ID: 945884035

View in Genome Browser
Species Human (GRCh38)
Location 2:215355739-215355761
Sequence GACCTGGTTGGTGGTGACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945884035_945884045 27 Left 945884035 2:215355739-215355761 CCTGTGTCACCACCAACCAGGTC No data
Right 945884045 2:215355789-215355811 CACATTCCTGTGCTTGATTACGG No data
945884035_945884040 0 Left 945884035 2:215355739-215355761 CCTGTGTCACCACCAACCAGGTC No data
Right 945884040 2:215355762-215355784 AAGAAGGAGATTTTGCTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945884035 Original CRISPR GACCTGGTTGGTGGTGACAC AGG (reversed) Intergenic
No off target data available for this crispr