ID: 945889954

View in Genome Browser
Species Human (GRCh38)
Location 2:215419835-215419857
Sequence TTTCTTAGAAGCTGCTCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 8, 3: 20, 4: 197}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945889954_945889958 27 Left 945889954 2:215419835-215419857 CCTGCTGAGCAGCTTCTAAGAAA 0: 1
1: 0
2: 8
3: 20
4: 197
Right 945889958 2:215419885-215419907 GTAATCTCACGTCAAACAAACGG 0: 1
1: 0
2: 0
3: 6
4: 82
945889954_945889957 5 Left 945889954 2:215419835-215419857 CCTGCTGAGCAGCTTCTAAGAAA 0: 1
1: 0
2: 8
3: 20
4: 197
Right 945889957 2:215419863-215419885 TCAGGCTTCTCTCTCAGTTCTGG 0: 1
1: 0
2: 2
3: 20
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945889954 Original CRISPR TTTCTTAGAAGCTGCTCAGC AGG (reversed) Intronic
900251080 1:1670115-1670137 TTTCAAAAAAGCTGCTCAGCGGG - Exonic
907634453 1:56119325-56119347 TTTCTAAGATCCTTCTCAGCTGG + Intergenic
908189187 1:61683887-61683909 TGTATTAGGAGCTGCTGAGCTGG - Intronic
909857524 1:80556950-80556972 TTCCTTAGAAGGTCCCCAGCAGG + Intergenic
912045926 1:105457280-105457302 TTTCTGAGAAACTGATCAGGTGG - Intergenic
913544874 1:119858340-119858362 TTTCTCAGCAGCTGCACAGTGGG - Intergenic
913992254 1:143625519-143625541 TTTCTCAGCAGCTGCACAGTAGG - Intergenic
916541736 1:165763028-165763050 TTTGTTAAAAGCAGCTCAGTAGG + Intronic
916825422 1:168437818-168437840 TTTCTGAGAAGCAGGTTAGCAGG - Intergenic
917551446 1:176034921-176034943 TTTCTTAGTAGGTGATCAGTTGG - Intronic
918860650 1:189822034-189822056 TTTCCAAGAATCTGCTCAGCAGG - Intergenic
920022166 1:202964785-202964807 TGTCATAGCAGCTGCTCAACTGG - Intronic
921286684 1:213615729-213615751 TGTCTTAGCAGCAGCTCAGCTGG - Intergenic
921442541 1:215204953-215204975 TTTATTAGAAGCTGTTCATTTGG - Intronic
924027845 1:239855957-239855979 TTTCTTAGCAGTTTCTCAGGAGG + Intronic
1064016045 10:11773151-11773173 TTTCTCAGAAGATCCCCAGCAGG + Intergenic
1064699641 10:18005919-18005941 TTGTTTAGAAGTTGCTCAGAAGG - Intronic
1067134419 10:43595427-43595449 TTTCTGATAAGCTGCTAAACAGG + Intergenic
1068736788 10:60422314-60422336 GTACATAGAAGATGCTCAGCAGG - Intronic
1070517774 10:77224283-77224305 TTTTTTAGAAACTGTTCAGAAGG - Intronic
1070646531 10:78205692-78205714 CTTCACAGAAGCAGCTCAGCAGG + Intergenic
1073275633 10:102308112-102308134 TTTCTAAGAATATGCCCAGCAGG + Intronic
1073867658 10:107823696-107823718 TTACTTAGAAGCTCCAGAGCTGG + Intergenic
1075310160 10:121407132-121407154 TTTATTGGAAGCATCTCAGCTGG - Intergenic
1076409181 10:130233712-130233734 GTTCTTAGAAGCTGCAGGGCTGG + Intergenic
1077344189 11:2038878-2038900 GTTCTTAGCTCCTGCTCAGCTGG + Intergenic
1077840305 11:5967549-5967571 TTTTTTACAACCTCCTCAGCAGG + Exonic
1084712416 11:70852260-70852282 TTTCTTTAAAGCTTCTAAGCAGG - Intronic
1086971791 11:93089434-93089456 TTCTTTAGAAGCTGCTTATCTGG + Intergenic
1088533749 11:110837993-110838015 TTTCTGATAAGCAGCTCAGAGGG + Intergenic
1089367519 11:117930162-117930184 GTTCTCAGCAGCAGCTCAGCTGG - Intergenic
1090368605 11:126229232-126229254 CTTCTCAGAAGCTGCACAGGAGG + Exonic
1091004411 11:131939681-131939703 ATTCTTGCAAGCTGCTCATCTGG + Intronic
1202827175 11_KI270721v1_random:94067-94089 GTTCTTAGCTCCTGCTCAGCTGG + Intergenic
1094089768 12:26635730-26635752 TTTATAAGGAGCTGCTAAGCTGG - Intronic
1095527987 12:43150964-43150986 TGCCTTAAAAGCTACTCAGCTGG - Intergenic
1096142233 12:49251995-49252017 TTTCTTAGAAGCCCCTTATCTGG - Intronic
1097154804 12:57004914-57004936 TTTCATAGGAGCTGCTAAGATGG - Exonic
1100227579 12:92574438-92574460 TTTCTTAGCAGCAGCACAGCTGG - Intergenic
1103562252 12:121798832-121798854 TGTCTAAGAAGCTCCACAGCTGG - Intronic
1104223354 12:126807558-126807580 TTTCTTGGCAGCTGTTCAGCAGG - Intergenic
1107860750 13:44658814-44658836 GTTCATAGAAGGTGCTCAGTAGG + Intergenic
1108468068 13:50738936-50738958 TTTTTTAGAGGCTGCTCACTGGG - Intronic
1108611614 13:52089290-52089312 TTTCTCTGAAGGTACTCAGCAGG + Exonic
1109593174 13:64514101-64514123 TTTGTGAGAAACTGCTGAGCAGG + Intergenic
1110112837 13:71771043-71771065 TTTATAAGAAGCTGCTCATTAGG + Intronic
1113505939 13:110815922-110815944 TTGATTAGAAGATGCCCAGCTGG - Intergenic
1113994577 14:16055687-16055709 TTTCTTGGAAGCTGCCCAGCGGG - Intergenic
1114802101 14:25788059-25788081 TTTCTTAGAAGCTGCTCAAGGGG + Intergenic
1115428955 14:33293967-33293989 TTACTTAGCACCTGCACAGCAGG - Intronic
1117941807 14:60975456-60975478 TTTCCCAGAAACTGCTCACCTGG + Exonic
1120247586 14:82025303-82025325 TTTCTCAACAGCTTCTCAGCTGG - Intergenic
1121544621 14:94754376-94754398 TTTCTCTGAAGGTGCTCAGGAGG - Intergenic
1122831493 14:104399453-104399475 TTTCCGAGAAGCTGCTCTCCGGG - Intergenic
1125677541 15:41511030-41511052 TTTGTTTGGAGCTGCTGAGCAGG + Intronic
1125832389 15:42726126-42726148 TTTGCCAGATGCTGCTCAGCAGG + Exonic
1126805750 15:52347352-52347374 TTTTTTAGAGGCTACACAGCAGG - Intronic
1129142941 15:73618212-73618234 TTTCTCAGAAACAGCTCAGCTGG - Intronic
1130120043 15:81040104-81040126 CTTCTCAGAAGCTGCAGAGCAGG + Intronic
1130965954 15:88697875-88697897 TTGCTTAGAACCTGCACACCTGG - Intergenic
1132049612 15:98596287-98596309 TTTCTTAGTTGCTCCTCAGACGG - Intergenic
1132190619 15:99853256-99853278 TTTGTTAGAAACTGCCAAGCTGG + Intergenic
1132738344 16:1398457-1398479 TTACTCGGAAGCTGCTCAGAGGG + Exonic
1135244498 16:20843957-20843979 AGTCCTAGAAGCTGCCCAGCTGG + Exonic
1135974191 16:27096507-27096529 TTGCTTAGATGCTCCTCAGTGGG - Intergenic
1136913304 16:34161152-34161174 TTTCTTGGAAGCTGCCCAGCGGG - Intergenic
1144078229 17:11737987-11738009 TTACTTAGAACAAGCTCAGCAGG + Intronic
1146860155 17:36290255-36290277 TGGATTAGAAGGTGCTCAGCTGG + Intronic
1147090481 17:38094346-38094368 TGGATTAGAAGGTGCTCAGCTGG + Intergenic
1147106732 17:38226180-38226202 TGGATTAGAAGGTGCTCAGCTGG - Intergenic
1148422791 17:47562357-47562379 TGGATTAGAAGGTGCTCAGCTGG + Intronic
1150488936 17:65561407-65561429 TTTCTTTGAAGCGGCTCCGCTGG + Intronic
1151807631 17:76416432-76416454 TTTCCCAGAAGCAGCTCAGAGGG - Intronic
1152371324 17:79890500-79890522 TTCCTTAGGATATGCTCAGCAGG - Intergenic
1153166042 18:2263190-2263212 TTTCAGAGAATCTGCTCAGAAGG - Intergenic
1154254610 18:12771604-12771626 CTTCTTAGAAGCTTCTAGGCCGG - Intergenic
1157436319 18:47672554-47672576 TTTCTTGGGAGCAGCTGAGCAGG + Intergenic
1158423000 18:57312772-57312794 TCTGTCAGCAGCTGCTCAGCAGG - Intergenic
1158514505 18:58119860-58119882 TTGCTTAGAAGCTGCCCGGGTGG + Intronic
1158630688 18:59111685-59111707 TTTCTTAGAAGCTGGTAAATTGG - Intergenic
1159139435 18:64374970-64374992 TTTCTTAGAAACTGCTCATGAGG + Intergenic
1162040754 19:7969529-7969551 TTTCTGAGCTGCTGCTCAGAAGG + Intronic
1163359119 19:16834555-16834577 TCACTTAGTAGCTACTCAGCAGG + Intronic
1164917929 19:32066717-32066739 TCTCATGGAAGTTGCTCAGCTGG - Intergenic
1165243581 19:34484766-34484788 TTTCTGAGGAGCTGCTAGGCCGG + Intronic
1167139795 19:47642402-47642424 TTTGTTAGAAACTGCCCACCTGG + Intronic
925415084 2:3664430-3664452 TTTCTTGGAAGCTGCTGAAAAGG + Intronic
926131656 2:10306718-10306740 TTTCTTAGATGCTGATGAGCAGG + Intronic
926936416 2:18090262-18090284 GTTCTTACAAGCTGCCCAGGTGG - Intronic
927746276 2:25624420-25624442 TTTAGTAGAAGCTGCTCACAGGG + Intronic
928179926 2:29061845-29061867 TGTCTGAGAAGCTGTACAGCTGG + Exonic
928616927 2:33050221-33050243 TTTATTAAAAGGTTCTCAGCAGG - Intronic
930257209 2:49106035-49106057 TTCCTAATAAGCTGCTCAGAAGG - Intronic
930783437 2:55247019-55247041 TTTTTTAAAGGCTGCACAGCTGG - Intronic
931569239 2:63650724-63650746 TTTCTTAGCAACTGACCAGCTGG + Intronic
932966580 2:76482519-76482541 TGTCTTAGAAACTGCTAAGAAGG + Intergenic
933805579 2:85996409-85996431 TTCCTCAGGAGCTGCTCACCTGG - Intergenic
934047725 2:88186221-88186243 TTTCCGGGAGGCTGCTCAGCTGG + Exonic
935365102 2:102280626-102280648 TCTCTTAGAAGAGGCTGAGCTGG + Intergenic
935424175 2:102902627-102902649 GTTCTTAGGACCTGCTCAGTTGG + Intergenic
937494926 2:122408421-122408443 TTTCTCAGAAGCAGCACAGCAGG + Intergenic
938536894 2:132255065-132255087 TTTCTTGGAAGCTGCCCAGCGGG + Intronic
939136759 2:138305459-138305481 TTTCCAAGAAGCTCCACAGCAGG + Intergenic
940013885 2:149083127-149083149 TTTTTTAGAAACTGCTCTGCAGG - Intronic
940434945 2:153640322-153640344 TTTCTTAGATGCTTCTCATATGG - Intergenic
945237115 2:207641305-207641327 TTTCTCAGATACTGATCAGCTGG - Intergenic
945889954 2:215419835-215419857 TTTCTTAGAAGCTGCTCAGCAGG - Intronic
946101403 2:217327795-217327817 TTTCTCAGCAGGTGCTGAGCAGG + Intronic
946407829 2:219501538-219501560 GTTCCTAGAAGCCGCCCAGCAGG + Exonic
946639516 2:221768525-221768547 TTTCCTAGAAGCTTCTCACATGG - Intergenic
948074846 2:235157970-235157992 TAGCATAGAAGCTCCTCAGCAGG + Intergenic
948224529 2:236298826-236298848 ATTGCTGGAAGCTGCTCAGCTGG + Intergenic
1169419167 20:5445517-5445539 TAGCTCAGAAGCAGCTCAGCTGG + Intergenic
1169717660 20:8638653-8638675 TTTCTTAAAAGTTGTTCAGAGGG - Intronic
1170209733 20:13836691-13836713 TTTCTCAGAAGGTGTCCAGCAGG - Intergenic
1171169154 20:23000157-23000179 TTGTTTACAAGCTGCTCAGAAGG - Intergenic
1171259539 20:23719658-23719680 TTTCATAGAATGTCCTCAGCTGG + Intergenic
1171268604 20:23795125-23795147 TTTCATAGAACGTCCTCAGCTGG + Intergenic
1171767668 20:29299021-29299043 TTTCTTGGAAGCTGCCCAGTGGG + Intergenic
1171865795 20:30486842-30486864 TTTCTTGGAAGCTGCCCAGCGGG + Intergenic
1175346607 20:58283138-58283160 TTTGTTAGAATCTGGTGAGCTGG + Intergenic
1175752930 20:61511494-61511516 TTTCTTAGTAGCTGCAGAGAGGG - Intronic
1175763294 20:61575788-61575810 TTTATCATATGCTGCTCAGCAGG - Intronic
1179211946 21:39332299-39332321 TTACTTAGAAGCTCCAGAGCAGG + Intergenic
1179401502 21:41088460-41088482 GTGCTTAAAAGCTGCTCAGGAGG + Intergenic
1179797811 21:43795502-43795524 TTTATAAGAAGCTCCTCGGCTGG - Intronic
1180312514 22:11251717-11251739 TTTCTTGGAAGCTGCCCAGCGGG + Intergenic
1180342738 22:11630668-11630690 TTTCTTGGAAGCTGCCCAGCGGG - Intergenic
1180580474 22:16831440-16831462 CTTCTGAAAAGCTGCGCAGCTGG - Intergenic
1180814807 22:18782661-18782683 TTTTTTAGGAGGGGCTCAGCAGG + Intergenic
1180902085 22:19381079-19381101 TTTCTTTGAAGCCTCTCAGTAGG + Intronic
1180905410 22:19407131-19407153 ATTTTTAGAAGCTGCTTTGCTGG - Intronic
1181031146 22:20149366-20149388 CTTCTGAGACCCTGCTCAGCTGG + Intronic
1181200993 22:21216997-21217019 TTTTTTAGGAGGGGCTCAGCAGG + Intronic
1181700747 22:24619973-24619995 TTTTTTAGGAGGGGCTCAGCAGG - Intronic
1184368196 22:44066061-44066083 TTTCTTAAAAGCTGCTAAAAAGG + Intronic
1184639347 22:45860881-45860903 GCTCTTAGAAGATGCTGAGCAGG + Intergenic
1184880544 22:47301788-47301810 TTTGATACAAACTGCTCAGCTGG + Intergenic
957372263 3:79310256-79310278 TCTGTTAAAAGCTGCTCATCTGG + Intronic
960513130 3:118574241-118574263 TTTTTAAGAAGTTGCTAAGCTGG - Intergenic
960572441 3:119198337-119198359 TTTGGTAGAGGCTGCTCAGATGG + Intronic
962904486 3:139789560-139789582 TTTCTTAGATGAAGCTGAGCAGG + Intergenic
965288843 3:166849930-166849952 ATTCTCAGTGGCTGCTCAGCTGG - Intergenic
965900230 3:173630958-173630980 TTTCTTTGAAGCTCCCCATCTGG - Intronic
966781639 3:183589307-183589329 TTTCTTAGATCCTGCCCAGGAGG - Intergenic
968138290 3:196235235-196235257 TTTTTTGGAGGCTGCACAGCTGG - Exonic
969262123 4:6040702-6040724 TTTCTCAGGACCTGTTCAGCAGG - Exonic
969434207 4:7175626-7175648 TTTTGTAGAAGCTGATAAGCTGG - Intergenic
969552248 4:7878313-7878335 TTTCTTACCAGCTGTGCAGCAGG + Intronic
970125287 4:12802842-12802864 TCTGTTAGAAGCTGCTGAGCAGG + Intergenic
972348396 4:38212783-38212805 TTAAATAGAAGCTACTCAGCTGG + Intergenic
972558095 4:40200385-40200407 TTTCTTAAAAGCTCCCCAGGTGG - Intronic
972640962 4:40924530-40924552 CTTCTTAGAAGCTGGACACCAGG + Intronic
973018766 4:45173037-45173059 TTTTTGAGAATCTGCGCAGCTGG + Intergenic
974730562 4:65859453-65859475 TTTATTTCAAGCTGCTCAGTAGG + Intergenic
978504774 4:109444743-109444765 TTTCAATGGAGCTGCTCAGCTGG - Intronic
981637442 4:146897280-146897302 TTTCTGAGAAGCTGGCCTGCAGG - Intronic
982316006 4:154033012-154033034 TCTCTTAAAAGCTACTCAGGAGG - Intergenic
983204966 4:164902359-164902381 GTTCCTAGAGGCAGCTCAGCAGG + Intergenic
983733054 4:171022088-171022110 TTTTTTAAAAGCTGCTCAGTTGG - Intergenic
985150909 4:186946169-186946191 TTTCTCTGATGCTGCTCTGCTGG - Intergenic
987434484 5:17877530-17877552 TGTCATAGAAACTGCTCACCTGG + Intergenic
989110395 5:37901843-37901865 TTTCTTAGAGGGTCCCCAGCAGG - Intergenic
990640023 5:57772590-57772612 TTTTTCAGAAGCTTCTTAGCAGG - Intergenic
991056758 5:62328872-62328894 TTTCTAAAAAGCTGCACAACGGG + Intronic
992580346 5:78168518-78168540 TTTTTTAGAAGTTGTCCAGCTGG - Intronic
994466839 5:100146279-100146301 TTCCTTTCAAGCTACTCAGCTGG + Intergenic
996658752 5:125973497-125973519 TTTTTTATAAGCTCTTCAGCTGG + Intergenic
998376095 5:141691893-141691915 TCTATTAGGAGCTTCTCAGCAGG - Intergenic
1000508212 5:162148310-162148332 TTTCTTTGAATCTTCACAGCAGG - Intronic
1001170301 5:169413216-169413238 AATCTTAGAAGCAGGTCAGCTGG + Intergenic
1004212041 6:13658306-13658328 TTTATTAAAAACCGCTCAGCAGG + Intronic
1005697575 6:28365461-28365483 TTTTCTGGAAGCTCCTCAGCTGG - Exonic
1008827398 6:55713629-55713651 GTTCTGAGTAGCTGCACAGCTGG + Intergenic
1009716668 6:67406252-67406274 TTTGCAAGATGCTGCTCAGCTGG - Intergenic
1009932526 6:70193370-70193392 TTTCTGAGAAGCTCCTCCTCTGG + Intronic
1011641681 6:89421708-89421730 TTTCCTAGAAGTTCCCCAGCAGG - Intergenic
1012704051 6:102498793-102498815 TTTGTTAGAAGTTGGTCATCTGG - Intergenic
1013658219 6:112267647-112267669 TTTCTCAGAGGCTGCTAACCAGG + Intergenic
1015620744 6:135129327-135129349 TTTCCTAGCAGCTGCCCAGAGGG + Intergenic
1016899658 6:149089025-149089047 TTCCTTAGAAGCTGACCAGGGGG - Intergenic
1019796159 7:3050284-3050306 TTTTTGAAAAGCTGCTCAGAGGG + Intergenic
1020051315 7:5083789-5083811 TTTCTTACAAGCTCCTCAGTAGG - Intergenic
1023895316 7:44428091-44428113 TTTCTTATAAACTGCTTGGCAGG + Intronic
1031477998 7:122246515-122246537 TTTGTTAAAAACTGATCAGCTGG - Intergenic
1038267645 8:26048602-26048624 TTACTTAGAAACTGCTCTCCTGG + Intergenic
1040439402 8:47425263-47425285 TTACTCAGCAGTTGCTCAGCAGG + Intronic
1040478514 8:47802597-47802619 TGTCTTCGAAGCTGCTCTGGAGG - Intronic
1041356511 8:57006155-57006177 TTCCTTAGAAGCTGTTTAGGGGG + Intergenic
1041538636 8:58957061-58957083 TTTCTGACCAGCTGCTCATCTGG + Intronic
1041902266 8:62995431-62995453 TACAGTAGAAGCTGCTCAGCTGG + Intronic
1042523416 8:69738832-69738854 TTTCTTGGAGGCAGCTCAGCAGG - Intronic
1042949620 8:74187457-74187479 TTGCTTGGCAGATGCTCAGCTGG - Intergenic
1042992533 8:74656701-74656723 TGTCTTTGAACCTGCTCAGGAGG + Intronic
1043198209 8:77328138-77328160 TTTCTTGGAAGCAACTTAGCTGG + Intergenic
1049996317 9:1037463-1037485 TTGCTTAGAAACTGCTCCACTGG + Intergenic
1050110773 9:2213612-2213634 TTGCTTATAAGCTGTTAAGCAGG + Intergenic
1051001918 9:12292555-12292577 CCTCTTAGAATCTGCTGAGCTGG + Intergenic
1051198778 9:14594023-14594045 TTTCTTAGATGCTGCTCTGTGGG - Intergenic
1052031684 9:23636357-23636379 CTTCTGAGGAGCTGCCCAGCTGG + Intergenic
1052781701 9:32788061-32788083 TTTCAAAGCAGCTGCTTAGCAGG - Intergenic
1054721428 9:68607949-68607971 TTTTTTAAAAGCTCCTCAGATGG + Intergenic
1056128708 9:83563352-83563374 TTACTCAGAGGCTGCTTAGCAGG - Intergenic
1056517192 9:87365302-87365324 TATATTAAAAGGTGCTCAGCCGG + Intergenic
1056674546 9:88663899-88663921 TTTATAAGAAGCTGCCAAGCTGG - Intergenic
1056985512 9:91361171-91361193 TAAATTTGAAGCTGCTCAGCTGG - Intronic
1058482024 9:105405554-105405576 TTTCACAGATGCTGCTAAGCTGG - Intronic
1058941700 9:109819131-109819153 TTTCTTATAAGATGCTCTGCAGG - Intronic
1058945529 9:109852059-109852081 TTTTTTAAAAGCTGATCATCTGG - Intronic
1059427291 9:114229140-114229162 TTTCTTAGCAAAGGCTCAGCTGG + Intronic
1059710827 9:116866283-116866305 TTACTAAGAACCTCCTCAGCAGG + Intronic
1062154609 9:135039715-135039737 TCTCAGAGGAGCTGCTCAGCGGG - Intergenic
1203361015 Un_KI270442v1:219180-219202 TTTCTTGGAAGCTGCCCAGCGGG + Intergenic
1187550177 X:20294730-20294752 TTTCTTGGCAGCTGTTCTGCTGG + Intergenic
1189215641 X:39320781-39320803 TTTCTCAGAGGGTTCTCAGCAGG - Intergenic
1189340279 X:40199892-40199914 CTTCTTGGCAGCTGCTCAGAGGG - Intergenic
1192028838 X:67487349-67487371 TTTCTTATAATGTGCTCATCTGG - Intergenic
1193625761 X:83818837-83818859 TTTCTTAAAAGCTGGTGGGCTGG + Intergenic
1195719993 X:107857897-107857919 TTTCTCAGAAGCGCCTTAGCTGG - Intronic
1196654228 X:118200204-118200226 TTTCTTGGAGGCTGCCCAGCAGG + Intergenic
1196828940 X:119761251-119761273 TTTTTTAAATGCTGCTGAGCAGG - Intergenic
1197641228 X:128970390-128970412 GTTCATAAAAGCAGCTCAGCAGG + Intergenic
1197760254 X:130023001-130023023 TTTCATAGAAGATGCTGAGAGGG - Intronic
1197918312 X:131560369-131560391 TGTCTTAGGAGCTGGGCAGCAGG - Intergenic
1200379269 X:155817512-155817534 TTTTTTAGAAACAGCTCATCAGG - Intergenic
1201077432 Y:10198359-10198381 TTTCTGGGAAGCTGCCCAGCGGG - Intergenic