ID: 945864361

View in Genome Browser
Species Human (GRCh38)
Location 2:215160423-215160445
Sequence GTCCAGCAGGAAAAAGTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945864361_945864366 17 Left 945864361 2:215160423-215160445 CCAACAACTTTTTCCTGCTGGAC No data
Right 945864366 2:215160463-215160485 CAAAGTACATATCATTAGGTAGG No data
945864361_945864365 13 Left 945864361 2:215160423-215160445 CCAACAACTTTTTCCTGCTGGAC No data
Right 945864365 2:215160459-215160481 ACAGCAAAGTACATATCATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945864361 Original CRISPR GTCCAGCAGGAAAAAGTTGT TGG (reversed) Intergenic
No off target data available for this crispr