ID: 945897028

View in Genome Browser
Species Human (GRCh38)
Location 2:215495023-215495045
Sequence ATTCCTGTTGTTCCACATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945897028_945897029 -8 Left 945897028 2:215495023-215495045 CCAGGATGTGGAACAACAGGAAT No data
Right 945897029 2:215495038-215495060 ACAGGAATCTCATTCATTGCTGG No data
945897028_945897030 -5 Left 945897028 2:215495023-215495045 CCAGGATGTGGAACAACAGGAAT No data
Right 945897030 2:215495041-215495063 GGAATCTCATTCATTGCTGGTGG No data
945897028_945897033 8 Left 945897028 2:215495023-215495045 CCAGGATGTGGAACAACAGGAAT No data
Right 945897033 2:215495054-215495076 TTGCTGGTGGGGATGCAAAACGG 0: 18
1: 268
2: 1080
3: 2335
4: 3861
945897028_945897031 -4 Left 945897028 2:215495023-215495045 CCAGGATGTGGAACAACAGGAAT No data
Right 945897031 2:215495042-215495064 GAATCTCATTCATTGCTGGTGGG No data
945897028_945897032 -3 Left 945897028 2:215495023-215495045 CCAGGATGTGGAACAACAGGAAT No data
Right 945897032 2:215495043-215495065 AATCTCATTCATTGCTGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945897028 Original CRISPR ATTCCTGTTGTTCCACATCC TGG (reversed) Intergenic
No off target data available for this crispr