATACACGG + Intronic
1003897891 6:10624706-10624728 GTGTCCACACAGCTCTAAGATGG - Intronic
1007934609 6:45721795-45721817 CTCTGTTCAAAGCTCTAATAGGG + Intergenic
1008233821 6:49019088-49019110 CTCTCTGCACACCTGTAACATGG - Intergenic
1010360485 6:74987362-74987384 CTCTTCTCACAGCTCTACCAGGG - Intergenic
1010641936 6:78339820-78339842 CTCCCTCCACTACTCTAACAGGG - Intergenic
1011207810 6:84919463-84919485 CTCTCTCCTCAGCTCTATAATGG - Intergenic
1012230903 6:96760571-96760593 CTCTCCAGACAGCAGTAACATGG - Intergenic
1012531397 6:100241811-100241833 CTGTCTTCTCATCTCTAACATGG + Intergenic
1012961636 6:105628456-105628478 CTCTCTACACTGCTTTCTCAAGG + Intergenic
1015071782 6:129103154-129103176 CTCTCTTGATAGCTCTCACATGG + Intronic
1021036163 7:15801746-15801768 CTCTTAGCACAGCTCTTACAAGG + Intergenic
1021744571 7:23725856-23725878 CTTTTTATACAACTCTAACAAGG + Intronic
1021909556 7:25370455-25370477 CTATCTACTCAACACTAACAGGG - Intergenic
1022570357 7:31447056-31447078 CTATCTATACAGCTGTTACACGG - Intergenic
1023886364 7:44360067-44360089 CTTTATCCACACCTCTAACAAGG - Intergenic
1024191929 7:47020923-47020945 CTCACCACACATCTCGAACATGG - Intergenic
1024480234 7:49855085-49855107 CTATCTTCACAGCTGTACCAAGG - Intronic
1033795051 7:144836235-144836257 CTCTGCACTCAGCTTTAACAAGG + Intronic
1035933306 8:3808924-3808946 CCCTCTACATAGCACTAACACGG - Intronic
1040542376 8:48371999-48372021 CTGACTACACAGCTTTAACTTGG - Intergenic
1046116959 8:109796312-109796334 ATATCTACCCAGCTCTGACACGG - Intergenic
1048021356 8:130542217-130542239 CTGTCTGCACAGCCCTAACATGG + Intergenic
1051517862 9:17950967-17950989 CTCTCTAGACAGCTCTCTCTAGG - Intergenic
1056402582 9:86242284-86242306 CTCTCTGCAAGGCTCTAAGAAGG - Intronic
1058566380 9:106289565-106289587 CTCTCCACACTCCTCAAACATGG - Intergenic
1185699376 X:2218919-2218941 CTCTCCACACAGCTCCCCCAGGG + Intergenic
1191679764 X:63829165-63829187 CTCTCTACACTGTGCTAACTGGG + Intergenic
1194262366 X:91712411-91712433 CTTCCTGCACAGCTTTAACATGG + Intergenic
1195927070 X:110037098-110037120 CTCTCTCTACGGCTCTACCAGGG - Intronic
1197043443 X:121968493-121968515 CTCTCTAGACAATTTTAACAAGG + Intergenic
1200581657 Y:4957246-4957268 CTTCCTGCACAGCTTTAACATGG + Intergenic
1201418821 Y:13776100-13776122 CTCTCTTCACAGCTGTCAGACGG + Intergenic