ID: 945896711

View in Genome Browser
Species Human (GRCh38)
Location 2:215491186-215491208
Sequence ATTCGTGTTGTTCCACATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945896709_945896711 26 Left 945896709 2:215491137-215491159 CCTTCAAAAGTGACTGTATCATG No data
Right 945896711 2:215491186-215491208 ATTCGTGTTGTTCCACATCCTGG No data
945896710_945896711 -5 Left 945896710 2:215491168-215491190 CCACTAGCAATGAACGAGATTCG No data
Right 945896711 2:215491186-215491208 ATTCGTGTTGTTCCACATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945896711 Original CRISPR ATTCGTGTTGTTCCACATCC TGG Intergenic
No off target data available for this crispr