ID: 945886787

View in Genome Browser
Species Human (GRCh38)
Location 2:215384299-215384321
Sequence CAAGATAGCGCTCTTTAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 112}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945886787_945886792 14 Left 945886787 2:215384299-215384321 CCCTTTTAAAGAGCGCTATCTTG 0: 1
1: 0
2: 0
3: 7
4: 112
Right 945886792 2:215384336-215384358 TTTATGCATGTAGCAAACCTTGG 0: 1
1: 0
2: 1
3: 16
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945886787 Original CRISPR CAAGATAGCGCTCTTTAAAA GGG (reversed) Intronic
905751178 1:40465593-40465615 CAATATATCTCTCTTCAAAAAGG - Intergenic
906824536 1:48964831-48964853 CAAGATAGCTCTTTTTAAACAGG + Intronic
907336105 1:53700650-53700672 CTAAATAGTGCACTTTAAAAGGG - Intronic
913513620 1:119584211-119584233 AAAGATTGCGCTCTTCAATAAGG - Intergenic
914388997 1:147201269-147201291 CAAGATATCCCTGTATAAAAAGG - Exonic
915593641 1:156884259-156884281 CAAGACAGCCCTCTCTGAAAAGG - Intergenic
919047796 1:192475543-192475565 CAAGATGGCGCTGGTCAAAATGG + Intergenic
922554045 1:226519577-226519599 CAACATAGCTCTCTATAAAGAGG + Intergenic
923018316 1:230143957-230143979 CAAAATAGCACTCTTTTAAATGG + Intronic
1063082441 10:2781528-2781550 CAACATAGCTCTTCTTAAAATGG + Intergenic
1063120236 10:3100822-3100844 GAAGATATAGCTCTTTAAAAGGG + Intronic
1065136870 10:22680075-22680097 CAATAAAGCTGTCTTTAAAAAGG + Intronic
1066481797 10:35803257-35803279 CAAGATAGCTCTTTTCTAAATGG + Intergenic
1067076181 10:43184811-43184833 CAACATAGGTCTCTTTTAAAAGG - Exonic
1068501564 10:57845394-57845416 GAAAATAGCACTCTGTAAAAAGG - Intergenic
1070126481 10:73626097-73626119 CGCGATAGCACTGTTTAAAATGG + Intergenic
1071392326 10:85188483-85188505 AACCATAGTGCTCTTTAAAAAGG + Intergenic
1072467974 10:95684819-95684841 CTGGATAGAGCTCTTTAAAAGGG + Intronic
1073216462 10:101839536-101839558 GAAGACAGCGCTCTTCAAAGAGG - Intronic
1073662147 10:105488350-105488372 CAGGATAGGGTTGTTTAAAAGGG + Intergenic
1073711010 10:106041199-106041221 CAAGAGTTGGCTCTTTAAAAAGG + Intergenic
1081121405 11:39271274-39271296 CCAGTCAGCGCTCTGTAAAATGG + Intergenic
1089415923 11:118290517-118290539 CAAGATCTGGCTGTTTAAAAGGG - Intergenic
1092610897 12:10171686-10171708 CCAGTTAGCTCTCTGTAAAAGGG + Intronic
1093752439 12:22816205-22816227 CATGATAACGCTTTTTCAAATGG - Intergenic
1094095675 12:26701838-26701860 TAAGCTAGTGATCTTTAAAAGGG + Intronic
1097519275 12:60647286-60647308 CAAGTCAGGGCACTTTAAAAAGG - Intergenic
1098538268 12:71620779-71620801 CAAGAAAGAACTCTTTACAAGGG - Intronic
1099803021 12:87480950-87480972 CAAGTTTTCTCTCTTTAAAAAGG - Intergenic
1100078955 12:90824488-90824510 CCAGTCAGCGCTCTGTAAAAGGG + Intergenic
1100446675 12:94667091-94667113 CAAAATAGAGCTCTATAAATTGG - Intergenic
1107774772 13:43826228-43826250 CAATATAGCACTATTTAATATGG - Intronic
1109500697 13:63233833-63233855 CCAATTAGCGCTCTGTAAAATGG + Intergenic
1110472571 13:75876468-75876490 CAAGATAACGGTGTTTTAAAAGG - Intronic
1110964732 13:81678668-81678690 CAACATAGCAATCTTTAAACAGG - Intergenic
1111816406 13:93159253-93159275 CAAGATAACCCACTTAAAAATGG - Intergenic
1113032718 13:106012621-106012643 CAAAATTGCACTCATTAAAAAGG + Intergenic
1115034664 14:28842771-28842793 CCAGTCAGCGCTCTGTAAAATGG + Intergenic
1122476870 14:102016336-102016358 CCAGATATCGCTATTAAAAAGGG - Exonic
1122766003 14:104070612-104070634 CAAGATTGCACTCCTTAGAAAGG - Intergenic
1124702004 15:31923337-31923359 CCAATTAGCGCTCTGTAAAATGG + Intergenic
1125621979 15:41071393-41071415 CAGGATACAGCTTTTTAAAAGGG + Intronic
1128901341 15:71425236-71425258 CAGGATAGCCCTCTGTAAAATGG - Intronic
1131782259 15:95872262-95872284 CCAGTCAGCGCTCTGTAAAATGG - Intergenic
1131807282 15:96135908-96135930 CAAATCAGCGCTCTGTAAAATGG - Intergenic
1138540819 16:57686328-57686350 CGAGATCTCGCTGTTTAAAACGG - Intronic
1139181915 16:64758799-64758821 CGAGATACTACTCTTTAAAATGG + Intergenic
1140237304 16:73171169-73171191 CAAAAAAGCCCTTTTTAAAAAGG + Intergenic
1140952830 16:79835652-79835674 CACAATGGTGCTCTTTAAAAGGG + Intergenic
1147481702 17:40770991-40771013 CATGATAGCTCTTTTTATAACGG + Intronic
1157578843 18:48761626-48761648 CAAGATGGCGCTCTTTATGGTGG + Exonic
1168594732 19:57666099-57666121 GAAGAATGCGCTTTTTAAAAAGG + Intergenic
925712610 2:6756476-6756498 CAAGAGAACGTTCTTAAAAACGG - Intergenic
932946774 2:76243080-76243102 CAAGATTTCACTCTTTTAAATGG + Intergenic
936808427 2:116365701-116365723 CAACATAACGCTGTTGAAAAAGG - Intergenic
937766371 2:125665198-125665220 CCAGTCAGCGCTCTGTAAAATGG - Intergenic
940068987 2:149663632-149663654 CTAGATCGGGCTTTTTAAAAGGG + Intergenic
940921629 2:159314337-159314359 TAAAATAGCGATCATTAAAAAGG + Intergenic
942544711 2:177051397-177051419 CAAAATAGTGCTGATTAAAAGGG - Intergenic
945565615 2:211395159-211395181 CAAGATAGTCCACTTTAAAAAGG - Intronic
945886787 2:215384299-215384321 CAAGATAGCGCTCTTTAAAAGGG - Intronic
1180879539 22:19194037-19194059 CCAATTAGCGCTCTGTAAAATGG - Intronic
952025476 3:29075726-29075748 CCAGATAGTGCTCTTTATATAGG + Intergenic
952230992 3:31430812-31430834 CAAGACACCGCTTTCTAAAATGG - Intergenic
954039181 3:47871189-47871211 CAAGTTAGGGCTCTACAAAATGG + Intronic
957179431 3:76857900-76857922 CAAGTTAGGGTTCCTTAAAAAGG + Intronic
957624880 3:82644074-82644096 CAAGACAGGGCACTTTAGAAAGG + Intergenic
957703789 3:83753611-83753633 CAACAAAGTGTTCTTTAAAATGG - Intergenic
958459392 3:94375161-94375183 CAGGATAGCACTTTTTAACACGG - Intergenic
958546265 3:95555423-95555445 CAAGTTAGCACCCTTAAAAATGG - Intergenic
970125650 4:12806978-12807000 CAAGATATGGTTGTTTAAAAGGG - Intergenic
971268809 4:25118120-25118142 CAAGGTAGAGCTCATTGAAAAGG + Intergenic
971322082 4:25613799-25613821 CCAGTCAGCGCTCTGTAAAATGG - Intergenic
974703716 4:65484535-65484557 CAACATAGCCCTCTGGAAAAAGG + Intronic
981902881 4:149887506-149887528 GAAGTTAGAGCTCCTTAAAAAGG + Intergenic
981931233 4:150191246-150191268 CAAGATAATGCTCCTTCAAAGGG - Intronic
984167139 4:176315969-176315991 CCAGATAATGCTTTTTAAAAAGG - Intergenic
986893925 5:12342121-12342143 CAAGATTGCACTCTTAAACATGG + Intergenic
987797700 5:22651330-22651352 CAAGATTGGGCAATTTAAAAAGG + Intronic
988784891 5:34557493-34557515 TAAGATAGTGCTTCTTAAAATGG - Intergenic
993904192 5:93604670-93604692 AAAAATATCCCTCTTTAAAAGGG - Intergenic
1001188520 5:169602579-169602601 TAAGACAGCCCTGTTTAAAAGGG + Intronic
1004321881 6:14638138-14638160 CAAGAAATCCTTCTTTAAAAAGG - Intergenic
1011563560 6:88648851-88648873 AAAGAAATCGCTCTGTAAAAAGG - Intronic
1012371912 6:98517574-98517596 CAACATAGGGCTATTTATAAAGG + Intergenic
1016727465 6:147391423-147391445 CAATATAATGTTCTTTAAAAAGG - Intergenic
1017380382 6:153821579-153821601 CCAAACAGCGCTCTGTAAAATGG + Intergenic
1021562707 7:21985078-21985100 GGAGATAGTGGTCTTTAAAAAGG - Intergenic
1022218440 7:28288680-28288702 CAGGAAAGCCCTCTTCAAAATGG - Intergenic
1024356075 7:48414769-48414791 CAAGATTTTGATCTTTAAAATGG + Intronic
1032997624 7:137465475-137465497 CAGGACAGAGCTCTTAAAAAGGG + Intronic
1033448594 7:141442697-141442719 CAAGAAAGCCCTCTCTAAAAGGG - Intronic
1036398119 8:8386065-8386087 GAGAATCGCGCTCTTTAAAACGG - Intronic
1038327309 8:26581356-26581378 GAAGATAGTACTTTTTAAAATGG - Intronic
1038810113 8:30832032-30832054 TAACATAGAGATCTTTAAAAAGG - Exonic
1039276572 8:35939085-35939107 CAAAACAGCACTCTGTAAAATGG + Intergenic
1040027815 8:42797435-42797457 CCAGTTAGCTCTCTGTAAAATGG + Intergenic
1040648688 8:49427001-49427023 CCAATTAGCGCTCTGTAAAATGG + Intergenic
1040732901 8:50470907-50470929 CAAATTAGCTCTCTGTAAAATGG - Intronic
1041000303 8:53442896-53442918 CCAGCCAGCGCTCTGTAAAATGG - Intergenic
1041998946 8:64098690-64098712 CATGTTAGATCTCTTTAAAATGG + Intergenic
1045545941 8:103128331-103128353 CATGATCTCACTCTTTAAAATGG + Intergenic
1048142391 8:131807109-131807131 CAAGATAGCTCTCTTCTAACTGG + Intergenic
1049295394 8:141831259-141831281 CAATAAAGCTCTCATTAAAATGG - Intergenic
1050468039 9:5952325-5952347 CCAGATTGAGCTGTTTAAAATGG - Intronic
1050709201 9:8440748-8440770 CAAGATGGCTCCCTTTAATAGGG + Intronic
1051178608 9:14386453-14386475 TAAGATAGTGCTCTTCAGAAGGG - Intronic
1051643225 9:19243014-19243036 CAAGATACCCCCCTTTAAATTGG - Intronic
1052535750 9:29744705-29744727 CAAAATAGGGCTCTTTTAATTGG + Intergenic
1055941182 9:81651531-81651553 CAAGAGAGCGCTCTTTTCATTGG + Intronic
1057708553 9:97416208-97416230 AAAGATAGCATACTTTAAAAAGG + Intronic
1057838478 9:98465995-98466017 CAAGATCGGGTTGTTTAAAAGGG + Intronic
1058059459 9:100479389-100479411 CAAGATAGGATTTTTTAAAAGGG + Intronic
1058423530 9:104856312-104856334 CAAGAGACCTCTCTTCAAAATGG - Intronic
1058837659 9:108873535-108873557 CAAGAAAGTGCTCTTTGAAGTGG + Intronic
1059465334 9:114465852-114465874 ACAGTTAGCCCTCTTTAAAATGG + Intronic
1192877465 X:75247037-75247059 CAAGTTATCCCTCTTTTAAAAGG + Intergenic
1193305007 X:79938728-79938750 CAAGATAGCCTTCTTTTTAAAGG + Intergenic
1201648408 Y:16260534-16260556 CAAATCAGCGCTCTGTAAAATGG - Intergenic
1201654402 Y:16324767-16324789 CAAATCAGCGCTCTGTAAAATGG + Intergenic