ID: 945881416

View in Genome Browser
Species Human (GRCh38)
Location 2:215328538-215328560
Sequence ACCAGGACGGTGAAGGGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 286}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945881416_945881420 -8 Left 945881416 2:215328538-215328560 CCTCTGCCCTTCACCGTCCTGGT 0: 1
1: 0
2: 1
3: 24
4: 286
Right 945881420 2:215328553-215328575 GTCCTGGTTTCTTGTTATTCAGG 0: 1
1: 0
2: 0
3: 11
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945881416 Original CRISPR ACCAGGACGGTGAAGGGCAG AGG (reversed) Intronic
900991306 1:6099603-6099625 ACCAGCTCGGTGCAGAGCAGCGG - Exonic
901674725 1:10876432-10876454 ACCATGAAGCTGAAAGGCAGAGG - Intergenic
902217924 1:14946138-14946160 ACAATGACAGTGAAGAGCAGTGG - Intronic
902675541 1:18006191-18006213 ACCAGGCTGGTGAGGGGCAGTGG - Intergenic
902715508 1:18270013-18270035 AGCATGAGGGTGAAGGGCGGTGG - Intronic
904602696 1:31682615-31682637 ATCAGGAAGTTGAAGGCCAGAGG - Intronic
904773468 1:32893621-32893643 ACAACGACGGTGAGGGGCAGGGG + Exonic
905945354 1:41897159-41897181 ACGAGAATGGTGAAGGTCAGTGG + Intronic
906241416 1:44244630-44244652 ACAAGGAGGCTGAAGGGGAGGGG - Intronic
906545307 1:46616065-46616087 GCTAGGACGGGGAACGGCAGTGG - Intronic
907121620 1:52013068-52013090 AACTGGAAGGTGGAGGGCAGAGG - Intergenic
907329114 1:53659943-53659965 GCCAGGAGGGAGCAGGGCAGGGG - Intronic
907580766 1:55570555-55570577 ACCAACACGCTAAAGGGCAGTGG - Intergenic
910826892 1:91418675-91418697 AGCAGGGAGGTGAAGGGGAGGGG + Intergenic
911667454 1:100569677-100569699 AGCAGGAAGGTAAAGGGCATAGG - Intergenic
915293447 1:154902207-154902229 ACTAGGATGGTGGAGGGAAGGGG + Intergenic
915725493 1:158014158-158014180 ACGAGGAAGGTAAAGGGAAGGGG + Intronic
916544198 1:165786416-165786438 CCCAGGACCCTGCAGGGCAGTGG + Intronic
916671498 1:167025828-167025850 GCCAGGAAGGGGAAGGGCATGGG + Intergenic
918086279 1:181247889-181247911 AACAGGAGGGTGAGGGGCTGTGG - Intergenic
920268597 1:204745615-204745637 ACCAGGAAGGTCTAAGGCAGAGG + Intergenic
921480645 1:215661209-215661231 ACCAAGCCAGAGAAGGGCAGAGG - Intronic
922748852 1:228061491-228061513 CCCAGGGCCGTGATGGGCAGGGG + Intergenic
923978846 1:239297303-239297325 GCCAGGAAGGAGAGGGGCAGGGG - Intergenic
1062848515 10:726021-726043 ACCAGGACAGTGAAAGGCTGAGG - Intergenic
1063138189 10:3235130-3235152 ATGAGGACAGTGAGGGGCAGAGG + Intergenic
1063225743 10:4013334-4013356 GGGAGGACGGTGAAGGGGAGGGG - Intergenic
1064206136 10:13325482-13325504 AGCAGGACAGAGAAGAGCAGGGG - Intronic
1064778597 10:18807976-18807998 ACAAGGACAGTGAAGGGATGGGG - Intergenic
1069041971 10:63705255-63705277 ACCAGGCTGGTGAAGTGCAGTGG + Intergenic
1069815551 10:71191591-71191613 GCCAGGAGGGTGAGGGGCAGGGG + Intergenic
1070327301 10:75397140-75397162 ACCCGGACGGGGAAAAGCAGCGG + Intergenic
1070357950 10:75658900-75658922 CCCAGGACTGGGAAGGACAGGGG - Intronic
1072662300 10:97370441-97370463 ACCAGGAAGGTGAGGCCCAGGGG - Exonic
1073290030 10:102408932-102408954 ACCAGGTCGGTGTAGAGCACGGG + Intronic
1073332292 10:102678232-102678254 AGCAGCAGGGGGAAGGGCAGAGG + Intronic
1073425304 10:103452221-103452243 AGGAGGGCGGTGCAGGGCAGCGG + Exonic
1074769587 10:116724705-116724727 CCCAGGACAGTGTGGGGCAGAGG + Intronic
1074908639 10:117887145-117887167 CCCAGGAGGGAGAAGGGGAGAGG - Intergenic
1076594046 10:131614043-131614065 TGCAGGACAGTGCAGGGCAGTGG - Intergenic
1076618624 10:131772656-131772678 AACAGCACGTTGAAGTGCAGTGG + Intergenic
1076890486 10:133280880-133280902 GCCAGGGCGGTGCTGGGCAGGGG + Intronic
1076890508 10:133280950-133280972 GCCAGGGCGGTGTTGGGCAGGGG + Intronic
1076890522 10:133281004-133281026 GCCAGGGCGGTGCTGGGCAGGGG + Intronic
1076890565 10:133281144-133281166 GCCAGGGCGGTGTTGGGCAGGGG + Intronic
1076890579 10:133281198-133281220 GCCAGGGCGGTGCTGGGCAGGGG + Intronic
1077233541 11:1469205-1469227 ACCAGCACGGGGAGAGGCAGGGG + Intergenic
1077485738 11:2837653-2837675 ACCAGGAGGGGGAAGGGAGGGGG + Intronic
1077863000 11:6199623-6199645 ACCAGGACAGGGTAGTGCAGTGG - Exonic
1078360149 11:10661690-10661712 GGCAGGACGGTGAAAGTCAGAGG - Intronic
1078542175 11:12221539-12221561 GCCAGGACTGTGCAGGGCACTGG - Intronic
1083631210 11:64096453-64096475 CCCAGGATGATGAAGTGCAGTGG + Intronic
1084537076 11:69763625-69763647 ACCAGCTGGGTGAAGTGCAGGGG + Intergenic
1084742993 11:71151100-71151122 ACCTGGATGGTGAGGGGCAGTGG - Intronic
1085037838 11:73310382-73310404 TCCTGGACGATGAGGGGCAGCGG - Exonic
1086308551 11:85509473-85509495 ACCAGGACGGTGGAGGGCTCTGG + Intronic
1086360006 11:86048792-86048814 CCCAGGAGGCTGAAGTGCAGTGG - Intronic
1086918835 11:92562666-92562688 AACTAGAGGGTGAAGGGCAGGGG + Intronic
1089284388 11:117396214-117396236 ACCAGGATGGTGTGGGGCATTGG + Intronic
1089625833 11:119750259-119750281 GCCAGGCCTGTGAAGGGCACAGG + Intergenic
1089681464 11:120121267-120121289 AGCATGACTGCGAAGGGCAGAGG - Intronic
1089695410 11:120213133-120213155 GCCAGGACAGTGAAAGGCAATGG + Intronic
1090817453 11:130311457-130311479 CCCAGGACGTTGAAAGGCCGAGG - Intronic
1093860234 12:24156310-24156332 GGCAGGACAGGGAAGGGCAGAGG - Intergenic
1096312423 12:50532926-50532948 ACCAGCCCGGTGAGGGCCAGAGG - Intronic
1097184563 12:57189672-57189694 GCCAGAATGGTGAGGGGCAGAGG + Intronic
1101874946 12:108591773-108591795 GCCAGGATGGTGGAGGGCAGGGG - Exonic
1103861802 12:124021227-124021249 ACCAGCACAGGGCAGGGCAGAGG + Intronic
1104750233 12:131233694-131233716 CCAAGGAGAGTGAAGGGCAGAGG + Intergenic
1104782481 12:131430767-131430789 CCAAGGAGAGTGAAGGGCAGAGG - Intergenic
1107093904 13:36514577-36514599 ACCAGGAAAGAGAAGAGCAGAGG - Intergenic
1111655281 13:91144033-91144055 ACCAGGAAGATAAAAGGCAGTGG + Intergenic
1113966678 13:114156463-114156485 ACCAGGACTGGGAAGGGCGAGGG - Intergenic
1116224163 14:42126840-42126862 ATCAGGAAAGTGAAGGCCAGAGG + Intergenic
1118473892 14:66099627-66099649 ACCAGCTCAGTGGAGGGCAGGGG - Intergenic
1118633490 14:67726730-67726752 AGCAGGTGGGTCAAGGGCAGAGG + Intronic
1119766027 14:77188082-77188104 ACCAGGACTGGGATGGGGAGAGG - Intronic
1119860234 14:77930930-77930952 ACCAGGTAGGTCAAGGGCTGTGG + Intronic
1122737235 14:103849724-103849746 TCCAGGAAGATGGAGGGCAGGGG - Intergenic
1122758861 14:104005344-104005366 ACCAGGCGGGGAAAGGGCAGTGG - Exonic
1123760005 15:23424668-23424690 AGGAGGAAGGTGCAGGGCAGTGG + Intergenic
1125507642 15:40276228-40276250 CCCAGTAGGCTGAAGGGCAGAGG - Exonic
1125759993 15:42089717-42089739 ACAAGACAGGTGAAGGGCAGAGG + Intronic
1126852680 15:52806459-52806481 AGCAGTAGGGTGAAGGGCAACGG + Intergenic
1127588164 15:60397700-60397722 GCCGGGAGGGTGCAGGGCAGAGG - Intronic
1127988796 15:64096056-64096078 TCCAGGCCGGGGAAGGGCGGAGG - Exonic
1128806420 15:70534338-70534360 AAGAGGAAGGTGAAGGGGAGGGG + Intergenic
1129651011 15:77489721-77489743 GCCAGCCCGGTGAAGGGCTGAGG + Intergenic
1130550652 15:84888333-84888355 ACAAGGGCAGTGAAGGGGAGGGG - Intronic
1132024393 15:98392481-98392503 CCCAGGCCGGTGGAGTGCAGTGG - Intergenic
1132554167 16:565367-565389 CCCAGGCAGGTGAGGGGCAGGGG - Exonic
1132839955 16:1974110-1974132 ACCAGCCTGGGGAAGGGCAGTGG + Intronic
1132885845 16:2181631-2181653 ACCAGGAGGCGGAGGGGCAGGGG + Intronic
1132933381 16:2469687-2469709 ATCAGGAAGCTGAGGGGCAGGGG + Intergenic
1133027994 16:2996970-2996992 ACCAGGAAGGGGCAGGGCTGGGG + Intergenic
1133848934 16:9483636-9483658 ACCAGGATGGAGAAGAGCTGGGG + Intergenic
1134456335 16:14398212-14398234 AGGAGGAAGGTGCAGGGCAGTGG - Intergenic
1134915044 16:18062382-18062404 AACAGTTCGGTGAGGGGCAGGGG + Intergenic
1137031234 16:35526471-35526493 AGCAAGAGGGTCAAGGGCAGCGG - Intergenic
1138439747 16:57026876-57026898 GCCAGGTCGGTGCAGGTCAGTGG - Exonic
1138445017 16:57058254-57058276 ACAAGGACTGTGGAGGGCAAGGG + Intronic
1139656175 16:68388387-68388409 AGCAAGAGGGTGAAGGACAGAGG - Intronic
1141285112 16:82664112-82664134 ACAAGGACAGTGAAGGGTTGAGG + Intronic
1142808593 17:2384860-2384882 ACAGGGACGGGGAGGGGCAGCGG + Exonic
1143954636 17:10658745-10658767 ACCTGGAGGGAGAGGGGCAGTGG - Intergenic
1144753835 17:17667846-17667868 AGCAGGAAGGAGAAGGGCAGGGG + Intergenic
1144819045 17:18058624-18058646 ACAAGGCAGGTGTAGGGCAGTGG + Intronic
1146212034 17:30950331-30950353 ACCCGCATGGTGTAGGGCAGAGG + Intronic
1146887535 17:36482710-36482732 GCCAGGAGGGTGGAAGGCAGCGG + Intergenic
1148763451 17:50021751-50021773 TGCAGGACAGTGCAGGGCAGTGG - Intergenic
1148875359 17:50683928-50683950 ACCTGGGCGGAGAAGGGAAGGGG - Exonic
1150212026 17:63446711-63446733 ACCAAGCCGGGGAAGGGCGGCGG - Intergenic
1150892881 17:69174723-69174745 ACCAGTATGCTGAAGGCCAGAGG + Exonic
1154150438 18:11902318-11902340 ACCAGTATGGTGAAGGGCCTGGG + Intronic
1154999261 18:21670653-21670675 ACCAGGCAGGTGAAGGTCACAGG - Intronic
1156977767 18:43245512-43245534 ACTAGGATGGAGATGGGCAGTGG - Intergenic
1157370861 18:47110028-47110050 AGGAGAAAGGTGAAGGGCAGAGG - Intronic
1157779618 18:50426072-50426094 ACCAGGAGGTTGGAGTGCAGTGG - Intergenic
1158932168 18:62333046-62333068 AGCTGGAGGGAGAAGGGCAGAGG + Intronic
1160190676 18:76711935-76711957 AGCAGGGCCCTGAAGGGCAGGGG - Intergenic
1160362959 18:78299354-78299376 ACCAGAAGGGTAAAGGGCTGAGG + Intergenic
1161330292 19:3683717-3683739 GCCAGGCGGGGGAAGGGCAGAGG + Intronic
1162804715 19:13131370-13131392 ACCAAGATGGTCAAGGGAAGAGG - Intronic
1163695413 19:18761138-18761160 ACCAGGGCAGGGCAGGGCAGGGG - Intronic
1164540353 19:29117407-29117429 CCCAAGGCGCTGAAGGGCAGGGG + Intergenic
1167698944 19:51031016-51031038 TACAGGTCGGTGAGGGGCAGGGG - Intronic
1168355053 19:55695455-55695477 CCCAGGAAGGGGAAGGGCACTGG - Intronic
1168549443 19:57280759-57280781 CCCAGGACAGAGAAGGGCTGTGG + Exonic
1168553702 19:57320779-57320801 CCCAGGACAGAGAAGGGCTGGGG + Exonic
925288814 2:2732920-2732942 GTCAGGACCGGGAAGGGCAGAGG + Intergenic
925298211 2:2792335-2792357 CCCAGGAGGGTGACGGGCATGGG - Intergenic
925896121 2:8473599-8473621 ACCAGGAAGGTGTGTGGCAGTGG - Intergenic
926370270 2:12171882-12171904 AGGAGGACCGGGAAGGGCAGGGG - Intergenic
927844875 2:26466157-26466179 CCTATGACAGTGAAGGGCAGGGG + Intronic
929774275 2:44918513-44918535 AAGAGGAAGGTGAAGGACAGTGG - Intergenic
930319721 2:49839188-49839210 AGGAGAAAGGTGAAGGGCAGTGG - Intergenic
931236176 2:60414136-60414158 AGGAGGAGGGGGAAGGGCAGGGG - Intergenic
932303509 2:70685451-70685473 ACCAGGACTGTGAGGGGCAGTGG - Intronic
932306998 2:70711131-70711153 ACCAGGATGCTGAAGATCAGAGG + Intronic
932319312 2:70809376-70809398 ACCAGGCCTGAGTAGGGCAGGGG + Exonic
935218716 2:100994179-100994201 CCCAGGACAGGGAAGGGCTGGGG - Intronic
936582634 2:113716738-113716760 AGCAGGGCAGGGAAGGGCAGGGG + Intronic
938685913 2:133737475-133737497 ACCAGGAGTGAGAAGGTCAGGGG - Intergenic
939152849 2:138493625-138493647 ATAAGGACAGAGAAGGGCAGGGG + Intergenic
939829631 2:147056634-147056656 AGCAGGACAAGGAAGGGCAGGGG - Intergenic
941866166 2:170336968-170336990 ACCATGAAGTTGAAGGTCAGGGG + Intronic
942880068 2:180848971-180848993 ACCAAGCCGGTGAAGGGCCTGGG + Intergenic
945881416 2:215328538-215328560 ACCAGGACGGTGAAGGGCAGAGG - Intronic
946396914 2:219447944-219447966 ACCAAGATGGAGAAGGGTAGAGG - Intronic
947724332 2:232387859-232387881 ACCAGAAAGGCGAAGGGAAGAGG - Intergenic
947752086 2:232538456-232538478 AACAGGAGGGTGGAGGGTAGGGG + Intergenic
947971284 2:234327547-234327569 ACCATGAGCATGAAGGGCAGGGG + Intergenic
948123367 2:235547140-235547162 ACCAGGGAGGTGACGGGCAGTGG + Intronic
948429867 2:237912421-237912443 AGCAGGGAGGTGACGGGCAGAGG - Intergenic
948826877 2:240577260-240577282 ACCAGGACGCTGAAGGCCCAGGG - Intronic
948879666 2:240850383-240850405 GCCAGGGCAGTGAAGGGCGGTGG + Intergenic
948879681 2:240850427-240850449 GCCAGGGCAGTGAAGGGCGGTGG + Intergenic
948879696 2:240850471-240850493 GCCAGGGCAGTGAAGGGCGGTGG + Intergenic
948916719 2:241038034-241038056 ACCAGGTGGGTGAAGGGCATGGG - Intronic
1168798609 20:629222-629244 AGGAGGACGGTGAAGGACAAGGG + Intergenic
1168892953 20:1306427-1306449 GACAGGATGGTGCAGGGCAGGGG - Exonic
1169550547 20:6697431-6697453 AGCAGGACAAAGAAGGGCAGAGG - Intergenic
1171532005 20:25859184-25859206 ACCAGGGCGGTGGAGGGTTGGGG - Intronic
1171806950 20:29688962-29688984 ACCAGGGCGGTGGAGGGTTGGGG + Intergenic
1174484213 20:50851303-50851325 ACCACGACTGTGGAGGGCCGAGG + Intronic
1175202866 20:57290088-57290110 ACCAGGAAGGAGCCGGGCAGAGG + Intergenic
1175958375 20:62622857-62622879 ACCAGGACTGTGAGGAGCAGGGG - Intergenic
1176215012 20:63943899-63943921 ACCAGGATGTTGAAGGCCTGAGG - Intronic
1176268334 20:64222302-64222324 AGCAGGACAGAGCAGGGCAGGGG + Intronic
1180161716 21:46001177-46001199 GCCAGGGCGGTGGAGGGGAGGGG + Intronic
1180338858 22:11601537-11601559 ACGAGGACGGTGAAGGAGACTGG - Intergenic
1180712905 22:17851912-17851934 ACGTGGCGGGTGAAGGGCAGAGG + Intronic
1181668632 22:24415106-24415128 ACTAGGACGGTGAAGGGCCCAGG - Exonic
1181696028 22:24593131-24593153 ACCCGGACGGGGCAGGGCCGCGG - Intronic
1182831744 22:33309808-33309830 CACAGGACGGTGAGGGGCAGGGG + Intronic
1183198299 22:36368524-36368546 ATCAGGAAGGAGAAGCGCAGAGG + Intronic
1183897013 22:40977562-40977584 CCCAGGAGGCTGAAGTGCAGTGG + Intergenic
1184300066 22:43553490-43553512 CCGAGGACGGTGAAGGGCTGGGG + Intronic
1184390529 22:44200876-44200898 TCCAGGAAGGTTAAGGGGAGCGG - Intronic
1184496669 22:44846258-44846280 ACCAGAAAGGTGCAGGGCTGAGG - Intronic
1185085136 22:48736825-48736847 TCCAGGACGGAGATGGGGAGTGG + Intronic
950460728 3:13120786-13120808 ACCATGACAGAGAGGGGCAGGGG + Intergenic
952203316 3:31152787-31152809 ACCAGGAGGCTGGAGTGCAGTGG - Intergenic
952703458 3:36350720-36350742 CCCAGGATGGTGGAGTGCAGTGG - Intergenic
952774658 3:37033127-37033149 AGCAGGACGGGGAAGGGAGGCGG - Intronic
953881924 3:46695103-46695125 AACAGGGCTGTGAAGGGGAGTGG - Intergenic
961723671 3:128911998-128912020 AACAGGACTGTGAGGGTCAGAGG - Intronic
962134903 3:132722644-132722666 AGCAGGACGGGGCGGGGCAGCGG + Intergenic
962742730 3:138373996-138374018 ACCAGGTTGGTGGAGTGCAGTGG + Intronic
962849956 3:139300982-139301004 ACCAGGTTGGGGAGGGGCAGGGG + Intronic
963194743 3:142514377-142514399 ACCAGTACTTTGAGGGGCAGAGG + Intronic
963963566 3:151338739-151338761 AACAGGACAGTGTAGAGCAGTGG + Exonic
966135728 3:176696020-176696042 ACCAGTGGGGTGGAGGGCAGGGG + Intergenic
967294585 3:187952772-187952794 ACCAGGACAGTGAAAGAAAGGGG - Intergenic
970676399 4:18455183-18455205 ATCAGGAGGGGCAAGGGCAGTGG - Intergenic
971029184 4:22618802-22618824 ACCAAAACGGTGAAGATCAGAGG - Intergenic
971655583 4:29340220-29340242 ACCAGGGCTGGGAAGGGTAGTGG - Intergenic
972641843 4:40932637-40932659 CACAGGAGGGTGAAGGGGAGGGG + Intronic
972802196 4:42488685-42488707 ACCAAGATTGTGAAGGGCACTGG - Intronic
974293667 4:59966894-59966916 ACCAGCATGGTGAAAAGCAGAGG - Intergenic
974295407 4:59992908-59992930 ACCAGGCTGGGGAAGGACAGTGG - Intergenic
977666237 4:99649937-99649959 CCCTGTAGGGTGAAGGGCAGCGG + Exonic
981010705 4:139922055-139922077 GCCAGGTCTGTGGAGGGCAGAGG + Intronic
981750726 4:148090666-148090688 ACCAGAACGGAGAGGGGCTGGGG + Intronic
983891751 4:173036883-173036905 ACCACTGAGGTGAAGGGCAGAGG + Intronic
985673479 5:1218374-1218396 GCCAGGACCGTGATGGGCCGGGG + Intronic
986688485 5:10294688-10294710 ACCAGGACGGTGATGGTGAGAGG + Intronic
990041161 5:51380186-51380208 ACCAAGACTGGGAAGGGAAGAGG - Intergenic
990131495 5:52591342-52591364 AATAGGAAGGTGAAAGGCAGAGG + Intergenic
991021665 5:61985698-61985720 ACCAGGATGTTGTAGGGAAGAGG - Intergenic
991361869 5:65829205-65829227 TCCAGGACTGTGGAGGACAGGGG - Exonic
998005073 5:138651389-138651411 TGCAGCACGGTGAAGGGCAGTGG + Intronic
998143429 5:139712225-139712247 ACCAGCACGGTTTAGGGGAGTGG - Intergenic
999072948 5:148766991-148767013 ACCAGGAGAGCGAAGGGCACTGG - Intergenic
999129822 5:149273761-149273783 ACTAGGAGTGTGAAGGGGAGGGG - Intronic
1000338814 5:160261354-160261376 TACAAGACAGTGAAGGGCAGAGG + Intronic
1001085676 5:168698696-168698718 ACCTGGTGGGTGAAGGGGAGTGG - Intronic
1002133622 5:177095649-177095671 ACCAGGACTGGGAAGGAGAGCGG - Exonic
1002421758 5:179152645-179152667 AACAGGACTGTGAAGTCCAGGGG - Intronic
1003125854 6:3355520-3355542 AACAGGACGTTGCTGGGCAGAGG + Intronic
1003206939 6:4021365-4021387 TCCCGGACGGTGGAGGGTAGGGG - Exonic
1005705048 6:28443264-28443286 GCCGGGCAGGTGAAGGGCAGAGG - Intronic
1010003000 6:70967198-70967220 ACCAGGATGTCCAAGGGCAGGGG - Intergenic
1010175309 6:73021042-73021064 ACCAAGATGGTGAAGGGAAGTGG - Intronic
1012457083 6:99419108-99419130 CCCAGGCTGGTGGAGGGCAGTGG - Intronic
1013525089 6:110966556-110966578 ACCAGGAAGGTGAAGATCATTGG + Intronic
1014709862 6:124794270-124794292 TCCAGGTCGGAGAGGGGCAGGGG - Intronic
1015754245 6:136591699-136591721 AAAAGGAGGGTGAAGGGCAAAGG - Intronic
1016800852 6:148167606-148167628 ACCAAAACAGGGAAGGGCAGAGG - Intergenic
1017247289 6:152240126-152240148 ACCAGGACAAGGGAGGGCAGAGG + Intronic
1018230057 6:161666713-161666735 TTCAGGACAGTGAGGGGCAGAGG - Intronic
1018947367 6:168356946-168356968 CCCAGGACGGTGCCTGGCAGGGG + Intergenic
1018947499 6:168357386-168357408 CCCAGGACGGTGCCTGGCAGGGG + Intergenic
1018947532 6:168357496-168357518 CCCAGGACGGTGCCCGGCAGGGG + Intergenic
1018947582 6:168357660-168357682 CCCAGGACGGTGCCCGGCAGGGG + Intergenic
1018947631 6:168357825-168357847 CCCAGGACGGTGCCTGGCAGGGG + Intergenic
1018947772 6:168358264-168358286 CCCAGGACGGTGCCCGGCAGGGG + Intergenic
1018947822 6:168358429-168358451 CCCAGGACGGTGCCTGGCAGGGG + Intergenic
1018947977 6:168358923-168358945 CCCAGGACGGTGCCCGGCAGGGG + Intergenic
1019429417 7:991862-991884 ACCAGGAAGGAGAAGGACTGGGG - Intergenic
1019526469 7:1482632-1482654 ACCAGGAAGGCGGTGGGCAGTGG + Exonic
1020787614 7:12590635-12590657 AACAGGAAGGAGAGGGGCAGAGG + Intronic
1023783400 7:43680716-43680738 CCCAGCACTGTGAGGGGCAGAGG + Intronic
1023843010 7:44107270-44107292 AGCAGGATGCTGAAGGCCAGAGG + Intronic
1024171331 7:46791045-46791067 ACAAGGAGGGTGAAGGGAAGAGG + Intergenic
1024254758 7:47532175-47532197 ACCAGGGCCTTGAATGGCAGCGG + Intronic
1024256968 7:47546481-47546503 CCCAGGACGGTGAGGTGCTGAGG + Intronic
1025201215 7:56963002-56963024 AGCAGGGTGGAGAAGGGCAGGGG - Intergenic
1025284693 7:57652041-57652063 ACCAGGGCGGTGGAGGGTTGGGG - Intergenic
1025670729 7:63613931-63613953 AGCAGGGTGGAGAAGGGCAGGGG + Intergenic
1026441019 7:70444160-70444182 ACCAGGAGGGTCATGAGCAGAGG + Intronic
1029281609 7:99439161-99439183 TCCATGCCGGGGAAGGGCAGCGG - Exonic
1032279164 7:130486931-130486953 ACCAGGGCGGAGAGCGGCAGTGG + Intronic
1033200052 7:139360360-139360382 ACGGGGACGGCGAAGGGAAGGGG + Intronic
1034455755 7:151168683-151168705 ACGAGGACGGGAAAGGGAAGAGG - Intronic
1034959445 7:155355862-155355884 ACCAGGACGGCGGAGGGGAAAGG + Intergenic
1035600782 8:895749-895771 TCCAGGTCGGTGTGGGGCAGTGG + Intergenic
1035722001 8:1799138-1799160 GCCAAGACAGTGAAAGGCAGAGG - Intergenic
1037583596 8:20261451-20261473 ACCAGGACGGGGAGGGGCCCGGG + Intronic
1040433904 8:47370994-47371016 ACCAGCACAGTGGAGGTCAGAGG - Intronic
1041777966 8:61545043-61545065 ATGAGGATGGTAAAGGGCAGTGG + Intronic
1042159968 8:65882525-65882547 ACCAGGACTGTGTAGGTAAGGGG + Intergenic
1042370392 8:67984878-67984900 ACCAGGACGGAGAGGGAGAGGGG + Intronic
1042533283 8:69835146-69835168 GCCACGCAGGTGAAGGGCAGCGG - Intergenic
1042590568 8:70393874-70393896 GCCTGGACGTTGAAGGGCATTGG - Intronic
1043232311 8:77818513-77818535 ACCATTACAGTGAAGTGCAGTGG + Intergenic
1044905419 8:96995946-96995968 ACCAGAACTTTAAAGGGCAGAGG + Intronic
1045703356 8:104892751-104892773 CCCAGGACCATGAAGGGAAGAGG - Intronic
1046365530 8:113226001-113226023 AGCAGGAAGGAGAAGTGCAGTGG - Intronic
1046830492 8:118740543-118740565 ACCAGCACACTGAAAGGCAGGGG - Intergenic
1047569615 8:126083633-126083655 ACCTGGGAGGTGAAGGGCATAGG + Intergenic
1048223773 8:132566086-132566108 CACAGCATGGTGAAGGGCAGGGG - Intergenic
1048279636 8:133095526-133095548 TCCAGGACCGTGGTGGGCAGGGG + Intronic
1048579597 8:135720090-135720112 ACCAGGCAGGGGCAGGGCAGTGG - Intergenic
1049027198 8:140001237-140001259 ACCAGGGGGGTGAGGGGCTGCGG + Intronic
1049565231 8:143334746-143334768 CGCAGGACGCAGAAGGGCAGTGG - Exonic
1049988520 9:972633-972655 TCCAGGACGGTGTGGGGAAGCGG + Intergenic
1050495271 9:6234408-6234430 AGCAGGGTGGTGAAGGGAAGTGG - Intronic
1050556811 9:6796366-6796388 ACCCGGGAGGTGGAGGGCAGAGG + Intronic
1052387965 9:27844606-27844628 AGCAGCACGGAGAAGTGCAGAGG + Intergenic
1052988025 9:34502153-34502175 ACCAGGGTGGGGAGGGGCAGTGG + Intronic
1053785023 9:41647216-41647238 ACCAGGGCGGTGGAGGGTTGGGG - Intergenic
1054173748 9:61861161-61861183 ACCAGGGCGGTGGAGGGTTGGGG - Intergenic
1054448603 9:65390226-65390248 ACCAGGGCGGTGGAGGGTTGGGG - Intergenic
1054663792 9:67719620-67719642 ACCAGGGCGGTGGAGGGTTGGGG + Intergenic
1054732521 9:68715333-68715355 ACCAGGACCGTGCAGGGCTCTGG - Intronic
1054897794 9:70333428-70333450 TCCAGGAGGCTGAAGCGCAGTGG - Intronic
1054951682 9:70858918-70858940 TCCAGGATGGGGAAGGTCAGGGG + Intronic
1055520041 9:77071646-77071668 ACCTGGGGGGTGAGGGGCAGAGG - Intergenic
1057212189 9:93206361-93206383 GCCAGGGCGGTGAAGGGGTGGGG - Intronic
1057452220 9:95175021-95175043 ATCATGATGGGGAAGGGCAGAGG - Intronic
1057531155 9:95847661-95847683 CCCAGGACCATGAATGGCAGTGG + Intergenic
1058427482 9:104887420-104887442 ACAACCTCGGTGAAGGGCAGAGG + Intronic
1059053120 9:110950207-110950229 CCCAGCACTGTGAAGGGCTGAGG + Intronic
1059275661 9:113094786-113094808 ACAAGGATGGTGCAGGGCAATGG + Intergenic
1060375824 9:123114707-123114729 ACCAGGACGGGGGAAGGCAGGGG - Intronic
1060591588 9:124820469-124820491 GCCAGGAGGGTGATGGGCAGGGG - Intergenic
1061965395 9:134011024-134011046 ACCAGGGCTCAGAAGGGCAGTGG + Intergenic
1062041774 9:134407679-134407701 CCCAGGACGGAGGAGGGCTGGGG - Intronic
1062109780 9:134775811-134775833 ACCAGGGAGGTGAGGGGCAGGGG - Intronic
1186622727 X:11258394-11258416 ACCAAGATGGGGAATGGCAGAGG + Intronic
1187239821 X:17502301-17502323 AGCAGGAGAGTGAAGGGCAGTGG + Intronic
1189111212 X:38291800-38291822 ACCAGGACGTTGTAGGTCATTGG - Intronic
1192261637 X:69509167-69509189 GCCAGGGCGGGGAAGGGCATCGG - Intronic
1192286876 X:69747661-69747683 ACAATGAAGGTGAAGGGAAGTGG + Intronic
1192479340 X:71471276-71471298 ACCAGGCTGGTGGAGTGCAGTGG - Intronic
1192494351 X:71605084-71605106 ACCGGGACGGGGTAGGGAAGGGG - Intronic
1195249888 X:103032504-103032526 ACATGGTCAGTGAAGGGCAGTGG - Intergenic
1196710489 X:118757065-118757087 ACAAGGAAGGAGCAGGGCAGAGG + Intronic
1197918608 X:131563417-131563439 AGGATGAAGGTGAAGGGCAGGGG - Intergenic
1200213739 X:154358299-154358321 GCCAGCAAGGTGAAGGCCAGTGG - Exonic
1201146731 Y:11068857-11068879 ACCTGGATGGTGAGGGGCAGTGG - Intergenic