ID: 945897029

View in Genome Browser
Species Human (GRCh38)
Location 2:215495038-215495060
Sequence ACAGGAATCTCATTCATTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945897022_945897029 20 Left 945897022 2:215494995-215495017 CCAAAACATTGACAACACCAAAG No data
Right 945897029 2:215495038-215495060 ACAGGAATCTCATTCATTGCTGG No data
945897028_945897029 -8 Left 945897028 2:215495023-215495045 CCAGGATGTGGAACAACAGGAAT No data
Right 945897029 2:215495038-215495060 ACAGGAATCTCATTCATTGCTGG No data
945897026_945897029 3 Left 945897026 2:215495012-215495034 CCAAAGGCTAGCCAGGATGTGGA No data
Right 945897029 2:215495038-215495060 ACAGGAATCTCATTCATTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945897029 Original CRISPR ACAGGAATCTCATTCATTGC TGG Intergenic
No off target data available for this crispr