ID: 945897030

View in Genome Browser
Species Human (GRCh38)
Location 2:215495041-215495063
Sequence GGAATCTCATTCATTGCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945897026_945897030 6 Left 945897026 2:215495012-215495034 CCAAAGGCTAGCCAGGATGTGGA No data
Right 945897030 2:215495041-215495063 GGAATCTCATTCATTGCTGGTGG No data
945897028_945897030 -5 Left 945897028 2:215495023-215495045 CCAGGATGTGGAACAACAGGAAT No data
Right 945897030 2:215495041-215495063 GGAATCTCATTCATTGCTGGTGG No data
945897022_945897030 23 Left 945897022 2:215494995-215495017 CCAAAACATTGACAACACCAAAG No data
Right 945897030 2:215495041-215495063 GGAATCTCATTCATTGCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945897030 Original CRISPR GGAATCTCATTCATTGCTGG TGG Intergenic
No off target data available for this crispr