ID: 945884695

View in Genome Browser
Species Human (GRCh38)
Location 2:215362865-215362887
Sequence CCGCGTGCCTTCCCATGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 0, 3: 59, 4: 161}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945884695_945884704 25 Left 945884695 2:215362865-215362887 CCAGTGCATGGGAAGGCACGCGG 0: 1
1: 0
2: 0
3: 59
4: 161
Right 945884704 2:215362913-215362935 GCTGGAGCAGCCCCTGAAGCCGG 0: 1
1: 0
2: 3
3: 30
4: 668
945884695_945884701 7 Left 945884695 2:215362865-215362887 CCAGTGCATGGGAAGGCACGCGG 0: 1
1: 0
2: 0
3: 59
4: 161
Right 945884701 2:215362895-215362917 GGGAGTCCGGGCGCCATTGCTGG 0: 1
1: 0
2: 0
3: 5
4: 88
945884695_945884699 -6 Left 945884695 2:215362865-215362887 CCAGTGCATGGGAAGGCACGCGG 0: 1
1: 0
2: 0
3: 59
4: 161
Right 945884699 2:215362882-215362904 ACGCGGAGCAAGAGGGAGTCCGG 0: 1
1: 0
2: 2
3: 7
4: 126
945884695_945884705 28 Left 945884695 2:215362865-215362887 CCAGTGCATGGGAAGGCACGCGG 0: 1
1: 0
2: 0
3: 59
4: 161
Right 945884705 2:215362916-215362938 GGAGCAGCCCCTGAAGCCGGTGG 0: 1
1: 0
2: 1
3: 28
4: 341
945884695_945884706 29 Left 945884695 2:215362865-215362887 CCAGTGCATGGGAAGGCACGCGG 0: 1
1: 0
2: 0
3: 59
4: 161
Right 945884706 2:215362917-215362939 GAGCAGCCCCTGAAGCCGGTGGG 0: 1
1: 0
2: 2
3: 14
4: 262
945884695_945884700 -5 Left 945884695 2:215362865-215362887 CCAGTGCATGGGAAGGCACGCGG 0: 1
1: 0
2: 0
3: 59
4: 161
Right 945884700 2:215362883-215362905 CGCGGAGCAAGAGGGAGTCCGGG 0: 1
1: 0
2: 0
3: 10
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945884695 Original CRISPR CCGCGTGCCTTCCCATGCAC TGG (reversed) Intronic
900125243 1:1066145-1066167 ACGGGTGCCTTCCCAGACACTGG + Intergenic
900167711 1:1250324-1250346 ACGGGTGCCTTCCCAGGCGCTGG + Intergenic
900220382 1:1505604-1505626 ACGGGTGCCTTCCCAGGCGCTGG + Intergenic
901027794 1:6288177-6288199 CCACGTGCCTTCCCCTGTGCTGG + Intronic
901834182 1:11913030-11913052 ACGGGTGCCTTCCCAGGCACTGG + Intergenic
902465230 1:16613359-16613381 TCGCGTAACTTCCCATTCACAGG + Exonic
903133908 1:21296918-21296940 CCTGCTGCCTTCCCCTGCACAGG - Intronic
903968821 1:27106085-27106107 CCCCCTGCCTTCCCCTGCAGGGG - Exonic
904164497 1:28545020-28545042 ATGGGTGCCTTCCCAGGCACTGG + Intergenic
904378101 1:30094419-30094441 CCGCCTGCCTCCCTATGGACTGG - Intergenic
904713400 1:32448522-32448544 ACGGGTGCCTTCTCAGGCACTGG - Intergenic
906086426 1:43139109-43139131 ACGGGTGCCTTCCCAGGCACTGG - Intergenic
907256858 1:53185853-53185875 ACGGGTGCCTTCCCAGGCACTGG + Intergenic
907294950 1:53444833-53444855 ACGGGTGCCTTCCCAGGCACTGG - Intergenic
907475101 1:54700249-54700271 CCCCCTGGCCTCCCATGCACTGG - Intronic
915559088 1:156676166-156676188 CCGGGTCCCTTCCCAGGCTCTGG - Intronic
916525696 1:165606916-165606938 ACGGGCGCCTTCCCAGGCACTGG + Intergenic
917096702 1:171405247-171405269 ACGGGTGCCTTCCAAGGCACTGG + Intergenic
920365663 1:205447080-205447102 CAGAGTACTTTCCCATGCACTGG + Intronic
922485795 1:225972276-225972298 CATGGTGCCTTCCCATGCTCAGG - Intergenic
1063320492 10:5047285-5047307 ACGGGTGCCTTCCCAGGCACTGG + Intronic
1064176886 10:13082669-13082691 ACGGTTGCCTTCCCAGGCACTGG + Intronic
1065204807 10:23346824-23346846 AGGCGTGCATTACCATGCACAGG - Intergenic
1065899280 10:30190693-30190715 ACGGGGGCCTTCCCAGGCACTGG - Intergenic
1067038051 10:42933618-42933640 CCGCCGGCCTTCCCAGGCCCCGG + Intergenic
1068429341 10:56911742-56911764 ACGGGTGCCTTCCCAGGCACTGG + Intergenic
1069941145 10:71956294-71956316 ACGGGTGCCTTCCCAGGCACTGG - Intergenic
1070170781 10:73931291-73931313 ACGGGTGCCTTCCCAGACACTGG + Intergenic
1072499131 10:95994604-95994626 ACGAGTGCCTTCCCAGACACTGG + Intronic
1072818980 10:98537677-98537699 ACGGGTGCCTTCCCAGACACTGG - Intronic
1073240975 10:102057894-102057916 ACAGGTGCCTTCCCAGGCACTGG - Intergenic
1073342904 10:102759180-102759202 ACGGGTGCCTTCCCAGACACTGG + Intronic
1073928407 10:108544606-108544628 ACGGGTGCCTTCCCAGGCACTGG + Intergenic
1075195938 10:120359263-120359285 CTGCCTGGCTTCCCTTGCACTGG - Intergenic
1076371307 10:129957102-129957124 CCGCGTGTGTTATCATGCACAGG - Intronic
1076688546 10:132209101-132209123 ACGTGTGCCTTTCCATCCACAGG - Exonic
1077001491 11:325427-325449 ACGGGTGCCTTCCCAGGCACTGG + Intronic
1077005673 11:354777-354799 ACGGGTGCCTTCCCAGGCACTGG + Intergenic
1077052523 11:573994-574016 ACGGGTGCCTTCCCAGGCACTGG - Intergenic
1077116724 11:888558-888580 CAGCGTGACTTCCGATGAACAGG + Intronic
1077706682 11:4493388-4493410 ATGGGTGCCTTCCCAGGCACTGG + Intergenic
1083130307 11:60618805-60618827 ACGGGTGCCTTCCGAGGCACTGG + Intergenic
1083618484 11:64037524-64037546 CAGCGTCCCCTCCCAGGCACGGG - Intronic
1083624198 11:64063726-64063748 CCGCGTGGCTGCCCATGGAGGGG - Intronic
1083875578 11:65522428-65522450 ACGGGTGCCTTCCCAGACACTGG + Intergenic
1083894431 11:65613111-65613133 GCGCGTGCCTCCCCATGTGCTGG - Exonic
1084202768 11:67572880-67572902 ACAGGTGCCTTCCCAGGCACTGG - Intergenic
1089395320 11:118132917-118132939 CCCAGTTCCTTCCCAGGCACTGG + Intergenic
1097243061 12:57589484-57589506 ACAGGTGCCTTCCCAGGCACTGG + Intergenic
1098259842 12:68657140-68657162 TTGCGAGCCTTCCCAGGCACTGG - Exonic
1098625464 12:72660449-72660471 ACGGGTGCCTTCCCTGGCACTGG + Intronic
1104596443 12:130123295-130123317 CAGCCTGGCTTCCCTTGCACAGG - Intergenic
1104795864 12:131517014-131517036 ACGGGTGCCTTCCCAGGTACTGG + Intergenic
1104862962 12:131934344-131934366 ACAGGTGCCTTCCCAGGCACTGG + Intronic
1105041379 12:132964159-132964181 ACGGGTGCCTTCCCAGGCGCTGG - Intergenic
1106542760 13:30704630-30704652 CCGAGTGCCCTGCCATCCACTGG - Intergenic
1111215287 13:85133214-85133236 ACAGGTGCCTTCCCAGGCACTGG + Intergenic
1112014097 13:95317173-95317195 ACGGGTGCCTTCCCAGGCACTGG - Intergenic
1113078497 13:106492130-106492152 GCGAGTGCCTCCCCATGCACTGG + Exonic
1114473057 14:22976997-22977019 CCAGGTGGCTTCCTATGCACTGG - Intronic
1116561485 14:46384865-46384887 ACGGGTGCCTTCCCAGGCACAGG + Intergenic
1118331044 14:64816240-64816262 CAGCGTGCCTTTCCATACAGTGG - Intronic
1123188123 14:106539725-106539747 ATGGGTGCCTTCCCAGGCACTGG - Intergenic
1127417051 15:58768538-58768560 ACGGGTGCCTTCCCAGACACTGG - Intergenic
1128107666 15:65056340-65056362 CCGCGTGCCTCACCATGGAGTGG - Intronic
1129468053 15:75734954-75734976 ACGGGTGCCTTCCCAGACACTGG - Intergenic
1129865309 15:78902884-78902906 ATGGGTGCCTTCCCAGGCACTGG + Intergenic
1130011509 15:80156133-80156155 ATGGGTGCCTTCCCAGGCACTGG + Intronic
1133934661 16:10259002-10259024 ACGGGTGCTTTCCCAGGCACTGG - Intergenic
1136575326 16:31120517-31120539 CCGGATCCCTTCCCATCCACGGG + Intronic
1136671158 16:31859630-31859652 TTGCCTGCCTTCCCAGGCACTGG - Intergenic
1136711760 16:32243280-32243302 ACAGGTGCCTTCCCAGGCACTGG - Intergenic
1136756156 16:32686127-32686149 ACAGGTGCCTTCCCAGGCACTGG + Intergenic
1136811957 16:33184246-33184268 ACAGGTGCCTTCCCAGGCACTGG - Intergenic
1136818433 16:33294326-33294348 ACAGGTGCCTTCCCAGGCACTGG - Intronic
1136824997 16:33350859-33350881 ACAGGTGCCTTCCCAGGCACTGG - Intergenic
1136830063 16:33449630-33449652 ACAGGTGCCTTCCCAGGCACTGG - Intergenic
1137017384 16:35391513-35391535 ACCGGTGCCTTCCCAGGCACTGG + Intergenic
1139068899 16:63355997-63356019 AGGGGTGCCTTCCCAGGCACTGG + Intergenic
1139488138 16:67270958-67270980 CTGCCTGCCTCCCCATCCACGGG + Exonic
1142393695 16:89818969-89818991 ACGGGTGCCTTCCCAGACACTGG - Intronic
1202990535 16_KI270728v1_random:7216-7238 ACAGGTGCCTTCCCAGGCACTGG - Intergenic
1203058294 16_KI270728v1_random:946479-946501 ACAGGTGCCTTCCCAGGCACTGG + Intergenic
1142546659 17:708661-708683 ACGGGTGCCTTCCCAGGCACTGG + Intronic
1147819435 17:43232875-43232897 ACGGGTGCCTTCCCAGGCACTGG - Intergenic
1147820024 17:43235905-43235927 ACGGGTGCCTTCCCAGGCACTGG - Intergenic
1147821338 17:43243304-43243326 ACGGGTGCCTTCCCAGGCACTGG - Intergenic
1147822136 17:43247789-43247811 ACGGGTGCCTTCCCAGGCACTGG - Intergenic
1147823059 17:43253233-43253255 ACGGGTGCCTTCCCAGGCACTGG - Intergenic
1147823829 17:43257833-43257855 ACGGGTGCCTTCCCAGGCACTGG - Intergenic
1147825746 17:43268754-43268776 ACGGGTGCCTTCCCAGGCACTGG - Intergenic
1147826876 17:43275219-43275241 ACGGGTGCCTTCCCAGGCACTGG - Intergenic
1147827764 17:43280097-43280119 ACGGGTGCCTTCCCAGGCACTGG - Intergenic
1147828872 17:43286258-43286280 ACGGGTGCCTTCCCAGGCACTGG - Intergenic
1147829967 17:43292401-43292423 ACGGGTGCCTTCCCAGGCACTGG - Intergenic
1147831709 17:43301885-43301907 ACGGGTGCCTTCCCAGGCACTGG - Intergenic
1147835005 17:43323738-43323760 ACGGGTGCCTTCCCAGGCACTGG + Intergenic
1147835154 17:43324772-43324794 ACGGGTGCCTTCCCAGACACTGG + Intergenic
1147836277 17:43334284-43334306 ACGGGTGCCTTCCCAGGCACTGG + Intergenic
1147836286 17:43334335-43334357 ACGGGTGCCTCCCCAGGCACTGG + Intergenic
1147836417 17:43335293-43335315 ACGGGTGCCTTCCCAGGCACTGG + Intergenic
1147838364 17:43351423-43351445 ACGGGTGCCTTCCCAGGCACTGG + Intergenic
1147841207 17:43372798-43372820 ACGGGTGCCTTCCCAGGCACTGG + Intergenic
1147959806 17:44160071-44160093 ACGGGTGCCTTACCAGGCACTGG + Intronic
1147991687 17:44337790-44337812 GCGGGTGCCTTCCCAGGCACTGG + Intergenic
1148054111 17:44783440-44783462 CCGCTTGCCTACCCACGCAGGGG - Intergenic
1148069679 17:44900974-44900996 CCCTTTGCCTTCCCAGGCACAGG + Exonic
1149239494 17:54632539-54632561 TCACGTTCCTTCCCAAGCACTGG + Intergenic
1149569735 17:57663881-57663903 CCCCGTGGCTCCCCATGCCCTGG + Intronic
1155011654 18:21784769-21784791 ACAGGTGCCTTCCCAGGCACTGG - Intronic
1159100129 18:63949287-63949309 CCGCCCGCCTCCCCATTCACTGG + Exonic
1160550396 18:79691336-79691358 CCACCTGCCTTCCCCAGCACAGG - Intronic
1160554222 18:79715550-79715572 CCGCGGGCCTGACCATGCCCAGG - Intronic
1161271586 19:3392661-3392683 CCCCTTGGCTTCCCAGGCACAGG - Intronic
1161870918 19:6869300-6869322 ACGGGTGCCTTCCCAGACACTGG - Intergenic
1162089396 19:8269105-8269127 ACGGGTGCCTTCCCAGGCGCCGG - Intronic
1162292581 19:9791244-9791266 ACGGGTGCCTTCCCAGGCACTGG + Intronic
1162638579 19:11988998-11989020 ACGGGTGCCTTCCCAGGCGCTGG + Intergenic
1163745536 19:19044242-19044264 CGGCATGCCTTCCAATGCAGGGG + Intronic
1164967459 19:32497683-32497705 ACAGGTGCCTTCCCAGGCACTGG + Intergenic
1167314196 19:48754430-48754452 ACGGGTGCCTTCCCAGACACTGG + Intronic
1167318582 19:48781285-48781307 ACGGGTGCCTTCCCAGGCACTGG + Intergenic
1167895507 19:52577676-52577698 ACGGGTGCCTTCCCAGACACTGG - Intronic
1168058613 19:53877916-53877938 ACGGGTGCCTTCCCAGACACTGG + Intergenic
1168084711 19:54037097-54037119 ACGGGTGCCTTCCCAGACACTGG - Intergenic
925159441 2:1673694-1673716 CCACGTTCTTTGCCATGCACTGG + Exonic
925176024 2:1784438-1784460 CCGGGTGCCTTCCCTTCCCCGGG + Intergenic
925451497 2:3973276-3973298 CCGGGTACCTTCCCTTGCCCTGG - Intergenic
931085220 2:58822803-58822825 ACGGGTGCCTTCCCAGACACTGG - Intergenic
931649460 2:64454691-64454713 CCGGGCGCCTTCCCACGCGCCGG - Intronic
931859842 2:66343418-66343440 CCACATGCCATCCCATGCCCAGG - Intergenic
937992468 2:127672344-127672366 CGGCGTGCCACCCCATGCTCTGG + Intronic
938926967 2:136052292-136052314 ATGAGTGCCTTCCCATACACAGG + Intergenic
943233725 2:185291257-185291279 AAGGGTGCCTTCCCAGGCACTGG - Intergenic
945884695 2:215362865-215362887 CCGCGTGCCTTCCCATGCACTGG - Intronic
947936474 2:234009105-234009127 CCCCGAGCCTTCCCTTGCATGGG - Intronic
948225390 2:236305816-236305838 CCAGGTGCCCTCACATGCACTGG + Intergenic
948464286 2:238144808-238144830 CCAGGTGCCTTTCCATGCACCGG - Intronic
1168882152 20:1216340-1216362 ACGGGTGCCTTCCCAGACACTGG - Intergenic
1171041768 20:21770774-21770796 CCTCCTGCCTTCCCCTGCAGGGG + Intergenic
1177611358 21:23452922-23452944 ACGGGTGCCTTCCCAGGCACTGG + Intergenic
1177897545 21:26872300-26872322 ACAGGTGCCTTCCCAGGCACTGG + Intergenic
1179597534 21:42452807-42452829 CCGCGTGGCTCCCCCTGCCCAGG - Intergenic
1180019908 21:45116306-45116328 CTGCGTGCCTTCCCTTGCCTCGG + Intronic
1181163633 22:20971999-20972021 CCACATGCATTCCCATGCTCAGG + Intronic
1182428082 22:30285387-30285409 CTGCGTGTCTGCCCATGCAGGGG - Exonic
1184133408 22:42531480-42531502 ACGAGTGCCTTCCCAGGCACTGG - Intergenic
1184221658 22:43104529-43104551 ACGGGTGCCTTCCCAGGCACTGG + Intergenic
1184546144 22:45169743-45169765 ACAGGTGCCTTCCCAGGCACTGG - Intronic
1185355679 22:50368328-50368350 ACGGGTGCCTTCTCAGGCACTGG + Intronic
1185386517 22:50534198-50534220 ACGGGTGCCTTCCCAGACACTGG - Intergenic
950124600 3:10503697-10503719 CCATGTGCCTGCCAATGCACGGG + Intronic
950124603 3:10503708-10503730 CTGCGTGCCTGCCCGTGCATTGG - Intronic
950589576 3:13926970-13926992 TCACGTGCCTTCTCAAGCACAGG + Intergenic
950792876 3:15487523-15487545 CCAAGTGCCTTCCCATGCAGGGG - Intronic
951403435 3:22263840-22263862 CCAAATGCCCTCCCATGCACAGG + Intronic
953141992 3:40237657-40237679 CTGCTTGACTTCTCATGCACAGG + Intronic
953171819 3:40514000-40514022 ACGGGTGCCTTCCCAGGCACTGG - Intronic
953900157 3:46835603-46835625 ACAGGTGCCTTCCCAGGCACTGG + Intergenic
953900166 3:46835656-46835678 ACGGGTGCCTTCCCAGGCACTGG + Intergenic
954182145 3:48889986-48890008 ACGGGTGCCTTCCCAGGCACTGG - Intronic
962299417 3:134224638-134224660 ACAGGTGCCTTCCCAGGCACTGG + Intronic
962299427 3:134224691-134224713 ACGGGTGCCTTCCCAGGCACTGG + Intronic
968172395 3:196521100-196521122 ATGGGTGCCTTCCCAGGCACTGG - Intergenic
968644045 4:1729829-1729851 ACGGGTGCCTTCCCAGGCACTGG + Intronic
968680168 4:1913232-1913254 ACAGGTGCCTTCCCAGGCACTGG - Intronic
968680176 4:1913285-1913307 ACGGGTGCCTTCTCAGGCACTGG - Intronic
969417209 4:7068457-7068479 CCGCGGGCCTTCCTTTGCTCTGG + Intergenic
971360646 4:25935245-25935267 CTGCTTGTCTTCCCATGCACAGG - Intergenic
973834495 4:54795764-54795786 TCCAGTGGCTTCCCATGCACAGG - Intergenic
977177048 4:93830041-93830063 CCGCGGGGCTTCCCGCGCACTGG - Exonic
978502506 4:109424255-109424277 ACGGGTGCCTTCCCAGGCACTGG - Intergenic
978502517 4:109424308-109424330 ACGGGTGCCTTCCCAGGCACTGG - Intergenic
984712397 4:182896611-182896633 CCTTGTGCCTTCCCAAGCCCGGG - Intronic
986857708 5:11890417-11890439 CTGCCTGCCTTTCCATGTACAGG - Intronic
987500162 5:18698676-18698698 ACGGCTGCCTTCCCAGGCACTGG + Intergenic
992374367 5:76173654-76173676 TTGCGAGCCTTCCCAGGCACTGG + Intronic
996184397 5:120458359-120458381 AGGGGTGCCTTCCCAGGCACTGG + Intergenic
998742863 5:145224928-145224950 CCTGGTGCCTTCCCAGACACTGG + Intergenic
1005576553 6:27195099-27195121 ACGGGTGCCTTCCCAGGCACTGG + Intergenic
1007174105 6:39884638-39884660 CCCCGGGCCTTCCCAGGCCCAGG - Intronic
1016989125 6:149917375-149917397 ACAAGTGCCTTCCCAGGCACTGG + Intronic
1019737509 7:2658025-2658047 CAGCCAGCCTTGCCATGCACAGG + Intronic
1020258498 7:6516533-6516555 ACGGGTGCCTTCCCAGGCACTGG - Intronic
1023995743 7:45157974-45157996 CCGCGGTCCTTCCCTTGCCCCGG + Intronic
1024174093 7:46820398-46820420 ACAGGTGCCTTCCCAGGCACTGG + Intergenic
1026870096 7:73845725-73845747 ACGGGTGCCTTCCCAGACACTGG - Intergenic
1029381490 7:100218101-100218123 ACGGGTGCCTTCCCAGGCACTGG + Intronic
1029400922 7:100345414-100345436 ACGGGTGCCTTCCCAGGCACTGG + Intronic
1034092934 7:148381037-148381059 CCGCGTGCTTACCCCTGCAAGGG - Intronic
1034484517 7:151350368-151350390 ACAGGTGCCTTCCCAGGCACTGG + Intronic
1035254184 7:157615566-157615588 CCGCGGGACTTCCCAGGCGCTGG - Exonic
1035271130 7:157720570-157720592 CCGCGTGCACACCCATGCATCGG - Intronic
1035432785 7:158834878-158834900 ATGGGTGCCTTCCCAGGCACTGG - Intergenic
1041650177 8:60294572-60294594 ACGGGTGCCTTTCCAGGCACTGG - Intergenic
1044159784 8:88898999-88899021 ACAGGTGCCTTCCCAGGCACTGG - Intergenic
1044159791 8:88899052-88899074 ACAGGTGCCTTCCCAGGCACTGG - Intergenic
1046212795 8:111100767-111100789 ACGGGTGCCTTCCCAGGCACTGG - Intergenic
1048042723 8:130746817-130746839 ATGGGTGCCTTCCCAGGCACTGG - Intergenic
1049311005 8:141933849-141933871 CCTCCTGCCTGCCGATGCACGGG + Intergenic
1049846585 8:144805102-144805124 ACTAGTGCCTTCCCAGGCACTGG + Intronic
1051585010 9:18717998-18718020 TTGCGAGCCTTCCCAGGCACTGG + Intronic
1054145808 9:61560027-61560049 CCGGGTGCCTTCCCTTGTCCTGG + Intergenic
1055438862 9:76319591-76319613 ACGGGTGCCTTCCCAGACACTGG - Intronic
1056097672 9:83272228-83272250 CCGCCTGCAATCCCAGGCACTGG - Intronic
1056933980 9:90901780-90901802 ACAGGTGCCTTCCCAGGCACTGG - Intergenic
1061066318 9:128279830-128279852 ACGGGTGCCTTCCCAGACACTGG + Intronic
1061754398 9:132802603-132802625 AAGCGTGCCCTCCCAGGCACCGG + Intronic
1061870149 9:133516131-133516153 ACGCGAGCCTTCCTAAGCACTGG - Intronic
1062095971 9:134703595-134703617 CCGCGTGGCCTCCCATCCAGAGG - Intronic
1062377723 9:136270738-136270760 ACGGGTGCCTTCCCAGACACTGG + Intergenic
1062487301 9:136785668-136785690 ACGGGTGCCTTCCCAGGCACTGG + Intergenic
1062487325 9:136785774-136785796 ACGGGTGCCTTCCCAGGCACTGG + Intergenic
1062639483 9:137511122-137511144 ACGGGTGCCTTCCCAGGCACTGG - Intronic
1062639495 9:137511175-137511197 ACGGGTGCCTTCCCAGGCGCTGG - Intronic
1062639507 9:137511228-137511250 ACGGGTGCCTTCCCAGGCGCTGG - Intronic
1062639532 9:137511334-137511356 ACGGGTGCCTTCCCAGGCACTGG - Intronic
1062639557 9:137511440-137511462 ACGGGTGCCTTCCCAGGCGCTGG - Intronic
1188955708 X:36433278-36433300 ACGGGTGCCTTCCCAGGCACTGG + Intergenic
1193611390 X:83635396-83635418 ACGGTTGCCTTCCCAGGCACTGG + Intergenic
1198272309 X:135066407-135066429 ACGGGTGCCTTCCCAGGCACTGG - Intergenic